Table Of ContentPROC. ENTOMOL. SOC. WASH.
108(4), 2006, pp. 749-760
SYNONYMY OF THREE PESTIFEROUS MATSUCOCCUS SCALE INSECTS
(HEMIPTERA: COCCOIDEA: MATSUCOCCIDAE) BASED ON
MORPHOLOGICAL AND MOLECULAR EVIDENCE
JANIE M. BOOTH AND PENNY J. GULLAN
Department of Entomology, University of California, 1 Shields Avenue, Davis,
CA 95616-8584, U.S.A. (e-mail: [email protected])
Abstract.4The scale insect genus Matsucoccus Cockerell (Coccoidea: Matsucoc-
cidae) contains several economically important species that cause damage to pine
trees, Pinus species, in the United States and elsewhere in the Holarctic Region.
Efforts to reconstruct the phylogeny of the group have provided information on
genetic variation within and among species. Here, three species of Matsucoccus are
synonymized based on newly acquired molecular data and reassessment of
morphological data. Matsucoccus resinosae Bean and Godwin, described from the
eastern United States, and Matsucoccus thunbergianae Miller and Park, from South
Korea, are considered to be new synonyms of Xylococcus (now Matsucoccus)
matsumurae Kuwana. The taxonomic confusion surrounding these names _ is
discussed. In addition, we suggest that several other species of Matsucoccus,
including M. pini Green, should be investigated as possible synonyms of #.
matsumurae.
Key Words: Margarodidae, Matsucoccus, red pine scale, taxonomy
Matsucoccus Cockerell is a morphologi- unpubl. data). One relationship of par-
cally conservative group of scale insects ticular interest jis (thattiofi sthree. pest
placed either in the scale insect family species, Matsucoccus matsumurae (Ku-
Margarodidae (Ben-Dov et al. 2005) or in wana), the Japanese pine bast scale, M.
its own family, Matsucoccidae (Koteja resinosae Bean and Godwin, the red pine
1984, 1986; Foldi 2004). All species feed scale, and M. thunbergianae Miller and
exclusively on Pinus (Pinaceae) and are Park, the black pine bast scale. New
mainly Holarctic, with limited records from evidence supports the synonymy of the
the Neotropical and Indotropical regions three species. Entomologists have specu-
(Ben-Dov 2005, Ben-Dov et al. 2005). This lated that M. matsumurae and M.
genus has received moderate taxonomic resinosae are synonymous (Ray 1982;
treatment (Ray and Williams 1984, 1991; McClure 1983b, 1987; Foldi 2004). The
Gill 1993; Foldi 2004), and 34 extant species recent catalogue of Margarodidae (Ben-
are recognized (Ben-Dov 2005). Dov 2005) treats these two species
Recent research to reconstruct the separately, but mentions previous work
phylogeny of Matsucoccus has provided suggesting that M. resinosae may be
the first hypothesis of species relation- a junior synonym of M. matsumurae
ships based on molecular and morpho- (McClure 1983a, Young et al. 1984, Park
logical data (Booth, Cook and Gullan, et al. 1986).
750 PROCEEDINGS OF THE ENTOMOLOGICAL SOCIETY OF WASHINGTON
Matsucoccus resinosae infests red pine, thunbergianae from M. matsumurae and
Pinus resinosa, on the east coast of the M. resinosae, based on the adult females
United States. Red pine scale was first or the first-instar nymphs, but #.
recognized in 1946 in Easton, Connecti- thunbergianae is said to differ from the
cut (Plumb 1950), and its rapid spread other two species in the size of the adult
and the high tree mortality that it caused male, in the number of generations per
suggested that 1t was a new introduction year, and in overwintering as the second-
(Bean and Godwin 1955). It has been instar nymph (as the first-instar nymph
hypothesized that it was introduced in the other two species). Matsucoccus
during the 1939 New York World Fair thunbergianae is univoltine or has only
on exotic pines imported as a display, a partial second generation (Miller and
because the same truck that transported Park 1987), whereas M. matsumurae
the exotic pines from the port was used and M. resinosae are bivoltine or have
to transport red pines from Easton to the a partial third generation (McClure
fairgrounds (Doane 1959). The feeding 1977, Miller and Park 1987). Matsucoc-
cyst stage of M. resinosae can damage cus thunbergianae 1s considered a pest 1n
the needles, causing extensive flagging Korea on black pine (Miller and Park
and needle drop (McClure 1976, Duda 1987, Chung et al. 2000).
1977). Damage is particularly severe in Several available pieces of biological
plantations found south of red pine9s evidence support the synonymy of these
native range (Bean and Godwin 1955), three Matsucoccus species. First, the sex
apparently because low winter tempera- pheromones of MM. matsumurae, M.
tures in the pine9s natural range to the thunbergianae, and M. resinosae have
north prevent survival of red pine scale been shown to be cross attractive in
nymphs (Doane 1959; McClure 1983a, bioassay studies (Young et al. 1984, Park
b). Damage from the red pine scale has et al. 1986). The primary component of
resulted in almost complete removal of the sex attractant was identified and the
once abundant red pine plantations in pheromone is identical for the three
Connecticut and New York states and it species and has been named <8matsuone=9
is now difficult to locate intact stands (Lanier et al. 1989, Hibbard et al. 1991).
(J. Booth pers. observation, Providence Second, all species occur on hosts found
Water Supply Board 2005). in the same Pinus subsection, subsection
The Japanese pine bast scale, M. Pinus, of the pine tree phylogeny of
matsumurae, has similar biology and Gernandt et al. (2005). Matsucoccus
morphology to M. resinosae (McClure matsumurae occurs on seven Pinus spe-
1976, 1983a). This scale is a pest in Asia, cies (McClure 1983a), Matsucoccus thun-
especially on black pine, Pinus thunbergii bergianae only on P. thunbergii and P.
(Taketani 1972, Cheng and Ming 1979). densiflora (Miller and Park 1987), and
The species was described originally by M. resinosae is found on P. resinosa
Kuwana as Xylococcus matsumurae (Ku- (Kuwana 1905, Bean and Godwin 1971,
wana 1905, 1907), and later transferred Miller and Park 1987), which is the only
to Matsucoccus by Cockerell as the type species of the Pinus subsection Pinus in
species of his new genus (Cockerell the United States (Gernandt et al. 2005).
1909). Ray (1982) and McClure (McClure
The third species, M. thunbergianae 1983b) went further and noted that M.
Miller and Park, from South Korea, was resinosae and M. matsumurae are more
described as similar to M. matsumurae specifically found only on members of
and M. resinosae (Miller and Park 1987). the Sylvestres group of the subsection
if is not possible to distinguish M. Pinus. However, the Sylvestres group 1s
VOLUME 108, NUMBER 4 Til
Table I. Specimens of adult females examined for morphological analysis.
SSS
Species Name #- Slides (# Females) Collection Information Depository
M. matsumurae 1 (1 non-type) JAPAN: Kanagawa-ken, ex pine tree, 13.v.1919; BME
Coll. S. I. Kuwana (mounted from dry material
sent by Kuwana to F. B. Herbert)
1 (2 non-type) JAPAN: Nagashima, ex P. densiflora, 10.v.1970; BME
Coll. M. Inoure
2 (2 non-type) JAPAN: Nagashima, ex P. densiflora, 4.v.1970; USNM
Coll. M. Inoure
3 (4 non-type) JAPAN: Japan: Mie Prefecture, Shimagahara BME
Village, ex P. thunbergii; 24.11.2004; Coll.
T. Kondo
M. pini 3 (5 paralectotypes) ENGLAND: Oxshott, Surrey, ex P. sylvestris, BMNH
31.x.1922; Coll. F.C. Withycombe
M. resinosae 3 (holotype and 2 USA: Connecticut, Easton, ex P. resinosa, USNM
paratypes) 2.v.1948; Coll. George H. Plumb
M. 4 (holotype and 5 SOUTH KOREA: Kohung, Chollanam-do, USNM
thunbergianae paratypes) ex P. thunbergiana (now P. thunbergii),
collected x1i1.1983, lab reared iv.1984;
CollNSAE* Park
1 (2 paratypes) SOUTH KOREA: Kohung, ex P. thunbergii, BME
collected xi1.1983, lab reared iv.1984; Coll.
Sa@a bank
not recognized in the most current Pinus material was examined for M. resinosae
phylogeny (Gernandt et al. 2005). Third, and M. thunbergianae, whereas subse-
the distribution of M. matsumurae, M. quent material collected by the original
resinosae and M. thunbergianae supports author was studied for M. matsumurae
their synonymy. McClure (1983b) point- (see below under <8Type material=; also
ed out that the first two species are Table 1). Specimens from each collection
restricted to a similar northern latitudi- were scored for 14 morphological char-
nal limit: 41°509N in the U.S., 41°309N in acters (Table 3), including those previ-
Japan, and 41°309N in China. Similarly, ously recognized by Ray (1982). The
M. thunbergianae has been reported only diagnosis was prepared based on the
from South Korea (Miller and Park specimens listed in Table 1. Specimens
1987), for which the northern boundary examined are housed at the Bohart
lies at about 39°N. Museum of Entomology (BME), Uni-
Here we present the first molecular versity of California, Davis; The Natural
data and reassess the morphological History Museum, London (BMNH); and
evidence to show that specimens de- the Coccoidea Collection of the National
scribed as M. matsumurae, M. resinosae Museum of Natural History, Smithso-
and M. thunbergianae belong to the same nian Institution (USNM) in Beltsville,
species. We synonymize M. resinosae and Maryland.
M. thunbergianae under the senior syno- Genetic analysis.4Molecular data
nym M. matsumurae and provide a new were acquired for 13 specimens belong-
diagnosis for this species. ing to six named Matsucoccus species
that the authors field collected or that
MATERIALS AND METHODS colleagues donated (Table 2). Specimens
Morphology.4Morphological charac- were stored in 75% ethanol for slide
ters were evaluated and measured using mounting and 100% ethanol for molecu-
a Leica compound microscope. Type lar work. Genomic DNA was extracted
N
O
T
G
SHIN MsBAIGUNY] <q ayeway yNpe ALEr.9T1I <N, IO. SOOT Hp 8opureurloyyD 8Aud nlexy :va1oy yINoAVA FOF SHMSD s IZOGING avunisiaquny) <Py
A
W Joe
F 8M-H-2puOpurS[IDDO eepqLO jeq TTuo0 nyDo j|
O
DSOUISIAA <q ayeuUlay yNpe M,61co¬L 8N,10 Japug, Jo uonounl 8ueeuryd :oD preyyouT LO 8vsa OCOAWEL IDSOUISAA <A
TY Ioog <f TOD <pOOT XS Feary es eidniny
E DSOUISAA <q ysAO M,ProEl <NLS. apLAdnadvjey 8apiaaadvjeyT 20D ssoysing AN <WSN STOAWE IDSOUISAA <J
I
C BuldsurA <XK TOD 8SOOT AST *RUIYD
O
S UBAIGUNY] 8q ysAO Ay leSGl NFO JSBOYION SSOUIAOIgG Ulf Ul AJUNOD Suoji,A :vuryD LPOAWL avanuinsypiut wy
L o<M-WLpypS oeuOo oc y
A 11s4aquny] <q a]euldy yNpe AL¬0.9¬1 8N,9P SOBR][IA VILYRSCUNIYS 8oINOIJoIg Ap :uedee FIOPING avaniuinsjpiul <Py
C
I JOP <Cs pue yoog <f <S[IOD -SOOT HES
OG DUDIUIBAIA <ql ss30 N,£S.9L <N,10 SAUW[IOB] INNS <OPPASIag :OD .ses10ay s9UuLIg CW 9COaWL SNOIYIDS <WW
OL y100g <f MOD -pOOT XE! -peoy peotyioary
M DPB 8 ys M,6¬.CL N.SS SOYSHOY ISVY <PRsysIATY :OD ALOJNS AN poouWer SnJOIN]DS <W
O
T UIaITID) <CM MOD -v00XcV O T
EN DpIsld o[eulo} y[Npe M.8P0CL <N.CSo 8OL WxO <Cop AMP <9][IATOURI :OD YLOHNS AN tcOaWe SNJOIIVS "W
YIOOg <f [OD {POOT' A] {4191U9D S.AOUSIA 189104
HE 119]]NOD 8dq syduiAu NM,STo9IT (NZS oZE [PUONEN purpaagyD 8vunse Til 70D osaiq ures VO 6cOAIWL Snsojasiq <W
T
4100 <f TOD -POOTAT6 Aled
OF psosapuod 8q S330 NM, COcIZI <N.ZI a1e1g soul osidurgq 8AaT[@A SSBPID 70D BPRAON WO 9TOAIWL SNSOJASIG <JV
opuoy \L pue yioog <f <SOD 8POOT ANT <PU o8Pray
GS vsosapuod 8q sydwiAu M,9ScITI <Ns 8To UMOJI[SUIYS ppTST <UMO}JI[SUIYS 70D vIseYS WO ¬lLOAWe SNSOJASIG <We
IN yycydouow 8gq syduicu M,9S.811 <N6b.PE AIPM <CF WOD 1007 L AW4ed Jozery sop UE WD OOM INE SNIdAJDID <PW
ED yIoog <f TOD 8SOOT HEOE +68 AMH JO JJO
E SIMA Gl o[euloy yNpe M.IToCIT NuCbove 8sstq UIA SNBUTPY JO AA TU C*] OD redearyx ZY ScOdWN snidAjpon <Py
C
O yIoog <fF TOD *sOOTHEOE -A9TIPA TOMAS
PR synp2 <d a]RUldy Npe NM SEoTIT (NU 6ToVE jo q sojiw 9 8py uiseg toddoad :oD iedearx ZV LEOUWe sniddjpov <We
JSOH{ Snug aBeIS IIT so] RUIpIOOD UONBWIOJUT UOTIDAT[OD 2P9D VWNA auRN saroedg
<SISATBUR IP[NSITOU IOJ pasn suoumtdedg "~ FQuLl
VOLUME 108, NUMBER 4 YS)
using a Qiagen DNeasy® kit (Qiagen Inc., ograms of individuals within species were
Valencia, California, U.S.A.). DNA was aligned in Sequencher 4.0.5 and examined
extracted non-destructively in many sam- to identify variable sites and indels.
ples so that the cuticle could be saved for
identification. In the remaining cases, RESULTS AND DISCUSSION
a dead adult female found in association Molecular evidence supports the syn-
with the other life stages used for DNA onymy of M. matsumurae and M.
extraction was preserved and mounted resinosae with the new inclusion of M.
for identification. Identification was per- thunbergianae. Morphological analysis
formed using published keys and descrip- corroborates this information - no dis-
tions (Kuwana 1905, Bean and Godwin cernible consistent morphological differ-
1955, Ray 1982, Miller and Park 1987, ences are observed.
Foldi 2004) supported by knowledge of Nucleotide sequence data.4Matsu-
each species9 known distribution and coccus matsumurae, M. resinosae, and
host-plant(s) and, in the case of #. M. thunbergianae had identical sequences
thunbergianae, by the authorative identi- for thel8S and 28S D10 regions. The
fication of Seung-Chan Park who was one D24D3 region of 28S revealed a total of
of the describers of this species (Miller four polymorphisms among these three
and Park 1987). Standard methods for species. This amount of divergence is
scale insect DNA analysis were utilized similar to that seen in other Matsucoccus
for molecular work (Cook et al. 2002, species in terms of polymorphic sites or
Downie and Gullan 2004). Targeted intraspecific divergence, as exemplified
DNA sequences (Table 4) were obtained by M. acalyptus Herbert, M. bisetosus
using Polymerase Chain Reaction, gel Morrison, and M. gallicolus Morrison
agarose DNA visualization, and auto- (Table 5). A pairwise difference compar-
mated DNA sequencing at the UC Davis ison showed a maximum of 0.1% se-
Division of Biological Sciences DNA quence difference in the D24D3 region of
Sequencing Facility. Sequences were edi- 28S between M. matsumurae, M. resino-
ted in Sequencher version 4.0.5 (Gene sae, and M. thunbergianae (Table 6).
Codes Corp, Ann Arbor, Michigan, This is less than the 0.8% recorded
U.S.A.) and aligned in Se-Al (Rambaut within M. acalyptus, 0.7% within M.
1996). PAUP* (Swofford 2003) was used bisetosus and 0.9% within M. gallicolus
for determining pairwise differences (Table 6). Maximum parsimony recon-
among species of Matsucoccus. As part struction revealed no phylogenetic struc-
of a larger phylogenetic project, sequence ture among the individuals of M. matsu-
data from two nuclear ribosomal genes murae, M. resinosae, and M. thunber-
were analyzed (Booth, Cook, and Gullan, gianae. However, the clade containing
unpublished data). The markers exam- M. matsumurae, M. resinosae and M.
ined were the small subunit ribosomal thunbergianae had 100 percent bootstrap
gene (SSU rDNA or 18S) and the D2, D3 support and Bayesian posterior proba-
and D10 expansion regions of the large bilities value of 100 (Booth, Cook, and
subunit ribosomal gene (LSU rDNA or Gullan, unpublished data).
28S) for a total of approximately 2,070 Morphology.4Many 4 coccidologists
base pairs. These sequences were aligned have treated M. matsumurae and M.
and compared to assess the amount of resinosae as synonyms based on mor-
genetic difference between purported spe- phology and life history data (Herbert
cies. Polymorphic sites within individuals 1921,= Morrison9 "1928; <Ray, 1932.
were identified by examining electropher- McClure 1983b, Kosztarab 1996) but
ograms in Sequencher 4.0.5. Electropher- no formal synonymy has been published
754 PROCEEDINGS OF THE ENTOMOLOGICAL SOCIETY OF WASHINGTON
Table 3. Morphological features of adult females examined for cladistic analysis.
Morphological Characters Character States
Size (a) under 3 mm; (b) typically larger than 3 mm
Body Shape (a) elongate-ovoid; (b) ovoid with two parallel lobes;
(c) club shaped
Dorsum
Bilocular tubular duct distribution (a) on apical part of abdomen; (b) in rows on entire body
Cicatrix bands (a) absent; (b) 1-4 bands; (c) =5 bands
Cicatrix diameter (a) <9 um; (b) 9-20 um; (c) =25 um
(a) absent; (b) reduced; (c) fully developed
Antennal segmentation (a) 243; (b) 4-8: (c) 9
Segment 5 of antennae with 142 (a) absent; (b) present
fleshy setae
Long trochanter setae (a) 1 long setae; (b) 2 long setae; (c) 0 setae
Long setae near coxae (a) absent; (b) present
Long setae midventrally on abdominal (a) absent; (b) present
segments V4VII
Abdominal spiracles (a) 3 pairs; (b) >3 pairs
Multilocular disk pores (a) absent; (b) present
Setae in marginal abdominal bands (a) absent; (b) present
of bilocular ducts
(see Ben-Dov 2005). Below we formally description of M. thunbergianae recog-
synonymize these three names. No dis- nizes this similarity (Miller and Park
cernible and consistent morphological 1987), but notes that the main differences
differences were observed among speci- lie in the morphology of the adult male
mens identified as M. matsumurae, M. and several biological characteristics, as
resinosae, and M. thunbergianae. A re- we explained in the introduction. The
view of the morphology of the adult morphological differences among the
females for a larger cladistic study males of the three species are primarily
(Booth, Cook and Gullan, unpublished) size differences. However, there is sub-
shows the three species to be identical stantial overlap among the three species
based on 14 characters, including pore in the size ranges for all morphological
types, antennal morphology, and setal features measured by Miller and Park
characters, typically used to distinguish (1987), including: penial sheath length,
species of Matsucoccus (Table 3). The aedeagus length, length of antennal
Table 4. Genes and associated primers used for molecular analyses.
Gene Region Primer Sequence (59439) Primer Name Primer Source
18S 24-585 CTGGTTGATCCTGCCAGTAG 18S42880 Tautz et al. (1988)
CCGCGGCTGCTGGCACCAGA 18S4B von Dohlen and
Moran (1995)
28S D2-D3 GAGAGTTMAASAGTACGTGAAAC $3660 Dowton and Austin (1998)
expansion TCGGARGGAACCAGCTACTA A335 Whiting et al. (1997)
region
D10 expansion GAATGGATTAACGAGATTCTCAA None Modified from
region Dietrich et al. (2001)
CACAATGATAGGAAGAGCC None Dietrich et al. (2001)
VOLUME 108, NUMBER 4
~) Nn Nn
Table 5. Genetic differences among species for DNA sequences 18S and 28S.
rr
Number of Polymorphic Number of Polymorphic
Species Sites within Individuals Sites within Species
M. acalyptus
JMBO037 0 5 sites + two indels
JMBO038
JM B040 0
M. bisetosus
JMBO13 0 6 sites; no indels
JMB026
JMBO029 0
M. gallicolus
JMBO023 0 1 site: no indels
JMBO024
JMB036 0
M. matsumurae; M. resinosae; M. thunbergianae
(matsumurae ) JMBO014 4 sites: no indels
JMB047
(resinosae) JMBO025
JM B030
(thunbergianae) JMBO21
4D444oS
segments II4X, hind femur length, hind described (in part) by Herbert under
tibia length, forewing length, ratio of the name matsumurae.= Ray (1982) also
length of femur/length of tarsus, and lists Herbert9s M. matsumurae as a syno-
length of longest tubular duct on ab- nym of M. gallicolus. This information
dominal segment VII. was not included in the recent catalogue
Bean and Godwin (1955) differentiat- of the Margarodidae (Ben-Dov 2005).
ed adult females of M. matsumurae and Tang and Hao (1995) questioned the
M. resinosae based on life history and species concept of M. matsumurae used
a subtle morphological disparity con- by American authors, partly because of
cerning the position at which the trachea the confusion created by Herbert9s
enters the thoracic spiracles in the in- (1921) and Morrison9s (1928) mixing up
termediate or cyst instar (Bean and of M. matsumurae and M. gallicolus, and
Godwin 1955). Herbert (1921) had re- also because they surmised that there
described M. matsumurae based on both may be two species of Matsucoccus in
Japanese and American material. How- Japan. Tang and Hao (1995) suggested
ever, Herbert based his description partly that M. thunbergianae might be synony-
on American material collected by Mr. mous with Kuwana9s (1905, 1907) con-
J.G. Sanders from the host species P. cept of M. matsumurae, and that M#.
rigida and P. virginiana. These pines are resinosae and M. liaoningensis Tang may
both known hosts of M. gallicolus, and be synonyms. They based their argument
not hosts of M. resinosae (Ben-Dov on purported differences in biology and
2005). As a consequence of this confu- adult body size of the two species pairs,
sion with M. gallicolus, Morrison (1928) but they were selective in their use of
even suggested that M. matsumurae may morphological data and their assertions
be indigenous to the Atlantic seaboard of cannot be supported.
the USA. Later, Morrison (1939) recog- In addition, certain morphological
nized this error and, in his original features in Matsucoccus can vary in
description of M. gallicolus, noted: <<This response to environmental conditions.
is the insect which was figured and For example, Miller and Park (1987)
756 PROCEEDINGS OF THE ENTOMOLOGICAL SOCIETY OF WASHINGTON
Table 6. Pairwise differences table (uncorrected): D24D3 region of 28S.
M. M. M. M. M. M. M. M.
acalyptus acalyptus 4 acalyptus 4acalyptus 4_acalyptus bisetosus __ bisetosus bisetosus
(JMB002) (JMB037) (JMBO038) (JMBO039) (JMB040) (JMBO013) (JMB026) (JMBO029)
M. acalyptus (JMBO02)
M. acalyptus (JMB037) 0.001
M. acalyptus (JMBO038) 0.001 0.000
M. acalyptus (JMBO039) 0.004 0.003 0.003
M. acalyptus (JMB040) 0.007 0.006 0.006 0.008
M. bisetosus (JMBO13) 0.111 0.109 0.111 0.107 0.112
M. bisetosus (JMBO026) 0.109 0.108 0.109 0.106 0.110 0.000
M. bisetosus (JMBO29) 0.115 0.114 0.116 0.112 0.116 0.007 0.007
M. gallicolus (JMBO023) OMB7 0.137 0.136 0.133 0.136 Osmy, 0.117 0.118
M. gallicolus (JMBO24) 0.129 0.128 0.127 0.124 0.128 0.111 0.111 0.114
M. gallicolus (JMB036) 0.129 0.128 0.127 0.124 0.128 0.111 0.111 0.114
M. matsumurae (JMB047) 0.097 0.095 0.097 0.094 0.098 0.032 0.031 0.037
M. matsumurae (JMBO14) 0.098 0.097 0.098 0.095 0.100 0.034 0.032 0.038
M. resinosae (JMBO25) 0.099 0.097 0.098 0.095 0.100 0.034 0.033 0.038
M. resinosae (JMB030) 0.097 0.095 0.097 0.094 0.098 0.033 0.031 0.037
M. thunbergianae (JMBO021) 0.099 0.098 0.099 0.096 0.100 0.034 0.033 0.039
M. M. M. M. M. M. M.
gallicolus gallicolus gallicolus matsumurae 4 matsumurae resinosae resinosae
(JMB023) (JMBO024) (JMB036) (JMB047) (JMBO14) (JMBO025) (JMBO030)
M. gallicolus (JMBO24) 0.007
M. gallicolus (JMB036) 0.009 0.000
M. matsumurae (JMB047) 0.115 0.108 0.108
M. matsumurae (JMBO14) 0.117 0.110 0.110 0.000
M. resinosae (JMBO25) 0.115 0.108 0.108 0.001 0.001
M. resinosae (JMBO30) 0.116 0.108 0.108 0.000 0.000 0.000
M. thunbergianae 0.118 0.111 0.110 0.000 0.000 0.001 0.000
(JMBO21)
examined the overwintering and summer 1952, Foldi 2004). Boratynski (1952)
generations of both M. matsumurae from indicates in his published key to the
China and M. resinosae from the U.S.A. genus that the main difference between
and showed that the adult females of the M. matsumurae and M. pini is the width
overwintering generation of both species of the dorsal cicatrices, the number of
had more multilocular pores and larger peripheral loculi in the multilocular
cicatrices than the summer populations pores, the host tree, and the country of
(Miller and Park 1987). Furthermore, origin. Foldi (2004) states that #.
morphological plasticity in body size and matsumurae and M. pini differ in the
additional features has been observed for length of the bilocular tubular ducts and
other species of Matsucoccus (Boratynski the number of multilocular pores at the
1952, Ben-Dov 1981). apex of the abdomen. We examined the
A fourth species of Matsucoccus, M. paralectotype females of M. pini housed
pini (Green), is found on a member of the at the BMNH and their morphology falls
Pinus subsection, namely Pinus sylvestris within the range of variation of #.
(Green 1925). This species is distributed matsumurae. Foldi (2004) states that the
throughout Europe and differs only average body size for M. pini is 2.8 mm
subtly from M. matsumurae (Boratynski long, which is less than we recorded for
VOLUME 108, NUMBER 4 Ul
the specimens of M. matsumurae that we 14 years after Kuwana9s first description
measured, however, Foldi also provides of the species. The latter specimens
a greater body size range for M. matsu- were collected by Kuwana outside of
murae (2.544.5 mm long). Tokyo, Japan, in 1919, whereas Kuwa-
No specimens of M. pini were avail- na9s original collection was from Su-
able for molecular analysis, but given the gamo, Tokyo.
evidence of seasonal plasticity in size of Holotype of Matsucoccus resinosae
cuticular features in Matsucoccus, the Bean and Godwin, adult female: USA:
synonymy of M. pini with M. matsu- Connecticut, Easton, on Pinus resinosa,
murae seems likely. Other species that June 2, 1948, collected by George H.
should be examined in this context are Plumb;'"" label -also9 <iwithy ~ number
the Chinese species M. dahuriensis Hu **50.2156= (USNM). In their original
and Hu described from P. sylvestris var. description, Bean and Godwin (1955)
mongolica (Hu and Hu 1981), M. liao- referred to an adult female holotype as
ningensis ex P. tubulaeformis (Tang well as paratypes of different stages.
1QIS)S Me. <yunnanensis. Ferris9 *ex <P: However, no slides of the type series
yunnanensis (Ferris 1950), and the Rus- (all in the USNM) bear any label in-
sian species M. boratynskii Bodenheimer dicating which adult female is the desig-
and Neumark ex P. sy/vestris (Bodenhei- nated holotype. There are two slides of
mer and Neumark 1955). These host adult females with collection data match-
Pinus species all belong to the same ing those given for the holotype in the
Pinus subsection (Gernandt et al. 2005) original description; one slide has four
as M. matsumurae and appear morpho- adult females and the other has five, but
logically similar to it based on available neither slide has a type label of any kind.
drawings of the adult females. In the absence of an identifiable holo-
type, Ray (1982), in his unpublished
Matsucoccus matsumurae (Kuwana) dissertation, chose one specimen as the
primary type and clearly indicated this
Xylococcus matsumurae Kuwana 1905:
information on the slide, but incorrectly
91; Kuwana 1907: 209 (described again
labeled it <8lectotype= instead of holo-
ASmuae Sp):
type. Here we properly label the pre-
Matsucoccus matsumurae: Cockerell 1909:
viously unlabeled holotype (as recom-
56 (change of combination).
mended by F. Christian Thompson,
Matsucoccus resinosae Bean and Godwin
personal communication to P. J. Gul-
1955: 166. New synonymy.
lan); the specimen is on the slide that has
Matsucoccus thunbergianae Muller and
four adult females and is the second
Park 1987: 50. New synonymy.
adult female from the right of the data
Type material.4Syntypes of Xy/ococ- label (body length: 4.2 mm; width:
cus matsumurae Kuwana: JAPAN: To- 2.2mm). Paratypes of M. resinosae:
kyo, at Sugamo, on bark of the trunk of various life stages including adult fe-
pine-tree; collected May 20, 1903. The males (see Bean and Godwin 1955, page
type specimens of X. matsumurae were 169 for paratype information).
destroyed in an earthquake in 1923 Holotype of Matsucoccus thunbergia-
(Kuwana 1925, Tang and Hao 1995). nae Miller and Park, adult female:
Tang and Hao (1995) incorrectly refer SOUTH KOREA: Kohung, Cholla-
to a holotype and paratypes of YX. nam-do, on Pinus thunbergiana (now P.
matsumurae; there is no evidence that thunbergii), collected December 1984, lab
Kuwana ever designated types and the reared April 1984, collected by S.C. Park
so-called 8<8paratypes99 were collected (USNM). Paratypes: 26 adult females, 36
758 PROCEEDINGS OF THE ENTOMOLOGICAL SOCIETY OF WASHINGTON
adult males, 5 pupal males, 8 third-instar formation about material held there; F.
males, 25 first-instar nymphs: similar Thompson (Systematic Entomology
data to holotype (see Miller and Park Laboratory, USDA, Washington D.C.)
1987, page 50, for paratype information). provided nomenclatural advice. We also
Diagnosis.4The adult female of M. are grateful to S.-C. Park (Department
matsumurae can be diagnosed by the of Entomology, Forest Research Insti-
following features: body 3.1-4.1 mm tute, Tongdaemun-gu, Seoul) for speci-
long, elongate-ovoid in shape; bilocular mens from South Korea; X. Yingping
tubular ducts distributed in segmental (The College of Life Science and Tech-
rows on entire dorsum; 5 dorsal cicatrix nology, Shanxi University, Taiyuan) for
bands on abdominal segments III to VII, specimens from China; and J. Kelley
cicatrix diameter 8-14 um; antennae (Mount Pinos Ranger District, Califor-
with 9 segments, segment V of antennae nia), M. Callan (New York State De-
without fleshy setae; legs fully developed, partment of Environmental Conserva-
one long (80-100 um) trochanter seta, tion, New Paltz), and C. Maier
long setae (25434 um) near coxae on all (Connecticut Agricultural Experiment
pairs of legs; 7 pairs of abdominal Station, New Haven), who collected
spiracles; cluster of multilocular disk material in the U.S.A. J. Martin (The
pores on ventral apex of abdomen; long Natural History Museum, London) ar-
setae (26-40 um) midventrally on ab- ranged the loan of the type specimens of
dominal segments V4VII, and _ setae M. pini. S. Takagi (Graduate School of
present in marginal abdominal bands of Agriculture, Hokkaido University) pro-
bilocular ducts. vided information on Kuwana9s_ type
material. T. Kondo (UC Davis) collected
CONCLUSION specimens in Japan, translated some
Molecular and morphological data as Japanese literature, and read a draft of
well as host use, sex pheromones, and the manuscript; T. K. Qin (Biosecurity
biogeography support the formal synon- Australia) translated some Chinese text;
ymy of M. matsumurae, M. resinosae and G. Morse (UC Davis) commented on
M. thunbergianae. The name Matsucoc- a draft of the molecular results; D. Miller
cus matsumurae (Kuwana) has nomen- and C. Ray, Jr. also made valuable
clatural priority. Additional species that comments on the manuscript. The De-
should be considered for synonymy 1n- partment of Parks and Recreation, Ca-
clude M. pini and several other Eurasian lifornia, provided permission to collect in
species. state parks. This research was supported
by grant DEB-0118718 from the USS.
ACKNOWLEDGMENTS National Science Foundation (Partner-
L. Cook (School of Botany and ships for Enhancing Expertise in Taxon-
Zoology, The Australian National Uni- omy program) to P.J. Gullan and by
versity, Canberra) assisted with align- a University of California Davis Center
ment and interpretation of the nucleotide for Biosystematics Grant to J. Booth for
sequences; DD: Muller-vand!:)D: Creel molecular work.
(Systematic Entomology Laboratory,
ARS, USDA, Beltsville, Maryland) ar- LITERATURE CITED
ranged the loan of specimens from the Bean, J. L. and P. A. Godwin. 1955. Description
Coccoidea collection of the USNM; D. and bionomics of a new red pine scale,
Miller also generously hosted a visit by J. Matsucoccus resinosae. Forest Science I:
164-176.
Booth to the USNM Coccoidea collec-
. 1971. Red pine scale. Forest Pest Leaflet
tion in March 2005 and provided in- 10: 1-16.