Table Of ContentHindawi Publishing Corporation
Journal of Pathogens
Volume 2015, Article ID 562136, 11 pages
http://dx.doi.org/10.1155/2015/562136
Research Article
Restriction Profiling of 23S Microheterogenic Ribosomal
E. coli
Repeats for Detection and Characterizing of and Their
Clonal, Pathogenic, and Phylogroups
ParvathiJayasreeRajagopalanNairandSunitaSingh
SchoolofBiotechnology&Bioinformatics,D.Y.PatilUniversity,Plot15,Sector50,CBDBelapur,NaviMumbai,
Maharashtra400614,India
CorrespondenceshouldbeaddressedtoSunitaSingh;[email protected]
Received1August2015;Revised31October2015;Accepted2November2015
AcademicEditor:OlimpiaPepe
Copyright©2015P.JayasreeRajagopalanNairandS.Singh.ThisisanopenaccessarticledistributedundertheCreativeCommons
AttributionLicense,whichpermitsunrestricteduse,distribution,andreproductioninanymedium,providedtheoriginalworkis
properlycited.
Correlating ribosomal microheterogenicity with unique restriction profiles can prove to be an efficacious and cost-effective
approach compared with sequencing for microbial identification. An attempt to peruse restriction profiling of 23S ribosomal
assemblagewasventured;digestionpatternswithBfaIdiscriminatedE.colifromitscolonymorphovars,whileHaeIIIprofiles
assisted in establishing distinct clonal groups. Among the gene pool of 399 ribosomal sequences extrapolated from 57 E. coli
genomes,varyingdegreeofpredominance(I>III>IV>II)ofHaeIIIpatternwasobserved.Thiswasalsocorroboratedinsamples
collectedfromclinical,commensal,andenvironmentalorigin.K-12anditsdescendantsshowedtypeIpatternwhereasE.coli-B
anditsdescendantsexhibitedtypeIV,bothofthesepatternsbeingexclusivelypresentinE.coli.Anear-possibleassociationbetween
phylogroupsandHaeIIIprofileswithpresumablecorrelationbetweentheclonalgroupsanddifferentpathovarswasestablished.
Thegenericnature,conservation,andbarcodegapof23SrRNAgenemakeitanidealchoiceandsubstituteto16SrRNAgene,the
mostpreferredregionformoleculardiagnosticsinbacteria.
1.Introduction of ribosomal appendage is the degree of conservation and
heterogenicity, with the nonvariable, slow evolving regions
The need of rapid assay with low detection limits has preferred for the identification and variable regions being
reverberated genotypic techniques to gain momentum in the choice for phylogenetic studies [10, 11]. While design-
diagnosticfieldwhichnotonlyrevolutionizedbutenhanced ing universal or specific primers against these stretches,
the authentication process. Within a short span, the evolv- parameters like primer specificity, hybridization efficiency,
ing concepts and strategies for molecular detection have andampliconincongruityarisingduetomicroheterogeneity
resulted in the shift of “gold standard” from being DNA- within rrn copies must be taken into consideration [12,
DNAhybridization(DDH)tocurrentlyNucleicAcidAmpli- 13]. These precautionary measures can help in limiting the
fication Techniques (NAATs) and gradually towards Aver- pitfallsofmolecularassayandhelptowinnowtheingrained
age Nucleotide Identity (ANI) [1–4]. Among the NAATs, information regarding the usability and effectiveness of
Polymerase Chain Reaction (PCR) based on amplification primers for identification. An alternative to this scenario is
of 16S rRNA region [5, 6] followed by the sequencing of toexploitinter-andintragenicribosomalmicroheterogeneity
amplicon forms a simple yet efficient rationale for bacte- fordevelopingSingleNucleotidePolymorphism(SNP)based
rial barcoding [7]. Basis for targeting this gene segment discriminative methods. The logic behind this stratagem is
is reasoned by the ubiquitousness in bacterial kingdom to todevelopbroadrangeprimersagainstmicrodiverseregions
multipleribosomalRNAcopies/numbers,rrn[8,9]provid- ofthetargetedstretchwhichencompassdistinctrestriction
ingsensitivityinPCRreaction.Anotherremarkablefeature profilecharacteristictoeachorganism(s)understudy[14].
2 JournalofPathogens
Thiscurrentstudyisanendeavortoentitle23SrRNAgene clinical,andenvironmentalorigin.Lyophilizedstrainswere
assubstitutetodefactobarcode,16SrRNAgeneusingampli- procuredfromMicrobialTypeCultureCollection(MTCC),
ficationensuedbyrestrictiondigestioninsteadofsequencing, Institute of Microbial Technology (IMTECH, Chandigarh,
making it a cost-effective approach. The exemplification of India),forbothidentificationandclonalitystudies(Table1).
the proposed method was carried out to detect and differ- Five different sets of fecal droppings from rat, chicken,
entiateE.coli(candidate)fromE.aerogenes,K.pneumoniae, pigeon,rabbit(petshops,Crawfordmarket,Mumbai,India),
andC.koseri(noncandidates).Theabovechoicewasfinalized andhumans(ExcelPathologyLab,Vashi,NaviMumbai)were
afterconsideringthefollowing:(i)alltheselectedmicrobes, considered for isolation of commensal samples. The strains
∘
bothcandidateandnoncandidate,areGramnegative,lactose were revived in nutrient broth at 37 C. For environmental
positive microbes of 𝛾-Enterobacteriaceae family [15]; (ii) strains,watersamplefromtenlocalwaterbodieslyinginand
all are urinary tract infection (UTI) pathogens with E. coli aroundtheparentinstitutewasutilized(areaswithhospitals
being reported as the major causative factor [16–18]; and orhealthcarecentersinthevicinitywereavoidedtoprevent
lastly(iii)allexhibitsimilarcolonysemblanceandanyfalse cross-contamination with clinical samples). For isolating E.
positiveandnegativebiochemicalcharacterizationresulting coliofclinicalorigin,urinesamplesfromtwenty-fivepatients
inmisinterpretationwithcandidatestrain. sufferingfromUTI(ExcelPathologyLab)wereconsidered.
In spite of being the model representative of bacterial The samples were processed within 24hrs of collection
kingdom, E. coli is also acknowledged for its omnipresence (eitherinziplogbagsorinsterileglassbottle)onMacConkey
and the capability of switching from good to bad microbe. agar(MAC).Thedistinctpinkcolonieswererestreakedonto
Pathogenic E. coli are classified into aggressive, invasive, both MAC and Eosin Methylene Blue (EMB) agar, respec-
pathogenic,hemorrhagic,andtoxigenicwhichdiffersintheir tively [31]. Isolates giving discrete colony morphology with
virulencegenesacquiredandthetypeofpathogenicity[19]. indeterminategreenishsheenwereselectedandevaluatedfor
Comparative study of commensal and pathogenic strains the false positive and negatives by both microbiochemical
of the same has shown a rather surprising result of fewer and molecular assays. Each of the selected colonies was
pathovar specific sequences evincing E. coli as a genera list pickedwithsterilewoodentoothpicksandtransferredtofive
∘
[12]. Sharing of 40% of core genomes among both virulent mLofnutrientbrothandincubatedovernightat37 C.These
and nonvirulent strains indicates clonality [20]. This con- sampleswerefurthercharacterized[32]byIMViC;1mLwas
ceptualizesanopenpangenomehavinggeneticreservoirsto utilized for DNA isolation and the remaining was used for
allowgeneacquisitionforevolvingintopathogenicones[21]. preparingglycerolstock(25%glycerol)forfuturereference.
BesidesisolatesofE.colipresentinnature,theroutinely
used nonvirulent lab strains are K-12, B, W, Crooks, and C 2.2.GenomeDatabaseandMicroheterogenicityAnalysis. The
withallbeingfecalinoriginexceptforstrainW(soilisolate) aboriginalstepinvolvedtheaggregationofGenbankgenome
[22]. Method of rapid identification of K-12 strains using sequencesofallthestrainsthatwereconsideredforthisstudy
mutationsinO-antigengenecluster[23]anddetermination fromthepublicdatarepository,NationalCentreforBiotech-
oflabstrainslineageusingmultiplexprimers[24]havebeen nology Information (NCBI). The data pool (until 11 April
reported. Studies on the lineages of well-established E. coli 2013) comprised an assemblage of 61 completed genomes
lab strains across the globe have shown that most strains (Supplementary Data A.1 in Supplementary Material avail-
are derived from either K-12 or B [25, 26]. Genomes of able online at http://dx.doi.org/10.1155/2015/562136) with 57
these supposed to be parental strains show 99% genetic of candidate strains (E. coli) and noncandidate strains (K.
identity with exceptions to IS elements and flagellar genes pneumoniae,C.koseri,andE.aerogenes).Thefollowingsteps
[27]. Phylogeneticclassification of E. coli strains into A, B1, wereexecutedtoanalyzethemicroheterogenicity(Figure1)
B2,D,andEgroupsusingMultilociEnzymeElectrophoresis, whichcandirectlyassistinevaluatingtheelectabilityof23S
MLEE [28], and triplex [29] has given insights into the rRNAgeneasanidealbarcode.
concept of clonality in E. coli. A comparative analysis of Twostrains,onefromthecandidateandonefromnon-
MLEEandrandomamplification,restrictionprofilingagainst candidategenome(E.colistr.K-12MG1655(NC 000913.2),
16S-23Sintertranscribedregion,andribotypinghaveverified C. koseri ATCC BAA-895 (NC 009792.1), E. aerogenes
that horizontal gene transfer mechanisms do not disrupt (NC 015663.1),andK.pneumoniaesubsp.pneumoniaeMGH
organizationofclonalpopulation[30]. 78578 (NC 009648.1)), were selected and assigned as refer-
No study till date has correlated Amplified Ribosomal encestrain.
DNA Restriction Analysis (ARDRA) of a core segment in For studying intergenic variability among the candidate
23SrRNAgeneagainstthepangenomeandtriedtoestablish andnoncandidatestrains,therrsH(16SRNAgene)andrrlH
a link between phylogroups, pathogroups, and restriction (23SrRNAgene)sequenceontheregularstrand(reference
groups. strains)wereextrapolatedandmultiplesequencealignment
(MSA) using ClustalW [33] was executed. Total mismatch
2.MaterialsandMethods was enumerated by the addition of number of mismatches
and sequence gaps introduced during the “line-up” of two
2.1.BacterialStrainsandCultureConditions. Authentication ormoresequences.Themismatchpercentagewascalculated
ofthemolecularassayinscreeningandidentifyingthecan- bydividingthetotalmismatchesseenacrossthefourstrains
didateorganismwasexecutedintoparts,onewithstandard bytheaveragebasepair(bp)forboth16Sand23Srrngene,
strainsofE.coliandtheotherwith25isolateseachfromfecal, respectively.
JournalofPathogens 3
Table1:Listofstandardstrainsusedinthisstudy.
Strains MTCC ATCC Nature
Barcoding/identificationstudies
Noncandidatestrains
Citrobacterfreundii 1658 8090 Clinical
Citrobacterkoseri 1657 27028 Bloodculture
Klebsiellapneumonia 432 33495 Urinaryculture
Enterobacteraerogenes 111 13048 Sputum
Candidatestrains
433 15228 Commensal
Escherichiacoli 4296 19138 Urine
448 25922 Clinicalsample
Diversity/clonalitystudies
1302 — K12
2622 10798 DescendentofK12
1667 — DH1
1304 — C1
1687 8739 Crooksstrain
Escherichiacoli 448 9637 W
2692 53846 DescendentofW
1303 — B
1678 — BL21
1679 — BL21DE3
1680 — BL21DE3Lys5
E.coli,namely,K-12,B,C,Crooks,andW,arecommonlyusedaslabstrains.WholegenomicdataofthesestrainsexceptstrainCisavailable(NCBIGenomes).
Candidate microbe
Estimation of diversity (multiple sequence alignment: MSA)
Escherichia coli
Intergenic diversity
rrlH from each
57 genomes (G) representative genome Intragenic diversity
(21 pathogenic,
36 nonpathogenic) (i) Complementary strands of
Virtual digestion
each genome
was individually
Extraction of23S rrn carried out on each (ii) Regular strands of each
rrlH genome
sequences from each genome
A total of 430 sequences considering both
candidate and noncandidate genomes Restriction patterns were
Restriction profiling for checked in all the 430
differentiating candidate ribosomal segments
from noncandidates
(NEB V2.0) Unique profile in
85 restriction groups candidate alone
(barcoding)
(Suppl. A.2)
Klebsiella pneumoniae (2 G) Bfa I was chosen
Enterobacter aerogenes (1 G)
Citrobacter koseri (1 G)
Polymorphic within candidate
Noncandidate Similar restriction patternsDissimilar restriction patterns genome
(rejected)
microbe (selected) (clonality)
Hae III was chosen
Figure1:Schematicrepresentationofmethodologyfordetectingbarcodeandestimatingclonality.Theprimersaredesignedagainstthe
regionsthatflanktheserestrictionsequenceswhichgivesuniquebandsrevealingidentificationorclonality.
For estimating the intragenic variability, all the riboso- 2.3. Virtual Restriction Profiling. Virtual restriction profiles
mal segments from 57 E. coli genomes were extracted (7 usingNEBV2.0[34]with85restrictiongroups(Supplemen-
copies/genome);complementaryandregularstrandswithin taryDataA.2)wereperformedforatotalof430ribosomal
eachstrainweresegregatedandthepercentagemismatches segments that included 399 from 57 E. coli genomes and
foreachofthegenomesweredetermined. 7, 8, and 16 rrn sequences from C. koseri, E. aerogenes,
4 JournalofPathogens
Table2:RestrictionsiteofBfaI(C/TAG)within23SrrlHofcandidateandnoncandidatesandtherestrictionprofileswith23SP1880.
RestrictionprofilewithinrrlH FragmentsobtainedonARDRA
F E Ci K Ea Mic. Fragments(ampliconsize)
1.1 687 685 685 685 E 665bp,215bp(880bp)
1.2 874 874 874 C 475bp,214bp,and189bp(878bp)
1.3 1670 1669 1667 1670 K 475bp,214bp,and189bp(877bp)
1.4 2336 2339 Ea 475bp,214bp,and189bp(876bp)
1.5 2652 2653 2650 2654
Primersweredesignedagainsttheregionsflankingtheboldrestrictionsites.
F:numberoffragments;E:Escherichiacoli;Ci:Citrobacterkoseri;K:Klebsiellapneumoniae;Ea:Enterobacteraerogenes;Mic.:microbe.
23SP1880-FP(+):5-GGCGAAAAGAACCCCGGCGA-3(20nt);23SP1880-RP(−):5-AGGGGTCGACTCACCCTGCC-3(20nt).
FP:forwardprimer;RP:reverseprimer.Theprimerdetailswereobtainedfromtheresultsofprimerblastandrestrictionprofilingpatternwasobtainedfrom
NEBV2.0.Forwardandreverseprimersof23SP1880liewithindomainsIandIIIof23SrRNAsecondarystructure,respectively,withBfaIsitesindomainII.
Table3:ClonalgroupsbasedonHaeIII(GG/CC)profileswithinthecandidatemicrobeusing23SP2682.
Virtualdigestpattern TypesofHaeIIIrestrictionpatternobservedamongst399rrnsequencesofE.coligenomes
F C TypeI TypeII TypeIII TypeIV
1.1 785 CutsitewithinrrlHofcandidaterrnsegments
1.2 1042 1984 1984 1984 1984
1.3 1116 x 2163 X 2163
1.4 1217 x X 2205 2205
1.5 1361 2415 2415 2415 2415
1.6 1445 Cutsitewithintheamplicon(682bp)
1.7 1907 28 28 28 28
1.8 1984
x 207 X 207
1.9 2161
x X 249 249
1.10 2205 459 459 459 459
1.11 2415 Fragmentsobtainedforeachgroup
28bp,179bp,223bp,and 28bp,210bp,221bp,and 28bp,42bp,179bp,
1.12 2839 28bp,223bp,and431bp
252bp 223bp 210bp,and223bp
Primersweredesignedagainsttheregionsflankingtheboldrestrictionsites.F:numberoffragments;C:cutsites.
23SP2682-FP(+):5CCGACCTGCACGAATGGCGT3 (20nt).
23SP2682-RP(+):5CAGTTCTCCAGCGCCCACGG3 (20nt).
Forwardandreverseprimersof23SP2682liewithindomainIVandtransitionofV-VIof23SrRNAsecondarystructure,respectively.Firstcutsitesliewithin
domainIVwhereastherestliewithindomainV.
and K. pneumoniae strains, respectively. Among the 14 primers.Therearetwoprimersets:23SP1880[Probe31778738]
common cutters groups (Supplementary Data A.3), Bfa I wasselectedwithBfaIrestrictiondigestion(Table2)demarking
(Supplementary Data A.4) was selected as the enzyme for thecandidateand23SP2682 [Probe31781046](Table3)with
barcoding as it gave conserved and distinct pattern across polymorphicHaeIIIrestrictionsiteswasselectedforaddress-
all the 399 rrn sequences (not shown) in differentiating the ingclonality.Possibilityofself-primingandprimer-dimerfor-
candidate from the noncandidate strains. The uniqueness mationofeachprimerwascheckedusingfreewebtools{Oli-
and position of the cuts sites for giving unique bands on gocal(http://www.simgene.com/OligoCalc),OligoEvaluator
agarosegelelectrophoresiswerealsoaleadreasonconsidered (http://www.sigmaaldrich.com/technical-documents/articles/
forfinalizingthisenzyme.HaeIIIdisplayingpolymorphism biology/oligo-evaluator.html),andmultipleprimeranalyzer
patternwith23SrDNAsegmentsofcandidatemicrobewas tool(http://www.thermoscientificbio.com/webtools/multiple-
finalizedfordiversitystudies(Figure1). primer/) maintained by SimGene, Sigma, and Fermentas,
resp.}.
2.4. Primersand RestrictionEnzymes for AddressingIdentity BLAST genome (Supplementary Data) assisted in veri-
and Clonality. Sequenceof rrlHof E. coliK-12 str. MG1655 fying the conservation and specificity of primers, amplicon
wasusedasthetemplatefordesigningbroadrangeprimers size, Bfa I recognition sites, and region of hybridization
using Primer-BLAST [35]. In conjunction with parameters acrossthegenomeof931bacterialfamilies.Afteromittingthe
likeGCcontent,𝑇𝑚 value,andtheampliconsizenumberof nonannotatedsequences,allofthecompletedwholegenome
restrictionsiteswithintheampliconandthesizeoffragment data aggregated under phyla Actinobacteria, Bacteroidetes,
after digestion were kept as the benchmark for finalizing Chlamydiae,Cyanobacteria,Firmicutes,Proteobacteria,and
JournalofPathogens 5
Spirochaetae of the bacterial kingdom were considered for percent mismatches in both complementary and regular
theanalysis. strands making it an ideal cluster with the highest degree
of conservation. Similar values of mismatches were seen in
2.5. DNA Isolation, Amplification, and Restriction Digestion. SE11 (Commensal), CB9615 (EPEC), and 0104:H4 2009El-
DNA isolation was performed according to Parvathi and 2011 (EAEC). These results indicate that there is no cor-
Singh[36].Thereactionsoupcomprised2𝜇Lofsupernatant relation between intragenic diversity of target stretch and
(DNA), 0.5𝜇M of each forward and reverse primer, 1x of pathogenicityofstrains.Thesedifferencessubstantiated23S
assay buffer (10mM Tris-HCl, pH 8.8, 50mM KCl), MgCl2 RNA clusters having microdiverse organization with both
(1.5mM),dNTPmix(800𝜇M),and0.5U/𝜇LTaqpolymerase conserved and variable stretches within them. Sequevars
(Kappa Systems, KK5004). Standard genomic DNA of E. arisingduetothisheterogeneityunavoidablyleadtobiased
coli K-12 (Merck) and nuclease-free water were used as results, differential amplification, and chimeric molecules.
positive and negative control. The reactions were carried Thus,themethodofscreeningandtargetingrestrictionpro-
out in a thermal cycler (Bioer) with the program set for file pattern within a region of choice (ribosomal segments)
∘ ∘
25cyclescomprisingdenaturation(95 C),annealing(68 C), andspecifictobacteriaofinterestdemonstratesauthenticand
andextension(72∘C)for30seach.3𝜇LofthePCRproduct simpler practice than routine molecular strategy involving
was digested with 2U of respective enzyme (Fermentas, amplificationandsequencing.
ThermoScientific)in5𝜇Lreactionmixat37∘Cfortwohours.
Theampliconsandtheirrestrictionproductswereanalysed 3.2. Barcoding E. coli from Its Colony Morphovars: ARDRA
by agarose gel electrophoresis (AGE) at 5V/cm in 2% and of 23S P1 with Bfa I. PCR amplification of the stan-
880
2.5%agarosegels,respectively,eachcontaining0.5𝜇g/mLof dard strains and isolates of different origin (commensal,
EtBr.ThegelswereviewedandphotographedinBioImaging urine, and clinical sample) with 23S P1880 gave amplicons
Systems(Syngene). (880bp) of high intensity with no primer-dimer formation
(Figure 2(a)). Restriction digestion of the amplicons with
Bfa I gave unique fragments of 665bp and 215bp in E. coli
3.ResultandDiscussion
whereas C. koseri, E. aerogenes, and K. pneumoniae each
3.1.GeneticDiversitywithin23SRibosomalRepeatsforIdenti- gave fragments of 475bp, 214bp, and 189bp, respectively
fication of E. coli. 23S rRNA gene showed 0.87% intergenic (Figure 2(b)). The genotypic strategy proved superior to
variations compared with 16S rRNA within the reference biochemicalcharacterizationtakingintoconsiderationallthe
genomes(SupplementaryDataA.5).Theresultseemedobvi- possible positive, negative, and false positive and negative
ous due to the increased frame size of the latter but this resultsacross25isolateseachfromclinical,commensal,and
also encouraged perusing microheterogenicity analysis of environmental origin (Supplementary Data A.7). 18 (72%)
the largest ribosomal segment for further approach. The of clinical, 22 (88%) of commensal, and all the 25 (100%)
sizes of target segments varied from 2903 to 2907bp with environmentisolatesshoweddistinctrestrictionpatternlike
maximum gene length observed in ATCC8739 (Crook’s that of E. coli. BLAST genome search across 931 bacterial
strain) accounting for 2970–2985bp followed by E24377A families verified the specificity of primers and restriction
displaying sequences of 2923–2925bp. One rrn of UM 146 preference for Bfa I. The primers showed exclusive binding
and ETECH10407 were of 1762bp and 1561bp, respectively only with Enterobacteriaceae family (Supplementary Data
(Supplementary Data A.9). Absolutely no link between rrn A.8). Among the various strains in the family only Shigella
size and pathogenicity could be defined because the varia- spp., Salmonella enterica (Arizona), and Proteus mirabilus
tions were random, ATCC8739 being a laboratory culture exhibited similar restriction preference to that of E. coli. In
of fecal origin and UM146 an EIAC strain, E23477A and spiteofShigellaspp.beingtaxaindisguiseofE.coli[37]they
ETECH10407ofETECorigin. canbeeasilyscreenedusingselectivemediumbecauseofno
Ribosomal genes were found to be distributed across lactose fermentation [38] whereas Salmonella enterica and
complementary and regular strand with majority of the Proteus mirabilis showed amplicon heterogeneity of 1073bp
genomes (46 out of 57) showing segregation in five regular and880bpduringamplificationthusmakingiteasytoavoid
and two complementary strands. All the 23S rrn sequences erroneousconclusionsandmisinterpretation.
distributed within the regular and complementary strands
acrossrespectivegenomeswereindividuallysortedforMSA 3.3.CategorizingE.coliStrainsUsingARDRAof23SP2 with
682
to attain an understanding of intragenic variation. Analysis HaeIII. AdetailedanalysisoftheHaeIIIprofileacross399
revealed the highest level of mismatches in complementary sequences[SupplementaryDataA.9]ofribosomalsegments
strands compared with their counterparts (Supplementary of E. coli indicated four possible profiles, types I, II, III,
Data A.6). The highest level of mismatches mounting to and IV, with varying degree of predominance within these
0.6%, corresponding to 50% of the targeted gene size was segments. The rest of the candidate strains showed type III
perceived in complementary strands of P12b (commensal), patternsbuttypesIandIVwereexclusiveforE.colistrains.
E2348/9 (EPEC), and ETEC H10407. The greatest dispar- Majority of genomes (𝑛 = 32) as in 15 nonpathogenic and
ity among sequences in regular strand was observed in 17pathogenicstrainsshowedtypeIprofiles(57%)followed
APEC01with0.03%(88/2903)followedbyCFT043(UPEC) by type III (35%) predominating in 15 strains. Six strains
and042(EAEC)having0.016%(∼42–51/2903)dissimilarity. showedtypeIVpattern(10%)ofwhichfourwereBstrains.
23Sribosomal copies of ED1a (commensal) showed zero TypeIgroupsrepresentE.colistrainsthatlackedrecognition
6 JournalofPathogens
1 2 3 4 5 6 7 1 2 3 4 5 6 7 8
880bp
665bp
475bp
215bp 214bp
178bp
(a) (b)
Figure2:(a)BroadRangePCRof23SP1880withgenomicDNAisolatedfromstandardstrains.Lane1:100bpladder;Lane2:blank;Lane3:
E.coli;Lane4:C.freundii;Lane5:C.koseri;Lane6:K.pneumonia;Lane7:E.aerogenes.PCRproductofsinglerepresentativeofE.coliwas
loaded.(b)ARDRAof23SP1880ampliconswithBfaI:Lanes1,2,and3:E.coli(ATCC15223,ATCC25922,andATCC11775);Lane4:C.freundii
(ATCC8090);Lane5:C.koseri(ATCC27028);Lane6:K.pneumonia(ATCC33495);Lane7:E.aerogenes(ATCC13048);Lane8:100bpladder.
elementsduetochangeat2205thand2161stbasewithrespect Among the isolates, 21 out of 22 commensal and 16 of
to23SrDNAorwithreferencetoampliconsat207thor249th 18 clinical samples showed type I pattern; heterogenicity of
base positions. Type IV strains are contrary to type I with patternswasnotobserved.Theseresultsreaffirmedpredom-
intactrecognitionsequenceatbothofthesesites.Strainswith inance (93%) of type I in nature. Multisequence typing has
type II profiles lacked 2161st (249th) cut site and type III showncommensalstrainstobecategorizedprimarilyunder
lackedthe2205th(207th)cutpositions,respectively.TypeII groupAorgroupB1whereasgroupsB2,D,andEcomprise
wastherarestwithitspatternsobservedtobeambiguousin generallypathogenicstrains;K-12,B,andCrooksstraincome
certainrrnsegments. underphylogroupAwhereasstrainWisaB1phylogroup.
Heterogenicityinfewgenomeswasnoted;tworrnamong
sevenrepeatsofW(NC 017685.1,eachinregularandcomple- 3.4.LocalAlignmentof23SrrnHaeIIIProfilesversusGlobal
mentarystrand)andKO11FL(NC 017660.1,eachinregular Alignment to Establish Clonality in E. coli. A number of
and complementary strand) and one in KO11FL (NC 016 genes that are of core, dispensable, and unique in nature
902.1,regular)showedtypeIIprofileinspiteoftypeIbeing make up for pangenome; the latter two are gained due to
theirprimarypattern.OneamongsevenoftheBstrainsREL recombinationalortranspositionalevents.Toobtainsimilar
606 (NC 012967.1, regular), BL21-Gold (NC 012947.1, com- clustering on comparing whole genome would emphasize
plementary),BL21DE3(NC 012971.2,regular),andBL21DE3 the significance of these restriction profiles and help in
(NC 012892.2, regular) showed type I profiles apart from establishingtheclonalnatureandpredominanceofasingle
being prevalent with type IV pattern. Similarly, two rrn clone. Hence dendogram constructs with 682bp amplicon
amongNRG873C(NC 017634.1,eachinregularandcomple- from a representative of each restriction profile will show
mentarystrand)andLF82(NC 011993.1,eachinregularand distinctclusteringoftheseprofilesduetothefactthatasmall
complementary strand) and one in CFT073 (NC 004431.1, subsetofsegmentswithinthewholegenomewasconsidered.
regular) showed type I pattern while exhibiting type III Theglobalalignmentofwholegenomesequences(Figure4)
patternpredominance.APEC01(NC 008563.1)beingprime oftheentire57E.colistrainsdisplayeddistinctconcentrate
in type III showed one rrn segment of type I and type IV of type I, III, and IV profiles. An intrinsic analysis of the
(both in regular strand). E. coli strain 042 (NC 017626.1) spot of divergence and respective clade formations showed
displayedpreponderanceintypeIpatternbutthreerrn(two interestingandrivetingfindings.Thestrainsattheancestral
regular and one complementary) copies exhibited type III rootshowedtypeIpatternandthenextdivergentnodepoint
pattern.OneoftheregularrrnelementsinLF82showedtype (D1)displayedformationoftwodistinctclansoftypeIand
IVpattern.ThefragmentationpatternobtainedbyARDRA type IV profiles segregated at the maximum distance from
of 23S P2682 with Hae III in the standard samples showed oneanother.Numberingofnodeswas doneby considering
thatallK-12,C,W,Crooks,andtheirrespectivedescendants the precedence of branch point at every node. A possible
exhibitedtypeIprofileswithtypeIVprofilesbeingexclusively scenario of two additional mutational events that are of
presentedbyBstrains(Figures3(a)and3(b)). transitional nature (A to G) at 2205th and 2161st bases has
JournalofPathogens 7
1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8
682bp
431bp
223bp
1 2 3 4 5 6 7 8 9 1 2 3 4 5 6 7 8
223+
210+
223+210bp 210bp
179bp
(a) (b)
Figure3:(a)BroadrangePCRof23SP2682withgenomicDNAisolatedfromstandardstrainsofE.coli.TheupperrowcomprisesLane1:
K-12strains;Lane2:derivativesofK-12strains;Lane3:DHIstrain;Lane4:strainC1;Lane6:Crook’sstrain;Lane7:Walker’sstrain;Lane8:
descendentofW;Lane9:blank.ThelowerrowcomprisesLane1:Bstrain;Lane2:BL21strain;Lane3:BL21DE3;Lane4:BL21DE3Lys5
(B3);Lane6:E.coli(ATCC15223,commensalisolate);Lane7:E.coli(ATCC11775;urinesample);Lane8:E.coli(ATCC25922,clinical).
Lanes5/5 andLanes9/9 inbothrowsare100bpladderandblank,respectively.(b)ARDRAof23SP2682ampliconswithHaeIII:Lane1of
bothrowscomprises100bpladder.ThedigestedproductsareloadedaspertheordergiveninFigure2(a).
introducedHaeIIIrecognitionpatterns.D6gavelineagesof Table 4: Corelation between phylogroups, Hae III profiles, and
B1 phylogroups, D9 giving rise to B2 clades (D12) of type I natureofE.colistrains(genomedataanalysisof57E.colistrains
profilesandDcladeswithvariedHaeIIIpatterns(D11).D10 collatedfromGenbank).
gave rise to two nodes (with strains being type I groups),
Strain Type A B1 B2 D E Total Outof
withoneshowingB1phylogroups(D13)andtheotherbeing
Commensal I 10 5 — — — 15 21
predominant in E phylogroups followed by B1. An almost
Commensal III — — 2 — — 2 21
exemplarycorelationbetweentheclonalgroupsanddifferent
pathovarswasfoundwiththisstudy.Majorityofcommensal Commensal IV 4 — — — — 4 21
strains and EIEC and all EAEC and EPEC were shown to EPEC I — — — — 7 7 8
behavingtypeIprofile(Table4).AllUPEC,ExPEC,APEC, EPEC III — — 1 — — 1 8
EIEC,andsinglestrainofEPECandtwocommensalstrains EAEC I — 4 — 1 — 5 5
showed type III pattern. B form strains along with a single EHEC I — 2 — — — 2 3
strainofUPECandenvironmentalisolateexhibitedtypeIV EHEC II — 1 — — — 1 3
profiles.
ETEC I 1 1 1 — — 3 3
Similarly, a near-pristine association between phylo-
UPEC III — — 7 — — 7 8
groupsand Hae III profileswas established. Strainscoming
UPEC IV — — — 1 — 1 8
under phylogroups A were preponderant in type I whereas
EIEC III — — 3 — — 3 3
typeIVprofileswereexclusivelyforBforms.TypeIprofiles
wereobservedinthestrains(𝑛)intheorderofA>B1>E>D ExPEC III — — 2 2 — 4 4
withtypeIIIdominantinB2strains.PhylogroupDshowed APEC III — — 1 — 1 1
equal occurrence of type III and type IV fragmentation ENV IV — — — 1 1 1
patternfollowedbyasinglestrainwithtypeIprofile.These APEC:avianpathogenic;EAEC:enteroaggressive;EHEC:enterohemorrhag-
resultsassistedinenumeratingaconjecturewhichworksup ic;ETEC:enterotoxigenic;EIEC:enteroinvasive;EPEC:enteropathogenic;
ascenarioofprimordialmicrobialpopulationwhereE. coli ENV:environmental;ExPEC:extraintestinalpathogenic;UPEC:uropatho-
genic.
strains had two clonal types (Figure 5(a)) which coexisted
together(typeIandtypeIVclones).Ofthese,typeIstrains
would have been the predominant clone in comparison to
typeIVbasedonthedendogramdatawithmaximumgene site) or from type IV (by deletion of one recognition site)
poolofrootstrainsshowingtypeI.TypeIIImayhavebeen strains.Inadifferentscenariomaybeallthreetypescoexisted
the next predominant clone (an intermediary one) that has ortypeIIIwouldhavegivenrisetotypeIVwithanadditional
evolvedeitherfromtypeI(byadditionofanewrecognition mutational event. This situation may be hardly convincing
8 JournalofPathogens
BL21(DE3)_1∗
BLB21L-2G1(oDldE(3D)E_32)∗pLysSAG∗ A phylogroup
Bstr.REL606∗ ETEC H10407∗(B2)
UMNK88(A)
D(B114clades) StSrt.rS2.t02r1.0120-0930E49L9E-32L0-270150 B1phylogroup
55989
Str.EC4115
Str.TW14359
D10 Str.EDL933
D7 Str.Sakai E phylogroup
Xuzhou21
D13 Str.RMSt1r2.C59B89615
Str.11128
Str.11368B1phylogroup
Str.12009∗∗
NA114
SE15
D8 SLtFr.8N2∗R∗G∗857C∗∗∗
D1 UM146
UTI89
IHE3034
D5 (B2claDd1es2) S88APCElCo nOe1 D∗∗ i2 B2phylogroup
Clone D i14
ABU83972
CFT073
D9 536
ED1a
Str.E2348/69
(D clades) O42∗∗∗
D4 D11 UMN026IAI39 D phylogroup
Str.CE10
SMS-3-5
W∗∗∗
DD23 (DB16clades) SE1WK1O11FEL2∗4∗377AKO11FL B1phylogroup 10%2%
IAI1
ATCC8739 31%
P12b∗ 56%
HS
BW295K2-12substr.DH10B A phylogroup
DH1
DH1(ME8569)
K-12substr.W3110
K-12substr.MG1655
1%
Commensal ExPEC
ETEC APEC
EHEC EAEC
EPEC EIEC
UPEC ENV
Figure 4: Analysis of distribution of Hae III profiles, phylogroups, and pathovars within the global alignment dendogram construct
comprising57E.coligenomes.Thedendogramofthewholegenomesequenceof57genomeswasobtainedfromtheNCBIwebsitefor
E.coliandwasredrawnusingPhotoshopCS6forcolourcoordinationforpathogenicandnonpathogenicstrainsandinputtingtheclonal
groupsandphylogroups(http://www.ncbi.nlm.nih.gov/genome/?term=escherichia+coli).Amongthe57genomes,32wereoftypeI(56%),
18wereoftypeIII(31%),and6and1wereoftypeIV(10%)andtypeII(2%),respectively,showingthattypeIispredominantandtypeII
therarest.Tocorrelatebetweenthephylogroups,HaeIIIprofiles,andpathovars,thelineageswereconsideredascladesderivedfromvarious
divergencepoint(D)duringthecourseofevolution.
asdendogramsegregationshowstypeIIIstrainsevolvingor An intrinsic metagenomic and pangenomic analysis of
present after type IV strains. The clustering also shows that mostbacterialspeciesexhibitedmosaicismsoftheirinherent
predominance of type III is more than type IV and maybe blueprint[39].Insuchsituations,coregeneelementsshared
evolutionaryprocesses/mutationhavetriggeredtheincrease across the species are limited in comparison to dispensable
intypeIIIprofiles.OnsimilarlinetypeIIcloneswouldhave (flexible) genetic contents that concede uniqueness to a
been evolved from type I (addition) or type IV (deletion) particularstrain.Theseflexiblecontentshelpinnicheadapt-
butduetotheverylimitedtypeIIrestrictionprofilepatterns ability and give bacteria the ability to infect and invade. A
(rare) as observed from the gene pool data, the chances or majorconcerniswhilediagnosingbothtrueandopportunist
approximation of such event is difficult to prove. Based on pathogenic bacteria, the former causing disease in virtually
these results no new insights into phylogroup distribution any susceptible host and the latter invoking diseases in
across candidate strains can be provided; however with immunocompromised individuals. “Molecular barcoding,”
respect to the Hae III profile an additional angle can be anevolvedtermwhichimpliesthemethodofallelespecific
considered. Phylogroups A and B1 are predominant with amplificationofrelativelysmallDNAsequencesorbarcodes
type I Hae III profiles whereas B2 phylogroups exclusively [40] for spotting a particular species, is a thrust area for
representedtypeIIIprofile(Figure5(b)). microbialdiagnostics.Aplethoraoffunctionalgenesranging
JournalofPathogens 9
Hypothesis
Predominant
clones Restriction profiles
and
Type I Type IV clones
(28, 459) (28, 207, 249, and 459) Phylogroups and
clones
+ −
+
Type III
(28, 249, and 459) Primordial
2∘clones/intermediate
−
+
Type II
(28, 207, and 459)
Rarest
Nonpathogenic Pathogenic
A > B1 > B2 B2 > B1 > E > D
type I > IV > III type I (IAT)/III(P)
> type IV/II
(a) (b)
Figure5:(a)HypothesisofclonalityinE.colistrainsbasedon23Srrnrestrictionprofiling.TheprimordialsoupofE.colimicrobeswould
havebeencomprisedoftwoclonalgroups,typesIandIVcoexistingwitheachotherbutpredominatedbytypeIstrains.Overthecourse
ofevolutiononaccumulatingmutationasameansforvariation,typeIortypeIVwouldhavegivenrisetotypeIIIbyaddition(former)or
deletion(latter)ofrecognitionsequence.Thesecondscenariocouldbearareeventbecauseaccumulationoftwomutationsinaconserved
regionwouldbedifficult.TypeIIbeingtherarestwouldhavebeenevolvedinsimilarbasistotypeIII.(b)Hypothesisoflinkingphylogroups,
HaeIIIprofiles,andclonaltypesinE.coli.ThisdiagramillustratestheclonalgroupsofcommensalE.colistrainshavingbothAphylogroups
(dominant)andB1phylogroupseachbeingtypeIprofiles.PathogeniccounterpartsshoweddominancyintypeIIIrestrictionpatternfollowed
bytypeIpattern.Withrespecttophylogroups,pathovarswerepredominantinB2andB1followedbyDandEgroups.
fromhousekeepingtorepairareemployedforcharacterizing [45]makingthisfindingaboriginal.Thisbasicmethodology
bacteria of which rRNA is referred to as the gold stretch can be adapted for detection of other bacterial organisms
[41,42].Ribosomalsegmentsorganizedasoperonclustersof bytargetingSNP/slinkedtorecognitionsequences,thereby
16S,23S,and5SrDNAandtheseassemblagesaredistributed validatingrrnsequencesasmarkerfordiagnostics.Acumu-
fromsingletomultiplecopiesacrossthebacterialgenophore lativeapproachofdetectionofuniquerestrictionpatternofa
[43].Theoccurrenceofredundancyinmaintainingdifferent targetedgeneanditscross-referenceacrossbacterialfamilies
copiesofthesegenesisnotassociatedwithvirulencebutan cancircumventchangesoffalsepositives.
in-builtecologicalstrategythatcontributestotheparticular
bacterium with a competitive edge and better chance of
Disclosure
survival[44].Afuturisticapproachofcouplingthetechnique
and results with antibiotic resistance pattern, colony char-
Thisworkwaspresented(poster)inpartatthe5thInterna-
acteristics, and genomic profiles of bacterial strains of both
tionalBarcodingofLife,Kunming,China,2013.
commensal and pathogenic nature can help in monitoring
andmanaginginfectionsinabettermanner.
ConflictofInterests
4.Conclusion
The authors declare that there is no conflict of interests
regardingthepublicationofthispaper.
Thecausatumofpostgenomicera,genomicsandproteomics,
has enhanced this progress by improvising the techniques
used for diagnostics. The strategy of ARDRA utilized in Acknowledgments
this study was rapid and a cost-effective approach to dif-
ferentiate E. coli from its colony morphovars along with TheauthorsacknowledgeandexpresstheirgratitudetoPro-
giving a predicament of nature of origin or clonal groups. fessor D. A. Bhiwgade (Ex-Director) and Professor Debjani
The mutations reported in this work for detection and Dasgupta,Director,SchoolofBiotechnology&Bioinformat-
establishing clonality, namely, T874A (Bfa I), G2161A, and ics,D.Y.PatilUniversity,aswellasthemanagementfortheir
G2205A(HaeIII),havenotbeenmentionedinanyresearch supportandforprovidingtheinfrastructuretocarryoutthe
paper or within the Ribosomal RNA Mutation Database currentwork.
10 JournalofPathogens
References [16] P. Behzadip, E. Behzadi, H. Yazdanbod, R. Aghapour, A. M.
Cheshmeh,andS.D.Omran,“Asurveyonurinarytractinfec-
[1] M.RichterandR.Rossello-Mora,“Shiftingthegenomicgold tions associated with the three most common uropathogenic
standardfortheprokaryoticspeciesdefinition,”Proceedingsof bacteria,”Maedica(Buchar),vol.5,no.2,pp.111–115,2010.
theNationalAcademyofSciencesoftheUnitedStatesofAmerica,
[17] B.C.Metri,P.Jyothi,andB.V.Peerapur,“Antibioticresistancein
vol.106,no.45,pp.19126–19131,2009.
Citrobacterspp.isolatedfromurinarytractinfection,”Urology
[2] A. F. Auch, M. von Jan, H.-P. Klenk, and M. Go¨ker, “Digital
Annals,vol.5,no.4,pp.312–313,2013.
DNA-DNAhybridizationformicrobialspeciesdelineationby
meansofgenome-to-genomesequencecomparison,”Standards [18] N.Taneja,S.S.Chatterjee,M.Singh,S.Singh,andM.Sharma,
inGenomicSciences,vol.2,no.1,pp.117–134,2010. “Pediatricurinarytractinfectionsinatertiarycarecenterfrom
northIndia,”IndianJournalofMedicalResearch,vol.131,no.1,
[3] D.H.Martin,M.Nsuami,J.Schachteretal.,“Useofmultiple
pp.101–105,2010.
nucleic acid amplification tests to define the infected-patient
‘gold standard’ in clinical trials of new diagnostic tests for [19] J. B. Kaper, J. P. Nataro, and H. L. T. Mobley, “Pathogenic
Chlamydiatrachomatisinfections,”JournalofClinicalMicrobi- Escherichiacoli,”NatureReviewsMicrobiology,vol.2,no.2,pp.
ology,vol.42,no.10,pp.4749–4758,2004. 123–140,2004.
[4] E. A. Mothershed and A. M. Whitney, “Nucleic acid-based [20] E. J. de Muinck, K. Lagesen, J. E. Afset et al., “Comparisons
methods for the detection of bacterial pathogens: present of infant Escherichia coli isolates link genomic profiles with
and future considerations for the clinical laboratory,” Clinica adaptationtotheecologicalniche,”BMCGenomics,vol.14,no.
ChimicaActa,vol.363,no.1-2,pp.206–220,2006. 1,article81,2013.
[5] J.E.ClarridgeIII,“Impactof16SrRNAgenesequenceanalysis
[21] D. A. Rasko, M. J. Rosovitz, G. S. A. Myers et al., “The
for identification of bacteria on clinical microbiology and
pangenomestructureofEscherichiacoli:comparativegenomic
infectiousdiseases,”ClinicalMicrobiologyReviews,vol.17,no.
analysisofE.colicommensalandpathogenicisolates,”Journal
4,pp.840–862,2004.
ofBacteriology,vol.190,no.20,pp.6881–6893,2008.
[6] O. Mizrahi-Man, E. R. Davenport, and Y. Gilad, “Taxonomic
[22] C.T.Archer,J.F.Kim,H.Jeongetal.,“Thegenomesequence
classificationofbacterial16SrRNAgenesusingshortsequenc-
ofE. coliW(ATCC9637): comparative genome analysis and
ingreads:evaluationofeffectivestudydesigns,”PLoSONE,vol.
an improved genome-scale reconstruction of E. coli,” BMC
8,no.1,ArticleIDe53608,2013.
Genomics,vol.12,articleno.9,2011.
[7] D. E. Lebonah, A. Dileep, K. Chandrasekhar, S. Sreevani, B.
Sreedevi,andJ.PramodaKumari,“DNAbarcodingonbacteria: [23] P.Kuhnert,J.Nicolet,andJ.Frey,“Rapidandaccurateidentifica-
a review,” Advances in Biology, vol. 2014, Article ID 541787, 9 tionofEscherichiacoliK-12strains,”AppliedandEnvironmental
pages,2014. Microbiology,vol.61,no.11,pp.4135–4139,1995.
[8] J.RajendhranandP.Gunasekaran,“Microbialphylogenyand [24] A.P.Bauer,S.M.Dieckmann,W.Ludwig,andK.-H.Schleifer,
diversity:smallsubunitribosomalRNAsequenceanalysisand “Rapid identification of Escherichia coli safety and laboratory
beyond,” Microbiological Research, vol. 166, no. 2, pp. 99–110, strain lineages based on multiplex-PCR,” FEMS Microbiology
2011. Letters,vol.269,no.1,pp.36–40,2007.
[9] R.Srinivasan,U.Karaoz,M.Volegovaetal.,“Useof16SrRNA [25] B. J. Bachmann, “Pedigrees of some mutant strains of
gene for identification of a broad range of clinically relevant EscherichiacoliK-12,”BacteriologicalReviews,vol.36,no.4,pp.
bacterial pathogens,” PLoS ONE, vol. 10, no. 2, Article ID 525–557,1972.
e0117617,2015.
[26] P.Daegelen,F.W.Studier,R.E.Lenski,S.Cure,andJ.F.Kim,
[10] S.Chakravorty,D.Helb,M.Burday,N.Connell,andD.Alland,
“TracingancestorsandrelativesofEscherichiacoliB,andthe
“Adetailedanalysisof16SribosomalRNAgenesegmentsfor
derivation of B strains REL606 and BL21(DE3),” Journal of
thediagnosisofpathogenicbacteria,”JournalofMicrobiological
MolecularBiology,vol.394,no.4,pp.634–643,2009.
Methods,vol.69,no.2,pp.330–339,2007.
[27] F.W.Studier,P.Daegelen,R.E.Lenski,S.Maslov,andJ.F.Kim,
[11] C. R. Woese, “Review bacterial evolution,” Microbiological
“Understandingthedifferencesbetweengenomesequencesof
Reviews,vol.51,pp.221–271,1987.
EscherichiacoliBstrainsREL606andBL21(DE3)andcompar-
[12] M.Touchon,C.Hoede,O.Tenaillonetal.,“Organisedgenome
isonoftheE.coliBandK-12genomes,”JournalofMolecular
dynamicsintheEscherichiacolispeciesresultsinhighlydiverse
Biology,vol.394,no.4,pp.653–680,2009.
adaptivepaths,”PLoSGenetics,vol.5,no.1,ArticleIDe1000344,
2009. [28] R.K.SelanderandB.R.Levin,“Geneticdiversityandstructure
inEscherichiacolipopulations,”Science,vol.210,no.4469,pp.
[13] J. M. Janda and S. L. Abbott, “16S rRNA gene sequencing
545–547,1980.
forbacterialidentificationinthediagnosticlaboratory:pluses,
perils,andpitfalls,”JournalofClinicalMicrobiology,vol.45,no. [29] D. M. Gordon, O. Clermont, H. Tolley, and E. Denamur,
9,pp.2761–2764,2007. “Assigning Escherichia coli strains to phylogenetic groups:
[14] J.-J.Lu,C.-L.Perng,S.-Y.Lee,andC.-C.Wan,“UseofPCRwith multi-locus sequence typing versus the PCR triplex method,”
universalprimersandrestrictionendonucleasedigestionsfor Environmental Microbiology, vol. 10, no. 10, pp. 2484–2496,
detectionandidentificationofcommonbacterialpathogensin 2008.
cerebrospinalfluid,”JournalofClinicalMicrobiology,vol.38,no. [30] P. Desjardins, B. Picard, B. Kaltenbock, J. Elion, and E.
6,pp.2076–2080,2000. Denamur,“SexinEscherichiacolidoesnotdisrupttheclonal
[15] N.M.Guentzel,“Escherichia,Klebsiella,Enterobacter,Serratia, structureofthepopulation:evidencefromrandomamplified
Citrobacter,andProteus,”inMedicalMicrobiology,S.Baron,Ed., polymorphic DNA and restriction-fragment-length polymor-
chapter26,UniversityofTexasMedicalBranchatGalveston, phism,”JournalofMolecularEvolution,vol.41,no.4,pp.440–
Galveston,Tex,USA,1996. 448,1995.
Description:The logic behind this stratagem is .. data aggregated under phyla Actinobacteria, Bacteroidetes, . Lane 1: 100 bp ladder; Lane 2: blank; Lane 3:.