Table Of Contentdiversity
Article
The Biogeography of Great Salt Lake Halophilic
Archaea: Testing the Hypothesis of Avian
Mechanical Carriers
BexL.Kemp†,ErinM.Tabish†,AdamJ.Wolford†,DanielL.Jones,JaimiK.Butlerand
BonnieK.Baxter*
GreatSaltLakeInstitute,WestminsterCollege,1840South1300East,SaltLakeCity,UT84105,USA;
[email protected](B.L.K.);[email protected](E.M.T.);[email protected](A.J.W.);
[email protected](D.L.J.);[email protected](J.K.B.)
* Correspondence:[email protected];Tel.:+1-801-832-2345
† Authorscontributedequally.
(cid:1)(cid:2)(cid:3)(cid:1)(cid:4)(cid:5)(cid:6)(cid:7)(cid:8)(cid:1)
Received:1November2018;Accepted:20November2018;Published:27November2018 (cid:1)(cid:2)(cid:3)(cid:4)(cid:5)(cid:6)(cid:7)
Abstract: Halophilicarchaeainhabithypersalineecosystemsglobally,andgeneticallysimilarstrains
havebeenfoundinlocalesthataregeographicallyisolatedfromoneanother. Wesoughttotestthe
hypothesisthatsmallsaltcrystalsharboringhalophilicarchaeacouldbecarriedonbirdfeathersand
thatbirdmigrationisadrivingforceofthesedistributions. Inthisstudy, wediscoveredthatthe
AmericanWhitePelicans(AWPE)atGreatSaltLakesoakinthehypersalinebrineandaccumulate
salt crystals (halite) on their feathers. We cultured halophilic archaea from AWPE feathers and
halite crystals. The microorganisms isolated from the lakeshore crystals were restricted to two
genera: Halorubrum and Haloarcula, however, archaea from the feathers were strictly Haloarcula.
WecomparedpartialDNAsequenceofthe16SrRNAgenefromourcultivarswiththatofsimilar
strainsintheGenBankdatabase. Tounderstandthebiogeographyofgeneticallysimilarhalophilic
archaea,westudiedthegeographicallocationsofthesamplingsitesoftheclosest-matchedspecies.
Ananalysisoftheenvironmentalfactorsofeachsitepointedtosalinityasthemostimportantfactor
forselection. Thegeographyofthesiteswasconsistentwiththelocationofthesub-tropicaljetstream
wherebirdstypicallymigrate,supportingtheaviandispersalhypothesis.
Keywords: Great Salt Lake; halophiles; haloarchaea; microbial biogeography; American White
Pelican;aviancarriers
1. Introduction
Halophilic archaea dominate the Earth’s many hypersaline environments such as salt lakes,
undergroundsaltdeposits,andsolarsalterns[1–5]. Thesemicroorganismsliveatlowwateractivity
andcantoleratesodiumchloridebrineatsaturation,eveninfluidinclusionsofsalt(halite)crystals[6].
Infact,severalstudiespointtothepossibilityofthesurvivalofhalophilesovergeologictimescalesin
halite[2,7–21]. Notonlycanhalophilicarchaealspeciessurviveinsidehalitecrystals,theyalsocan
likelysurvivespaceconditions: Halorubrumchaoviatorthrivedinculturefollowingspaceexposure
experiments[22–24]. Onekeytotheirabilitytopersistinextremeconditionsisthathaloarchaeaare
polyextremophiles,toleratingnotonlysalinity,butalsodesiccationandhighlevelsofultraviolet(UV)
irradiation[25].Indeed,haloarchaeahaveasuiteofgeneticcapacitiesthatincludetheabilitytosurvive
highosmoticstress[26,27]aswellasrobustDNArepairandphotoprotectionmechanisms[25,28–30].
CultivationapproacheshaveidentifiedmembersoftheclassHalobacteria,whicharecharacterized
bycontainingcarotenoid-pigmentsandbeingaerobicorfacultativeanaerobicandarerepresentedby
Diversity2018,10,124;doi:10.3390/d10040124 www.mdpi.com/journal/diversity
Diversity2018,10,124 2of20
atleast47generaand165species[31]. Twogenera,HalorubrumandHaloarcula,areoverrepresented
in culture studies [32,33] and each has a significant number of species [4,31]. Halorubrum [34] has
25speciesknownatthistime[31]andawidedistributionaroundtheglobeinmodernandancient
saltdepositsorhypersalineaquaticenvironments[1,3,17,28,35–38]. Halorubrumisconsideredthemost
highlyrepresentedarchaealgenusinmanysalternsafterHaloquadratum[39]. Inmolecularanalyses
of16SrRNAgenesinsalterncrystallizerponds,Halorubrummakesup4%to17%ofthemicrobial
population[3,38]. AspatialstudyofHalorubrumspeciessurveyingsaltminesandpondsinChina
discovered29strainsofwithnineteenlineages[37]. Halorubrumspecies,likeotherhalophilicarchaea,
havehighratesofrecombinationandhorizontalgenetransfer,anditisclearthatthesemechanisms
can increase genetic diversity within the genus [35,40,41]. As a result, Halorubrum may represent
the largest number of species grouping within the family of Halobacteriace [31,37]. For example,
Haloarcula marismortui was discovered in the Dead Sea [42], Haloarcula japonica was isolated from
aJapanesesaltern[43],andHaloarculahispanicawasculturedfromaSpanishsaltern[44]. Thegenomes
ofbothHalorubrumandHaloarculapopulations,eveninasinglesetting,canbealteredrapidlythrough
genetransferorrecombinationevents[41].
HalorubrumandHaloarculaspecies,amongotherhaloarchaea,resideinthesalt-saturatedregions
ofGreatSaltLake(GSL),anaturalhypersalineterminallakeinUtah[5].TheseGSLhaloarchaearemain
relativelystableovertime. Inaddition,theysurvivethefluctuationoftemperatureandsalinityin
GSL[45],desiccationinsidehalitecrystals[28],andevendesiccationinbrineshrimpcysts[46]. AGSL
Haloarculastrainwasshowntoadjustgeneexpressioninresponsetostress[45],andaGSLHalorubrum
strainwasshowntobehighlyresistanttodesiccationandUVlight[28]. Theseobservationssuggest
mechanismsthatassistsurvivalovertimeundersub-optimalgrowthconditionsintheenvironment
ofGSL.
GSL is the largest lake in the western United States and the fourth largest meromictic lake in
the world [47]. Thus, this enormous inland sea is a critical stop on the Pacific flyway; GSL hosts
an estimated ten million water birds (around 250 species), making the lake the most important
shorebirdsiteinNorthAmerica[48–52].Theavianpopulationspendstimeinthehaloarchaea-enriched
watersasmanybirdseattheinvertebrates,namelybrineshrimp(Artemiafranciscana)andbrineflies
and their larvae (Ephydra spp.) [53–57]. Other avian visitors do not eat from the lake but instead
find GSL gives them solace from predators. This is the case with the American White Pelicans
(Pelecanus erythrorhynchos; AWPE) on Gunnison Island in the north arm [50], which is isolated by
arailroadcauseway(Figure1). Herethewatersarerichwithhalophilicarchaea[5].
AsdescribedabovewiththeexamplesofHalorubrumandHaloarcula,haloarchaeaspeciesthatare
geneticallysimilarhavebeenfoundinhypersalinesiteswithglobaldistribution[58]. Contemplating
thisbiogeographyofhalophilicarchaea,toexplainspatialpatternsofcultivatablemicrobialdiversity,
weconsideredGSLanditsmigratingavianpopulation. Wesoughttotestthehypothesisthatbirds
couldtransporthaloarchaeainsaltcrystalsontheirfeathersfromsitetositereasoningthatconnecting
patternsofmigration[59]mightexplainhowsimilarmicroorganismsappearoveralonggeographic
distance. Migratingbirdshavebeenstudiedaspotential(pathogenic)microbialvectors,whichare
usuallyamicroorganismreplicatingwithinanavianhostandbeingdeliveredtoanewlocationvia
feces [60,61]. However, birds can also act as mechanical carriers, where the feathers of the animal
servetotransportthemicroorganism[60,62,63]. Fungalspores,notoriousfortoleratingdesiccation,
wereappliedtofeathersandfoundtosurviveforhours[63]ordays[62],whicharesmalltime-frames
comparedtoGSLmicroorganisms[28].
Diversity2018,10,124 3of20
Diversity 2018, 10, x FOR PEER REVIEW 3 of 20
FFiigguurree 11.. MMaapp ooff GGrreeaatt SSaalltt LLaakkee ddeeppiiccttiinngg tthhee llooccaattiioonn ooff tthhee nnoorrtthh aarrmm ssaammpplliinngg ssiitteess:: tthhee AAmmeerriiccaann
WWhhiittee PPeelliiccaann bbrreeeeddiinngg ccoolloonnyy oonn GGuunnnniissoonn IIssllaanndd ((lleefftt,, bblluuee)) aanndd tthhee llooccaattiioonn ooff RRoozzeell BBaayy wwhheerree
hhaalliittee wwaass ccoolllleecctteedd ((rriigghhtt rreedd)).. TThhee iissllaanndd iiss aa rreessttrriicctteedd aacccceessss ssiittee aass tthhee bbrreeeeddiinngg bbiirrddss aarree pprrootteecctteedd
bbyy llaaww.. SSiinnccee tthhee eelleevvaattiioonn ooff GGrreeaatt SSaalltt LLaakkee flfluuccttuuaatteess oovveerr ttiimmee,, wwee hhaavvee iinnddiiccaatteedd tthhee hhiigghh--wwaatteerr
lliinnee aanndd tthhee hhiissttoorriicc llooww eelleevvaattiioonn.. TThhee rraaiillrrooaadd ccaauusseewwaayy tthhaatt sseeppaarraatteess tthhee hhyyppeerrssaalliinnee nnoorrtthh aarrmm
ffrroomm tthhee ssoouutthh aarrmm iiss sshhoowwnn,, aanndd tthhee llaakkee’’ss iissllaannddss aarree aallssoo iinnddiiccaatteedd.. TThhee ccaauusseewwaayy lleennggtthh iiss 1199 kkmm,,
whichprovidesscaleforthisimage.Imagecredit:GreatSaltLakeInstitute.
which provides scale for this image. Image credit: Great Salt Lake Institute.
Since halophilic archaea can survive over geologic time in halite [2,7–21], and these crystals
Since halophilic archaea can survive over geologic time in halite [2,7–21], and these crystals
wouldlikelyformonfeathersofbirdsfeedinginGSLwaters,wedecidedtoinvestigatetheability
would likely form on feathers of birds feeding in GSL waters, we decided to investigate the ability of
of halophilic archaea in halite to be carried mechanically by migrating birds. Birds as vectors for
halophilic archaea in halite to be carried mechanically by migrating birds. Birds as vectors for
haloarchaealdispersalhavebeensuggestedbysomestudiesongeographicdistribution[10,64,65]and
haloarchaeal dispersal have been suggested by some studies on geographic distribution [10,64,65]
shownbytwo: aHalococcusspecieswasfoundinsaltcrystalscollectedfromthenostrilsaltgland
and shown by two: a Halococcus species was found in salt crystals collected from the nostril salt gland
of a migratory bird [66] and a broad diversity of halophilic archaea were discovered on flamingo
of a migratory bird [66] and a broad diversity of halophilic archaea were discovered on flamingo
feathers[67]. Inthisreport,wepresentevidencefortheformationofhalitecrystalsonfeathersand
feathers [67]. In this report, we present evidence for the formation of halite crystals on feathers and
theirpreservationofhalophilicarchaea. Specifically,weexaminedthehaloarchaealdiversityofstrains
their preservation of halophilic archaea. Specifically, we examined the haloarchaeal diversity of
carried by AWPE, which live in the hypersaline north arm of GSL [50] and compared this to the
strains carried by AWPE, which live in the hypersaline north arm of GSL [50] and compared this to
microbialdiversityofhalitecollectedonanearbyshoreofthelake. Examiningtheclosestgenetic
the microbial diversity of halite collected on a nearby shore of the lake. Examining the closest genetic
relativesoftheGSLstrains,whichwereisolatedaroundtheglobe,wepresentadistributionmapand
relatives of the GSL strains, which were isolated around the globe, we present a distribution map and
amodelforaviandispersalandselectionbyhypersalineenvironments.
a model for avian dispersal and selection by hypersaline environments.
Diversity2018,10,124 4of20
2. MaterialsandMethods
2.1. Collection,Cultures,andDNAExtraction
ChestfeatherswerecollectedfromAWPEfromtheGunnisonIslandbreedingcolonyunderthe
migratorybirdpermitMB105510-0, whichallowedforsalvageandscientificcollectionoffeathers
from migratory birds at GSL. Feathers were photographed with a Dino-Lite digital microscope
(AnMo Electronics Corporation, New Taipei City, Taiwan) at 100× magnification. Three feathers
wereindividuallyplacedin8mLof23%NaClModifiedGrowthMedia(MGM)[68],suchthatthe
feathersweresubmerged,forthreeweeksat37◦Cwithshakinguntilcultureswereturbid.Saltcrystals
werecollectedfromtheshoreatRozelBayinthenortharmofGSLanddissolvedandculturedwith
shakingin5mLof23%MGMforthreeweeksat37◦C.Dilutionsofeachculturewerespreadon23%
MGM agar plates (three for each feather and salt crystal culture) and incubated at 37 ◦C for three
weeks. Tencoloniesperplatewererandomlyselectedandsub-cultured,into23%MGMliquidbroth,
fromeachplate. WeextractedDNAfrom1mLofturbidculturewiththeFastDNASpinKitforSoil
(MPBiomedicals,SantaAna,CA,USA).Thekitprotocolwasfollowedbyanethanolprecipitationto
furthercleantheDNA.
2.2. PCRAmplification,DNASequencingandGenbankComparisons
To amplify a partial sequence of the archaeal 16SrRNA gene, we used the Taq PCR
kit (New England Biolabs, Ipswich, Mass) and the halophilic archaeal primers: 1HK (5(cid:48)
ATTCCGGTTGATCCTGCCGG 3(cid:48)) [69–72] and H589R (5(cid:48) AGCTACGGACGCTTTAGGC 3(cid:48)) [45].
Initial denaturation was at 94 ◦C for 5 min followed by 45 cycles of denaturation (94 ◦C for 30 s),
annealing (58 ◦C for 60 s), and elongation (72 ◦C for 60 s). The final elongation phase was 72 ◦C
for5min[46,70]. Amplificationofthis~550bpproductwasobservedbyanalysisona2%agarose
gel, utilizing a tris acetate buffer. For successful amplifications, the PCR products were cleaned
with a QIAquick PCR Purification Kit (Quiagen, Venlo, Netherlands) and then submitted to the
Center for Integrated BioSystems at Utah State University for DNA sequencing, using the 1HK
primeraboveforthesequencingreactions. Sequencedata(depositedinGenBank,accessionnumbers
MH746823-MH746869)wereanalyzedbytheBasicLocalAlignmentSearchTool(BLAST)usingthe
GenBankdatabase[73]. Usingthesesequencedatafromthe16SrRNAgenesegment,matchedspecies
wereloggedforeachisolate.
2.3. GeographicandClimateData
Closest-matchedspeciesweresurveyedforsamplingsitelocations,includinglongitude,latitude,
andelevation. ThisinformationonpreviouslydepositedsequenceswasdetailedineitherGenbank,
the supporting literature, and/or cell culture catalogs: the American Type Culture Collection
(ATCC,Manassas,VA,USA);theBiologicalResourceCenter(NBRC/JCM,Kyoto,Japan),theLeibniz
InstituteDSMZ(DSM,Braunschweig,Germany),andtheAll-RussianCollectionofMicroorganisms
(VKM,Moscow,Russia). ReferencesforeachstrainmatchareincludedinTables1and2. Foreach
sitelocation,wecollecteddataontheKöppenClimateClassification(KCC)categories[74],andother
environmental parameters [75]. The KCC system identifies the main climate groups with the first
letter: A(tropical),B(dry),C(temperate),andD(continental). Thesecondletterrepresentsseasonal
precipitationsubgroup: m,monsoon;w,wetsavanna;S,steppe;W,desert;f,rainforest;s,drysavanna.
The third letter represents a temperature pattern subgroup (for all groups other than those in the
Agroup): a,hotsummer;b,warmsummer;c,coldsummer;d,verycoldwinter;h,hot;k,cold.
Diversity2018,10,124 5of20
2.4. StatisticalMethods
Toaddressthequestionofparametersinvolvedinselectionofstrainsateachlocation,weanalyzed
eDnivveirrsoitny m201e8n, t1a0,l xc FoOnRd PitEiEoRn RsEoVfIEaWll s ites. StatisticalanalyseswerecarriedoutusingtheRpack5a ogfe 20s tats
version3.5.0(TheRFoundation,Vienna,Austria). Theaveragetemperaturesandannualprecipitations
annual precipitations among geographic sites of the closest-matched species (Table 1, Table 2, n = 50)
amonggeographicsitesoftheclosest-matchedspecies(Table1,Table2,n=50)werecombinedand
were combined and compared to those of GSL using one-sample t-tests, with each µ corresponding
compared to those of GSL using one-sample t-tests, with each µ corresponding to the GSL value
(1to1 .t0he◦ CGSaLn dva3lu9e3 .(211m.0m °C, raensdp 3e9c3ti.v2 emlym)., rTeshpeescetiavveleyr)a. gTehsesaer eavreerpaogretse adrei nretphoertteedx tina tshe9 5te%xtc aosn 9fi5d%e nce
confidence intervals. It should also be noted that these sample data do not constitute a random
intervals. Itshouldalsobenotedthatthesesampledatadonotconstitutearandomsample.
sample.
3. Results
3. Results
3.1. GreatSaltLakeAmericanWhitePelicans,Feathers,andHaliteCrystals
3.1. Great Salt Lake American White Pelicans, Feathers, and Halite Crystals
GSLboaststhesecondlargestbreedingcolonyofAWPEintheworld[50,51]onGunnisonIsland
GSL boasts the second largest breeding colony of AWPE in the world [50,51] on Gunnison Island
(Figure1),whichisprotectedasarefugeforthecolonybytheStateofUtah[76]. Thesebirdsmust
(Figure 1), which is protected as a refuge for the colony by the State of Utah [76]. These birds must
travel to obtain fish since this food is not available in the lake waters surrounding their breeding
travel to obtain fish since this food is not available in the lake waters surrounding their breeding
grounds; therefore, it was generally assumed that they did not spend time in the salt-saturated
grounds; therefore, it was generally assumed that they did not spend time in the salt-saturated water.
water. Recently, however, thisactivitywascaughtbyamotion-activatedcamerathatweinstalled
Recently, however, this activity was caught by a motion-activated camera that we installed on
onGunnisonIsland,inconjunctionwithGreatSaltLakeEcosystemProgram(GSLEP)attheUtah
Gunnison Island, in conjunction with Great Salt Lake Ecosystem Program (GSLEP) at the Utah
DivisionofWildlifeResources[77]. AnumberofourimagesindicateAWPEdoindeedspendtimein
Division of Wildlife Resources [77]. A number of our images indicate AWPE do indeed spend time
thebrinee.g.,(Figure2a,b). Furthermore,weobservedbabypelicanscoatedinsaltcrystals(Figure2c)
in the brine (e.g. Figure 2a and 2b). Furthermore, we observed baby pelicans coated in salt crystals
d(uFriginugret h2ec)A dWuPriEngn ethstel iAngWbPaEn dniensgtlienfgfo brta[n7d8i]n.gT hefefsoertb [ir7d8]s. aTrheepsree sbeirndtsa tarGe SpLrewsehnilte abtr eGeSdLi nwg,hMilea rch
thbrroeeudgihngS, eMpatermchb tehrro[u79g]h, Sthepentemmbigerr a[t7e9]s, othuethn mtoigMraetxe iscoou,tahn tdo Msoemxiecot,a aknindg soamnei ntalaknindg paant hinltahnrdo ugh
thpeatSho tuhtrhowugehs ttehren SUo.uSt.h[w80e]s.teTrhne Uy.Sa.l s[o80m]. oTvheeyb aaclsko amndovfeo rbtahckto afnrde sfhowrtha tteor flraeksehswiantetrh elakWees sitne rtnheU .S.,
aWndesGteSrLn isUa.S“.,c laenadr cGenStLr ailsh au b“colfeathr ecwenetsrtael rnhupbo pouf ltahteio nw”es(Rte.rNn oprovpeulll,aptieornso” n(aRl. cNomormveulnl,i cpaetriosonn,acli ting
ucnopmumbluisnhiceadtidoant, aciftrionmg utnhpeuSbtalitseheodf Udatatah )fr.om the State of Utah).
FFigiguurree 22.. GunGnuisnonni sIosnlanIds lAanmderiAcamn eWrichainte PWelhiciatens P(AelWicaPnEs). ((aA)W anPdE )(.b)( aIm) aagneds fr(obm) Iam magoteisonf-rom
aamctiovtaiotend-a tcrtaiivl actaemdetrraa islhcoawmienrga AshWoPwEin ign AcoWntPaEct iwnictohn Gtarcetatw Siathlt GLarekaet nSoarltthL aarkme nhoyrptehrsaarlmineh ywpaetersra, line
wimataegre, cirmedaigt:e PcEreLdIicta:mP sEpLonIcsaomreds pbyon Gsroeraetd Sbaylt GLarkeea tInSsatilttuLtea kate WInessttimtuintestaetr WCoellsetgme iannsdte trheC Uoltlaehg eDaivnidsiothne ofU tah
DWiviilsdiloifne, oGfWreailtd lSiafel,t GLraekaet EScaoltsyLsatekme EPcroosgyrsatmem. (Pcr)o Agr abma.by(c )AAWbPaEb yonA WGuPnEnoisnonG uIsnlannisdo, ncoIsaltaendd i,nc osaatlet din
scarlytsctraylss,t aimlsa,gime cargeedictr: eGdrite:atG Sraelatt LSaaklet ILnaskteituIntes taitt uWteesattmWinessttemr CinosltleegreC. ollege.
Since migrating AWPE do spend time in water teeming with halophilic archaea [5], we
wondered if the feathers from adults contained halite crystals that might preserve, and potentially
Diversity2018,10,124 6of20
DiversiStyin 2c0e18m, 1i0g, rxa FtOinRg PAEEWR PREEVdIoEWsp endtimeinwaterteemingwithhalophilicarchaea[5],wewond6 eorf e2d0
if the feathers from adults contained halite crystals that might preserve, and potentially disperse,
dthisepmeriscer,o tohreg manicisrmoosr.gWaneiscmolsl.e Wcteed cothlleenctpedh othtoegnr pahpohteodgrAaWphPeEd cAhWesPtEfe cahthesetr fseaanthderfos uanndd fsomuanldl hsmalaitlel
hcraylisttea lcsry(1st–a2lsm (1m–2w midmth )waisdstohc)i aatsesdocwiaittehde wacihthf eeaatchhe fretaetshteerd t(eFsitgeudr (eF3igau).reW 3eah).a Wrvee shtaedrvleasrtgeedr lhaarglieter
hcraylisttea clsry(1st–a3lsc m(1–)3(F cimgu) r(eFi3gbu)r,ef r3obm), ftrhoemn othrteh naorrmths ahromre sh(Foirgeu (rFeig1u)rtye p1i)c taylpoifcahlo opfp heorpspaeltr csraylts tcarlysstthaalst
tahraetp arreev palreenvtailnentht einf atlhl,ew fahlel,n wthheenw tahtee rwteamtepr etreamtupreeradteucrree adseecsraenadsessa altnpdr esacilpt iptaretecsip. Tithatiessh. aTlihties whoaluitlde
wseorvuelda ssearvcoe natsr oal ctoonatsrsoels tsop arsesseesrsv epdremseircvroedbi amlidcirvoebrisailt ydiivneGrsSitLyc irny sGtaSlLs ncroytsatsaslos cniaotte adsswoictihatfeeda twheitrhs,
faelalothweirnsg, aulslotwoilnoogk uast ttoh elocookm amt tohnea cliotymomfomniaclriotyb ioalf cmoimcrmobuinailt iceosmomflaukneithieasl iotef lvaekres uhsatlhitaet vwehrsiuchs mthaayt
wbehcicahrr miedayo bnet hcaerprieeldic aonns t.he pelicans.
Figure3.HalitecrystalsfromGreatSaltLake.(a)AtinyhalitecrystalonafeatherfromanAmerican
Figure 3. Halite crystals from Great Salt Lake. (a) A tiny halite crystal on a feather from an American
WhitePelicanfromthebreedingcolonyonGunnisonIsland, scalebaris1mm. (b)Hopperhalite
White Pelican from the breeding colony on Gunnison Island, scale bar is 1mm. (b) Hopper halite
crystalscollectedfromRozelBay,scalebaris1cm.
crystals collected from Rozel Bay, scale bar is 1 cm.
3.2. HalophilicArchaeaDiversityofAmericanWhitePelicanFeathersandHaliteCrystalCultivars
3.2. Halophilic Archaea Diversity of American White Pelican Feathers and Halite Crystal Cultivars
To investigate the possibility of microorganisms living on the feathers or in the halite on the
To investigate the possibility of microorganisms living on the feathers or in the halite on the
feathers,weincubatedAWPEfeathersinsaltbrothmediaandthenplatedculturesonsolidmedia
feathers, we incubated AWPE feathers in salt broth media and then plated cultures on solid media
(Figure4a).Coloniesfromtheseplatesweresub-culturedandDNAwasextractedfromisolatedstrains.
(Figure 4a). Colonies from these plates were sub-cultured and DNA was extracted from isolated
We amplified a partial 16S rRNA gene sequence for each isolate, which resulted in PCR products
strains. We amplified a partial 16S rRNA gene sequence for each isolate, which resulted in PCR
theexpectedsizeaspredictedbyprimerlocation(Figure4b). DNAsequencingoftheamplification
products the expected size as predicted by primer location (Figure 4b). DNA sequencing of the
productsconfirmedthemicroorganismswerehalophilicarchaea(Table1).
amplification products confirmed the microorganisms were halophilic archaea (Table 1).
Table1.HalophilicarchaeaisolatesculturedfromGreatSaltLakeAmericanWhitePelicanfeathers.
Foreachisolatedcultivar,wehavelistedtheclosest-matchedspecies/strainandpercentsimilarity
(%Sim)inthepartial16SrRNAgenesequence. Forthesamplingsitesofmatchedstrains,wehave
indicatedthegeographiclocationandreferenceforthestudy,KöppenClimateClassfication(KCC)
[74], EL, Elevation Level (EL) in meters above sea level; Average Rainfall (AR), and Average
Temperature(AT).DNAsequenceinformationisavailableintheGenBankdatabase,underaccession
numbersMH746823-MH746869.
EL AR AT
MatchedStrain %Sim Location[Reference] KCC (m) (mm) (◦C)
Haloarculaamylolytica 99 KachchhSaltPans,Gujarat,India[81] BSh 5 753 27.3
Haloarculaamylolytica 99 Xinjiang,China[82] BSk 408 514 13.2
Diversity2018,10,124 7of20
Table1.Cont.
EL AR AT
MatchedStrain %Sim Location[Reference] KCC (m) (mm) (◦C)
Haloarculaargentinensis 99 Leh-Ladkh,RohtangPass,India[83] Dwd 3978 27 3.75
Haloarculaargentinensis 99 SalinasChica,Chubut,Argentina[84] BSk −20 206 13.5
Haloarculahispanica 99 SantaPola,Alicante,Spain[44] Csa 10 66 26
Haloarculajaponica 99 NotoPeninsula,Japan[85] Cfb 438 180.016 13.75
Haloarculamarismortui 99 Mumbaisalterns,India[86] Am 14 242.2 27.2
Haloarculamarismortui 98 DeadSea,Israel[87] Csa −430.5 50 25.5
Haloarculaquadrata 99 KachchhSaltPans,Gujarat,India[81] BSh 5 753 27.3
Haloarculaquadrata 99 Salada,Murcia,Spain[88] BSk 4 297 18.6
Haloarculaquadrata 99 SebkhaGavish,SouthernSinai,Egypt[89] BWh 13 40 24.4
Haloarculasalaria 99 KachchhSaltPans,Gujarat,India[81] BSh 5 753 27.3
Haloarculasalaria 99 Thailand(Thaifishsauce)[90] Aw 0 1184 25.6
Haloarculatradensis 99 Thailand(Thaifishsauce)[90] Aw 0 1184 27.3
Haloarculasp.strainSP2(1) 100 KachchhSaltPans,Gujarat,India[91] Am 14 242.2 27.2
Haloarculasp.strainI.C6 100 IslaCristina,SouthernSpain[92] Csa 11 612 17.8
Haloarculasp.strainD21 100 ChottMelrhir,Algeria[93] BWh −40 160 22.8
Table2.HalophilicarchaeaisolatesculturedfromGreatSaltLakeshorehalitecrystals.Foreachisolated
cultivar,wehavelistedtheclosest-matchedspecies/strainandpercentsimilarity(%Sim)inthepartial
16SrRNAgenesequence.Forthesamplingsitesofmatchedstrains,wehaveindicatedthegeographic
locationandreferenceforthestudy,KöppenClimateClassfication(KCC)[74],EL,ElevationLevel
(EL)inmetersabovesealevel;AverageRainfall(AR),andAverageTemperature(AT).DNAsequence
informationisavailableintheGenBankdatabase,underaccessionnumbersMH746823-MH746869.
EL AR AT
MatchedStrain %Sim Location[Reference] KCC (m) (mm) (◦C)
*Haloarculaargentinensis 100 SalinasChica,Chubut,Argentina[84,94] BSk −20 206 13.5
*Haloarculahispanica 99 SantaPola,Alicante,Spain[44] Csa 10 66 26
Haloarculahispanica 100 SantaPola,Alicante,Spain[95] Csa 10 66 26
*Haloarculajaponica 100 NotoPeninsula,Japan[85] Cfa 438 180.016 13.75
*Haloarculamarismortui 100 DeadSea,Israel[87] Csa −430.5 50 25.5
*Haloarculaquadrata 100 SebkhaGavish,SouthernSinai,Egypt[89] BWh 13 40 24.4
*Haloarculasalaria 99 Thailand(Thaifishsauce)[90] Aw 0 1184 27.3
Haloarculasinaiiensis 100 SebkhaGavish,SouthernSinai,Egypt[96] BWh −999 60 26.5
*Haloarculatradensis 100 Thailand(Thaifishsauce)[90] Aw 0 1184 27.3
Haloarculavallismortis 100 DeathValley,CA,USA[97] BSk −86 60 27.2
Halorubrumarcis 100 TibetanPlateau,China[98] BWk 4500 43 4.8
Halorubrumcaliforniense 100 BalearicIslands,Spain[99] BSk 13 449 18.2
Halorubrumcaliforniense 100 Newark,California,USA[100] Csc 6 368 15
Halorubrumchaoviator 100 SantaPola,Alicante,Spain[33] BSh 6 317 18.2
Halorubrumchaoviator 100 SaharanSalineSyst.,SouthernTunisia[101,102] Csa −22.5 100 20
Halorubrumchaoviator 99 Yuli,Bayingol,Xinjiang,China[103] BWk 900 30 11
Halorubrumchaoviator 100 BajaCalifornia,Mexico[36] Csb 660 116.8 18.2
Halorubrumejinorense 100 LakeEjinor,InnerMongolia,China[37,104] BSk 1065 391 6.4
Halorubrumezzemoulense 100 SebkhetezZemoul,OumelBouaghi,Algeria[105] BSk 850 382 14.5
Halorubrumezzemoulense 100 Sfaxsolarsaltern,Tunisia[106] BWh 0 212 19
Halorubrumlitoreum 99 Xiuyu,Fujian,China[107] Cfa 21 1178 20.9
Halorubrumtebenquichense 100 Patagoniansaltflat,Argentina[108] BSk 175 685.8 19.5
Halorubrumtebenquichense 100 Atacamasaltern,Chile[109] BWk 2339 7 17
Halorubrumterrestre 100 Ashgabat,Turkmenistan[110] BSk 219 228 15.4
Halorubrumterrestre 100 Gyaur-Kala,Turkmenistan[110,111] BWk 252 124 14.8
Halorubrumtrapanicum 99 Turkmenistan[110] BWk 281 124 14.8
Halorubrumxinjiangense 99 Xiao-Er-KuleLake,Xinjiang,China[112] BWk 4475 105 11.5
Halorubrumsp.strainSP9-2 98 RedSea[113] Csa −400 41.9 26.1
Halorubrumsp.strainspIB11 98 IslaBacutaandIslaCristina,Huelva,Spain[92] Csa 8 467 17.8
Halorubrumsp.strainSS13-13 98 SamutSakhon,Thailand[114] Aw 7 1330 27.8
Halorubrumsp.strainY122 99 YunnanSaltMine,China[115] Cwb 1892 570.7 15.2
Halorubrumsp.strainY62 99 YunnanSaltMine,China[37] Cwb 1892 570.7 15.2
Halorubrumsp.strainYC-11 98 YunchengSaltLake,Shanxi,China[37] BSk 353 74.7 14.05
*ThesestrainsaresimilaroridenticaltotheonesisolatedfromfeathersshowninTable1.
Diversity2018,10,124 8of20
Diversity 2018, 10, x FOR PEER REVIEW 7 of 20
Figure 4. Evidence for microorganisms associated with the feathers of American White Pelicans.
Figure 4. Evidence for microorganisms associated with the feathers of American White Pelicans. (a)
(a)Culturesgeneratedbyincubatingfeathersinsaltmediabrothwereplatedonthesamemediain
Cultures generated by incubating feathers in salt media broth were plated on the same media in solid
solidform;onesuchplateisshown.Thesecoloniesrepresentedmixedspeciesofhalophilicarchaea,
form; one such plate is shown. These colonies represented mixed species of halophilic archaea, and
andweselectedtenrandomlyfromeachplatebyquadrantsforanalysis.(b)RepresentativePCR
we selected ten randomly from each plate by quadrants for analysis. (b) Representative PCR
amplificationofthe16SrRNAgenefromisolatedspeciesofhalophilicarchaeafromfeathercultures.
amplification of the 16SrRNA gene from isolated species of halophilic archaea from feather cultures.
Themarker(100bpDNAladder,NewEnglandBiolabs)isinlaneone,andthearrowindicatesthe
The marker (100 bp DNA ladder, New England Biolabs) is in lane one, and the arrow indicates the
migrationoftwolengthsofDNAcombined: 500bpand517bp.Amplificationwithhaloarchaeal
migration of two lengths of DNA combined: 500 bp and 517 bp. Amplification with haloarchaeal
primersresultedintheestimatedrangeof550–560bpbands.expectedforthissegmentofthe16SrRNA
primers resulted in the estimated range of 550–560 bp bands. expected for this segment of the 16S
gene in halophilic archaea. Negative controls, PCR reactions with no template DNA, showed no
rRNA gene in halophilic archaea. Negative controls, PCR reactions with no template DNA, showed
amplificationproduct.
no amplification product.
Each 16S rRNA gene partial DNA sequence was compared in BLAST searches, and the
Each 16S rRNA gene partial DNA sequence was compared in BLAST searches, and the closest-
closest-matched species were recorded. All isolates aligned with the Haloarcula genus according
matched species were recorded. All isolates aligned with the Haloarcula genus according to homology
tohomologyinthissegmentofthegene. Table1liststhemostsimilarGenBankBLASThitsforthese
in this segment of the gene. Table 1 lists the most similar GenBank BLAST hits for these related species
relatedspeciesofeachcultivar. Wealsorecordedthesamplinglocationofeachmatchedstraininthe
of each cultivar. We also recorded the sampling location of each matched strain in the database to
databasetogatherdataongeographicdistributionofstrainssimilartoourGSLstrainsisolatedfrom
gather data on geographic distribution of strains similar to our GSL strains isolated from the AWPE
theAWPEfeathers(Table1).
feathers (Table 1).
We repeated this procedure for the shore-collected halite crystals (Figure 3b), from which we
cultivateddozensofhalophilicarchaea. TheclosestmatchedspeciesforeachGSLhaliteisolatewere
Table 1. Halophilic archaea isolates cultured from Great Salt Lake American White Pelican feathers.
logged(Table2). Thehalite-derivedstrainswereclassifiedaseitherintheHaloarculagenus,aswiththe
For each isolated cultivar, we have listed the closest-matched species/strain and percent similarity (%
feather-derivedstrains,orintheHalorubrumgenus. Weinvestigatedthesamplinglocationsofthese
Sim) in the partial 16S rRNA gene sequence. For the sampling sites of matched strains, we have
relatedspeciesaswell,andthesesitesarepresentedinTable2. Clearly,bothgeneraarecapableof
indicated the geographic location and reference for the study, Köppen Climate Classfication (KCC)
survivinginhalitecrystalsandcanbeculturedfromthem,incontrasttothecultivationexperiments
[74], EL, Elevation Level (EL) in meters above sea level; Average Rainfall (AR), and Average
withAWPEfeatherswhereonlyHaloarculacultivarswereobtained(Table1).
Temperature (AT). DNA sequence information is available in the GenBank database, under accession
numbers MH746823-MH746869.
3.3. GeographicDistributionPatternsofClosest-MatchedStrains
% EL AR AT
MHaotcwhedd oStrraeilna ted Halorubrum andLHoacalotiaornc u[Rlaefsetrreanicnes] exist in enKvCirCo nments separated by large
Sim (m) (mm) (°C)
distancesaroundtheplanet? Tocreateamodel,wefirstplottedthegeographicdistributionofthe
Haloarcula amylolytica 99 Kachchh Salt Pans, Gujarat, India [81] BSh 5 753 27.3
strHaailnoasrcmulaat acmhiynloglyotiucar GSL99fe atherandhaXliitnejiiasnogl,a Ctehsi.naF i[g82u]r e5showsthBeSks amp4li0n8g sitel5o1c4a tionof13th.2e se
closestH-maloaatrcchulead strainsasindicatedbythereferencedstudies(Tables1and2). Thedistributionof
99 Leh-Ladkh, Rohtang Pass, India [83] Dwd 3978 27 3.75
theseasrigmeniltainrenhsaisl ophilicarchaeastrainsindicatedapatternoftwobeltsaroundtheEarth,alignedwith
Haloarcula
the(northandsouth)sub9-9t ropicaSlaljientasst Crehaicma,, Cdheumbuatr,k Aerdgewntiitnha b[8o4l]d latiBtuSdk elin−e2s0o nthe2m06a pproj1e3c.t5i on
argentinensis
Haloarcula hispanica 99 Santa Pola, Alicante, Spain [44] Csa 10 66 26
Haloarcula japonica 99 Noto Peninsula, Japan [85] Cfb 438 180.016 13.75
Haloarcula marismortui 99 Mumbai salterns, India [86] Am 14 242.2 27.2
Diversity 2018, 10, x FOR PEER REVIEW 9 of 20
Halorubrum trapanicum 99 Turkmenistan [110] BWk 281 124 14.8
Halorubrum xinjiangense 99 Xiao-Er-Kule Lake, Xinjiang, China [112] BWk 4475 105 11.5
Halorubrum sp. strain SP9-
98 Red Sea [113] Csa -400 41.9 26.1
2
Halorubrum sp. strain Isla Bacuta and Isla Cristina, Huelva,
98 Csa 8 467 17.8
spIB11 Spain [92]
Halorubrum sp. strain
98 Samut Sakhon, Thailand [114] Aw 7 1330 27.8
SS13-13
Halorubrum sp. strain
99 Yunnan Salt Mine, China [115] Cwb 1892 570.7 15.2
Y122
Halorubrum sp. strain Y62 99 Yunnan Salt Mine, China [37] Cwb 1892 570.7 15.2
Halorubrum sp. strain YC-
98 Yuncheng Salt Lake, Shanxi, China [37] BSk 353 74.7 14.05
11
* These strains are similar or identical to the ones isolated from feathers shown in Table 1.
3.3. Geographic Distribution Patterns of Closest-Matched Strains
How do related Halorubrum and Haloarcula strains exist in environments separated by large
distances around the planet? To create a model, we first plotted the geographic distribution of the
strains matching our GSL feather and halite isolates. Figure 5 shows the sampling site location of
these closest-matched strains as indicated by the referenced studies (Tables 1 and 2). The distribution
Diversity2018,10,124 9of20
of these similar halophilic archaea strains indicated a pattern of two belts around the Earth, aligned
with the (north and south) sub-tropical jet stream, demarked with bold latitude lines on the map
(pFriogjuecretio5n). M(Fiogrueorev e5r),. thMeosrteroavinesr,m thatec hsterdaitnost hmeaGtcShLedfe atoth tehrei sGoSlaLt efsesahthoewr eidsoalastiems islahrodwisetdr ibau stiimonilator
tdhiesttrhibousetioonf tthoe thGeS Lthhoaseli toef itshoela GteSsL. halite isolates.
AA mmiiccrroooorrggaanniissmm’’ss mmoolleeccuullaarr ssiiggnnaattuurree eevvoollvveess oovveerr ttiimmee dduuee ttoo sseelleeccttiioonn bbyy vvaarriioouuss
eennvviirroonnmmeennttaall adaadpatpattaiotinosnasl onalgonwgit hwgietnho mgiecndoimveicrs itdy.ivEenrvsiitryo.n mEennvtiarlofnamcteonrstaslu cfhacatsotresm psuecraht uraes,
pteHm,paenrdatucroen, cpeHnt,r aatniodn csonofceinntdraivtiiodnusa lofi oinnsdiwviedrueasl hioonwsn wtoereg isvheowrisne ttoo gaidvea prtiaseti oton sadinaphtaaltoiopnhsi liinc
ahraclhoapehail[i1c 1a6r].chPaoetean [t1ia1l6e].n vPiorotennmtieanl teanlvpiarroanmmeetenrtsalt hpaatrcaomueldteerns atbhlaett hceouseldle cetnioanbloef mthiec rsoeolregcatinoins mosf
mmaicyroreolragteantoismclism mataey. Treolaextea mtoi ncleimcoamtem. Toon aelxitaiemsiinnec cliommamteoanmaolintigest hine gcleiomgartaep hamicosnitges thcoer greesopgornadpihnigc
tsoiteesa cchorcrloessepsotn-mdiantcgh teod esapcehc icelso(sTeasbt-lmesa1tcahnedd 2s)p,weceiecsl a(sTsaifibeleds e1a cahndsi t2e)b, ywiet scKlaöspsipfieendc eliamchat esictea tbegyo irtys
(KFöigpupreen6 c).liTmhaeteH caaltoeagrcourlya (aFnigduHrea l6o)r.u Tbrhuem Hsaploeacriceuslfaa avnodre Hdadlorryu(b5r2u%m) sapnedciteesm fapveorareted (d32ry% ()5c2l%im) aatneds,
wteimthpethraetem (o3s2t%fr)e qcluimenattecsla, swsiifithc atthioen mboesint gfrceoqludesnetm clia-asrsiidfic(aBtSiokn; 2b2e%in)g, wcohlidc hseismtih-aersidam (BeScka;t e2g2o%r)y,
awshGicShL i.s the same category as GSL.
FFiigguurree 55..G eGoegorgarpahpihcidci sdtriisbturitbiountioofnh aolfo phhailliocpahriclhica eaarscpheaceiaes /ssptercaiienss/smtraaticnhse dmbayt1c6hSerdR NbyA1h6So mroRlNogAy
thooGmroelaotgSya lttoL aGkreeaist oSlaatlet s.LRakeed cisirocllaetsesin. dRiecdat ecimrcaletcsh einsdfricoamtec umltaitvcahressi sforolamte dcufrlotimvafresa tishoelraste(Tda bfrleom1)
afenadthbelruse (cTiracbleles i1n)d aicnadt ebtlhuoes ecifrrcolmes sihnodriecahtael ittheo(sTea bfrleom2) .sThhoered ahrakleitnee d(Tlainbeles i2n)d. iTchatee dthaerkbeonuendd alirnieess
oinfdthiceatSeu tbhter obpoiucanldjaertisetsr eoaf mthse( SNuobrttrhopanicdalS joetu sthtr)e.aImmsa g(eNcorretdhit :anGdre SaotuStahlt).L IamkeagIne sctrietduitte: aGtrWeate sStmaltin Lsatkere
CInosltleitgueteu saitn Wgmesatmpipnrsotjeerc tCioonllaegvea iulasbinlegf rmomap CprreoajetcivtieoCn oamvamiloanbsle. from Creative Commons.
3.4. EnvironmentalFactorsasVariablesinDistributionandSelection
Additionally,wecollecteddatafortheaverageannualprecipitation,andaveragetemperature,
andelevationatthegeographicsitescorrespondingtoeachclosest-matchedspecies(Tables1and2)
in order to evaluate climate parameters more specifically and compare them to GSL. The average
annualprecipitationamongthesamplesites(365.5±108mm)wasnotsignificantlydifferentfromGSL
(393.2mm;p=0.6).Incontrast,theaveragetemperature(19.6±1.9◦C)wassignificantlydifferentfrom
GSL(11.0◦C;p=9×10−12). Elevationamongthesamplesitesshowedahighdegreeofvariability
(min=−999m;max=4500m;median=10.5m)andwasnotstatisticallycomparedtoGSL(1280m).
WeshouldnotethatGSLexperiencessignificantseasonaltemperaturevariation,from0.5◦CinJanuary
to26.7◦CinJuly[117]andupto45◦Cintheshallowmargins[118]duetoitselevationandaridsetting.
Beyondclimate,akeyenvironmentalvariablecommontoallsamplingsiteswassalinity: allsites
containedeitherbrineatsalt-saturation,crystallinehalite,orsalinesoils. Therefore,thissuggeststhat
salinityisasignificantdriverforselectionofHalorubrumandHaloarculastrains,notunexpectedsince
thesespeciesaredefinedbytheirsaltrequirement.
Diversity 2018, 10, x FOR PEER REVIEW 10 of 20
3.4. Environmental Factors as Variables in Distribution and Selection
Additionally, we collected data for the average annual precipitation, and average temperature,
and elevation at the geographic sites corresponding to each closest-matched species (Tables 1 and 2)
in order to evaluate climate parameters more specifically and compare them to GSL. The average
annual precipitation among the sample sites (365.5 108 mm) was not significantly different from
GSL (393.2 mm; p = 0.6). In contrast, the average temperature (19.6 1.9 °C) was significantly different
from GSL (11.0 °C; p = 9 × 10−12). Elevation among the sample sites showed a high degree of variability
(min = −999 m; max = 4500 m; median = 10.5 m) and was not statistically compared to GSL (1280 m).
We should note that GSL experiences significant seasonal temperature variation, from 0.5 °C in
January to 26.7 °C in July [117] and up to 45 °C in the shallow margins [118] due to its elevation and
arid setting.
Beyond climate, a key environmental variable common to all sampling sites was salinity: all sites
contained either brine at salt-saturation, crystalline halite, or saline soils. Therefore, this suggests that
salinity is a significant driver for selection of Halorubrum and Haloarcula strains, not unexpected since
Diversity2018,10,124 10of20
these species are defined by their salt requirement.
Figure6.Köppenclimateclassification(KCC)categories[74],seemethods,forgeographicsitesfrom
Figure 6. Köppen climate classification (KCC) categories [74], see methods, for geographic sites from
whereeachHalorubrumandHaloarculaclosestmatchedspecies(Tables1and2)wassampled.
where each Halorubrum and Haloarcula closest matched species (Tables 1 and 2) was sampled.
4. Discussion
4. Discussion
Toexplainthevastdiversityofmicroorganismsandtheiroverlappinggeographicdistributions,
To explain the vast diversity of microorganisms and their overlapping geographic distributions,
Baas-Beckingfamouslypostulatedthat“everythingiseverywhere,buttheenvironmentselects”[119].
Baas-Becking famously postulated that “everything is everywhere, but the environment selects”
Others, such as Finlay, supported this model, suggesting that, due to microorganisms’ small size,
[119]. Others, such as Finlay, supported this model, suggesting that, due to microorganisms’ small
abundance,andmetabolicplasticity,theycouldtrulyexistinmanyenvironments,dormantandin
size, abundance, and metabolic plasticity, they could truly exist in many environments, dormant and
smallnumbers,makingthemdifficulttodetectuntilconditionsselectedfortheirgrowthe.g.,[120].
in small numbers, making them difficult to detect until conditions selected for their growth [e.g. 120].
Morerecentstudies,usingmoleculartechniques,havedisputedthisideaofcosmopolitanismand
More recent studies, using molecular techniques, have disputed this idea of cosmopolitanism and
suggestedmechanismsofdistribution,suchasactivepropulsion,atmosphericdeposition,ortraveling
suggested mechanisms of distribution, such as active propulsion, atmospheric deposition, or
bymechanicalcarriers,toexplainthebiogeographye.g.,[121–124]. Ineithercase,microbialdiversity
traveling by mechanical carriers, to explain the biogeography [e.g. 121–124]. In either case, microbial
studiesrevealthatenvironmentalparametersinfluencebiogeographicalpatterns[125,126].
diversity studies reveal that environmental parameters influence biogeographical patterns [125,126].
HowdoesthisrelatetotheHalorubrumandHaloarculagenerawithglobally-distributedspecies
How does this relate to the Halorubrum and Haloarcula genera with globally-distributed species
whicharegeneticallyrelated? Whichenvironmentalparametersareimportantinselection? Halophilic
which are genetically related? Which environmental parameters are important in selection?
archaeaaremetabolicallyflexiblewithrespecttotemperature,pHanddesiccatingconditions.Asurvey
Halophilic archaea are metabolically flexible with respect to temperature, pH and desiccating
ofallstudiedhalophilicarchaeasuggeststhatthesecellshavebroadpHandtemperatureranges[127].
conditions. A survey of all studied halophilic archaea suggests that these cells have broad pH and
SiroosiandcoworkersnotedthatHalorubrumsp. strainHa25grewandproducedproteinoverarange
oftemperature(30–55 ◦C)andoverapHrange(6.0–8.0)[128]. AHaloarculastrainfromGreatSalt
Lake,whichwasstudiedundertemperatureandsalinitystressoutsideofoptimalranges,adjusted
tochangingenvironmentalchangesbygeneregulation, whichmayprovidesomeinsightintothe
mechanismsofitsflexibilitywithenvironmentalconditions[45]. Underspaceexposureconditions,
inwhichthetemperaturerangedfrom−24.6to+49.5◦C,Halorubrumchaoviatorsurvivedandgrew
vegetativelywhenitwasreturnedtothelaboratoryonEarth[23]. Thus,itmaynotbesurprisingto
observeaHalorubrumspeciessurvivingthecoldtemperaturesofaTibetanPlateauandanotherofthe
samegenusinthewarmthofBaja,California(Table2).
In continuing to think about selection, we applied statistical analyses to compare the climate
andenvironmentalparametersofeachsitelocationofourcloselymatchedstrains(Tables1and2).
Here, we were not asking a question about dispersal mechanisms, but instead looking for
commonalities among isolation sites for these halophilic archaea. As shown in Figure 6, dry and
temperateconditionswerefavored,butthebroaddistributionofclimateclassificationspointsagainto
theflexibilityofthesespecies. Asexpected,giventheclimateclassificationresults,astatisticalanalysis
Description:Great Salt Lake Institute, Westminster College, 1840 South 1300 East, Salt Lake City, UT 84105, USA; halite [2,7–21]. Not only can halophilic