Table Of ContentZOOLOGICAL SCIENCE 10: 849-854 (1993) © 1993 Zoological SocietyofJapan
[RAPID COMMUNICATION]
RAPD analysis: An Efficient Method of DNA
Fingerprinting in Fishes
K. R. Dinesh1 T. M. Lim1 K. L. Chua2
, ,
W. K. Chan13 and V. P. E. Phang14
department of Zoology, 2Department of Biochemistry and
^Institute of Molecular and Cell Biology, National
University of Singapore, Kent Ridge, Singapore
0511, Republic of Singapore
ABSTRACT—Random Amplified Polymorphic DNA target DNA-sequence information for designing
(RAPD) generated using arbitrary primers of 9, 10, 16 specificprimers. Recently, Williams etal. [18] and
a(nPdCR2)0wnuacsleiontviedsetilgeantgetdhisnb1y2PsopleycimeesraosfefiCshheasi.nWReeafcotuinodn Wbaeslesdh amnedthMocdCletlelramnedd[R17a]nddeoscmribAemdplaifnioveedlPPoClyR-
tUhraetat-hSeDSam-pPliAfGiEcatainodn dpertoedcutcetds bwyerseilvbeerststariensionlgv.edThbey morphic DNA (RAPD) fingerprinting. This tech-
DNA
amplification products ranged from 25 to 75 depending nique allows detection of polymorphisms by
on the primer and template combination. The random randomly amplifying multiple regions of the
primersgeneratedunique fingerprintsforeachspeciesof genome by PCR using single arbitrary primers
fish in terms of number and position of RAPDs. Our DNA
designed independent of target sequence.
results showed that the fish species can be distinguished RAPD
from each other by RAPDs. The complexity of the Since the technique involves enzymatic
RAPDs in the fingerprints may be manipulated to suit amplification of target DNA by PCR using arbi-
the requirement of the study. The use of RAPD in trary primers it is also called Arbitrarily Primed
taxonomy, fishery management and fish culture is dis- Polymerase Chain Reaction (AP-PCR) or DNA
cussed.
Amplification Fingerprinting(DAF). Thismethod
overcomessometechnicallimitationsofthe earlier
INTRODUCTION
fingerprinting methods and has wide applications
The conventional DNA fingerprinting method, including: genetic fingerprinting of bacteria,
involving restriction fragment length polymorph- plants, fewanimal species andhumans [1-3, 6, 17,
ism (RFLP) assay, requires large quantities of 18]; creating linkage maps [16]; locating disease
relatively pure DNA, specific DNA probes and resistance genes [11, 12, 14]; and identifying
generally uses short-lived radio-isotopes in the chromosome-specific markers [15]. AP-PCR has
DNA
detection system. It is also laborious and time been used for the detection of polymorph-
consuming making it impractical for large popula- ismsoffewfish speciesincludingcolourmutantsof
tion based studies. Fingerprinting by polymerase tiger barb, Barbus tetrazona and guppy, Poecilia
chain reaction (PCR) technique requiresmuch less reticulata [4, 5]. Kubota et al. [10] used this
DNA but a major limitation is the requirement of method for the detection of radiation induced
DNA damages in Japanese medaka fish, Oryzias
Accepted July 5. 1993 latipes. Hence, RAPD fingerprinting technique is
Received April 23. 1993 robust, simple, fast, sensitive and particularly
4 To whom reprint request should be addressed. suited to problems where the genome is anony-
850 K. R. Dinesh, T. M. Lim et al.
mous or quantity of genomic DNA available is Oligonucleotide Primers: Random primers
limited. Itcanalsobeusedforanalysesofmuseum synthesized on ABI 394 DNA synthesizer and
specimensandrarefishesusingDNAisolatedfrom purified by an ABI oligonucleotide purification
scales and clipped fins without destroying the cartridge were purchased from the Bioprocessing
whole organism. Technology Unit, National University of Singa-
We used this technique for generating DNA pore. The 10 primers used were of 9-20 nuc-
fingerprints in 10 species of tropical and two leotides (9-to20-mer) in lengthwith G+Ccontent
species of temperate fishes representing seven ranging from 45.0-77.7%. The melting tempera-
families, viz., Belontidae (Betta splendens), Ana- ture (Tm) values ofthe primers ranged from 28°C
bantidae (Colisa Mia, Trichogaster microlepis), to 58°C. The details of the primers are given in
Cyprinidae (Cyprinus carpio, B. tetrazona, Table 1.
Brachydanio rerio), Poeciliidae (P. reticulata,
Xiphophorus maculatus) Cichlidae {Oreochromis DNA Amplification: Samples were amplified
,
niloticus), Characidae {Hyphessobrycon innesi) in 50pi reaction mixtures containing IX PCR
mM M
and Salmonidae (Onchorhynchus nerka, Salmo buffer (Promega), 15 MgCl2, 1.0 primer,
salar). We report here the usefulness of this 0.3 to 0.5pg of genomic DNA, 2mM of each
method in combination with Urea-SDS-PAGE in dNTP (Promega) and 2.0units of Taq DNA
generating RAPDs among the fishes. polymerase (Promega). Thetotalreactionmixwas
overlaid with 40/^1 of mineral oil (Sigma). Am-
MATERIALS AND METHODS plificationwasperformed in a Perkin-Elmer Cetus
GeneAmp PCR System 9600 programmed for 30
Extraction of genomic DNA Tissues from cycles of 3min denaturation at 94°C, 3min low
:
individual fishes were pulverized after flash freez- stringency annealing at 37°C and 2min primer
ingin liquid nitrogen, incubated with mildshaking extension at72°C. At the end a final extension for
at 55°C in 10volumes ofextraction buffer (50mM 10min was performed at 72°C.
Tris-Cl, pH8.0; 100mM EDTA, pH8.0; 100mM
NaCl; 100mM DTT; 1.0% SDS; 0.5 mg/ml pro- Denaturing polyacrylamide gel electrophore-
teinase K). After phenol extraction and ethanol sis: Amplified fragments were separated by
precipitation, DNA was dried using Speed Vac SDS-PAGE (3% stackingand8% resolvinggel)in
concentrator (Savant), resuspended in TE buffer a Mini-Protean II (Bio-Rad; Fig. 2) or Urea
(10mM Tris-Cl, pH8.0; 1 mM EDTA, pH8.0) SDS-PAGE (3% stacking and 8% resolving gel
M
and stored at 4°C. containing 7 urea) in Sturdier SE 400 (Hoefer)
Electrophoresis unit. Eight to tenp\ ofeach PCR
Table 1. Details of Arbitrary Primers
Name Nucleotide length Sequence (5'-3') (G+C)% Tm(°C)
NUSZG1 9-mer TTGCGTCCA 55.5 28
NUSZG2 9-mer GCACTGTCT 55.5 28
NUSZG3 9-mer GGTAACGCC 66.6 30
NUSZG4 9-mer GGAGCTGGC 77.7 32
NUSZG5 10-mer AGGTCACTGA 50.0 30
NUSZG6 10-mer CGGTCACTGT 60.0 32
NUSZG7 10-mer AATCGGGTCG 60.0 32
NUSZG8 10-mer TGCCGAGCTG 70.0 34
NUSZG9 16-mer TGCCTGTGGGGAATCC 62.5 52
NUSZG10 20-mer TATGTAAAACGACGGCCAGT 45.0 58
RAPD Fingerprinting in Fishes 851
RAPD
product was loaded onto polyacrylamide slab gels the patterns obtained using similar elec-
of0.75 mm(7x8cm; Mini-ProteanII)or 1.00mm trophoretic conditions, gel size and detection
(14X18cm; Sturdier SE 400) thickness. The system should be used.
electrode buffer (pH 8.3) contained 0.025 M Tris- The RAPD profiles were found to be similar in
Cl. 0.2 M glycine and 0.1% SDS. The samples terms of mobility and intensity of the bands for
were loaded together with a PCR dense dye different individuals ofthe same species as seen in
containing 50mM EDTA, 30% glycerol, 0.25% our example ofthe guppy, indicating specificity of
DNA
xylene cyanol FF and 0.25% bromophenol blue. the patterns for a given species (Fig. 1).
Electrophoresis was carried at 100V for 3K hr in Among the 10 guppies (5 male and 5 female
Mini-Protean or 16hr in Sturdier gel unit. full-sibs obtained from a single-pair mating)
tested, theyshared many monomorphic (constant)
Silverstaining Silver staining method of Her- bands with few polymorphic (variable) bands
:
ring etal. [8] was used with slight modifications to accounting for individual differences (Fig. 1).
stain the gels. The gels were fixed with 10% Hence, these fingerprints indicated low genetic
ethanol-0.5% acetic acid for 1 hr and then soaked variabilitywhichcouldbeduetoinbreeding, asthe
M
in 0.011 silver nitrate for 30min. After rinsing parents ofthe individuals testedwere from a small
the gels twice briefly in distilled water, the reduc- random breeding stock of about 50 in number
tion reaction was carried out for a maximum of 10 maintained for several years in our laboratory.
M
min with a solution of 0.75 sodium hydroxide The presence of simple repetitive male specific
M DNA
and 0.085 formaldehyde till the bands were revealed by oligonucleotide fingerprinting
clearly visible. The reaction was stopped by has been reported in the guppy, a species with
transferring the gels to 0.07 M sodium carbonate XX/XY sex determining mechanism [13]. We did
for 30min. Prior to drying, the gels were photo- not find any sex specific RAPD markers for male
graphedwithtransmittedlightusingaNikonF-501 or female guppies using the 16-mer RAPD primer
mm
camerafittedwitha55 f2.8Micro-Nikkorlens
and Kodak TMAX 100 black and white film.
Bio-Rad gel dryer 583 was used to dry the gels - 6 7 8 9 10
afterbrieflysoakingin asolutionof30% methanol
and 5% glycerol.
RESULTS AND DISCUSSION
RandomAmplifiedPolymorphicDNA (RAPD)
in 12 species of fishes was investigated. Both the
short (9 and 10 nucleotide) andmedium length (16 i 1
and 20 nucleotide) primers generated discrete
DNA
amplified fragments of varying lengths and
revealed RAPD variation among the species. We
found that addition of 7 M urea to the 8% 9_^
resolving gels in SDS-PAGE improved the am-
plifiedfragment separationconsiderably. General-
ly the fragments of range 100 to 3500 bp could be
adequately resolved by Urea-SDS-PAGE. The Fig. 1. RAPD fingerprints generated by 16-mer
spectrum of amplified products was reproducible (NUSZG9)in5male(lanes1-5)and5female(lanes
fora particulartemplate-primercombination. The 6-10) i—ndividuals of the guppy, Poecilia reticulata.
technique of DNA amplified fragment separation LDaNnAe.' Fr'aigsmoefnntesgiazteisve(brpe)aocftiloanmsbwdiathDoNuAt-tBesmptlEatIeI
and detection system play important roles in digest molecular weight standard: a) 3675, b) 2323,
RAPD
analysis. For the purpose of comparison c) 1929, d) 1371, e) 1264, f) 702, g) 224, h) 117.
852 K. R. Dinesh, T. M. Lim et al.
5-
M1 234 567 8910
2 3 4
-"|
a
Fig. 2. DNA profiles from a single tiger barb, Barbus
tetrazonaobtainedbyusingfourprimersofdifferent
DNA
nucleotide sequences and lengths. amplifica- Fig. 3. Amplification fingerprints in 10 species of tro-
tionproductsby: 9-mer, NUSZG4(lane2); 10-mer, pical fishes generated by a 9-mer, NUSZG3. Lane
NUSZG8 (lane 3); 16-mer, NUSZG9 (lane 4); and M: Molecular weight marker is lambda DNA-BstE
20-mer, NUSZG10(lane5). Thefirstandlastlanes II digest. Lane 1: Betta splendens; Lane 2: Colisa
are of lambda DNA-BstE II digest and negative lalia; Lane3: Trichogastermicrolepis;Lane4: Cyp-
reactions without template, respectively. RAPD rinus carpio; Lane 5: Barbus tetrazona; Lane 6:
bands resolved by SDS-PAGE in Mini-Protean II Brachydaniorerio;Lane7: Poeciliareticulata;Lane
(BIO-RAD). 8: Xiphophorus maculatus; Lane 9: Oreochromis
niloticus Lane 10: Hyphessobrycon innesi. Arrows
indicate R; APD variable bands among the different
(NUSZG9) (Fig. 1). species.
Figure2 showed that four primers of different
sequences and lengths generated different profiles length ofthe primers and the numberofamplified
DNA
in a single individual tiger barb. Also, the fragments generated. The number of amplified
profiles of 10 individual fishes representing 10 products may be related to the G+C content of
species (lanes 1-10) in Fig. 3 (9-mer, NUSZG3), primerandtemplate DNAsequenceratherthanto
Fig. 4 (10-mer, NUSZG5) and Fig. 5 (20-mer, theprimerlength [1]. G+Ccontentoftheprimers
NUSZG10) show clearly that different patterns of usedinourstudyrangedfrom45.0-77.7%. Figure
amplified products are generated by different 2shows some evidence thatprimers ofhigher G+
primers. We have found that the primers ofsame C content generate more amplified products.
length but with different sequences generated The 9-mer (NUSZG3) generated a total of
different DNA patterns in a single fish [4, 5]. about 40 clearly noticeable RAPD variable bands
These results showed that this technique can be among the 10 species of tropical freshwater fishes
manipulated bychanging the primersequence and (Fig. 3), while the 10-mer (NUSZG5) (Fig. 4),
length to generate amplification products of de- 16-mer (NUSZG9) and 20-mer (NUSZG10) (Fig.
sired complexity to suit different purposes like 5) generated 31, 20 and 28 RAPD variable bands,
genetic mapping or genotyping [1]. Depending on respectively, among the 12 species offishes which
the particular primer and template combination, included two cold water species. The fingerprints
the numberofRAPD ranged from25 to 75. Each generated by the four different primers revealed
primer detected an average of 30 RAPD variable uniqueprofilesforeachspeciesintermsofnumber
bands among the 12 species of fishes studied. and position of RAPD bands. Thus, the RAPD
However, there was no clear relation between the generated for each species can be efficiently used
RAPD Fingerprinting in Fishes 853
M12345678
910111213
a_
b-S)
d__
e
.
M
f
—
iJttb— Urn
fc
Fig.4. DNAfingerprintsgeneratedbyadecamerprimer, NUSZG5in 12speciesoffishes. LanesMand 1 to 10are
as in Fig. 3. Lane 11: Onchorhynchus nerka; Lane 12: Salmo salar and Lane 13: control reactions without
template DNA.
789
M1 23 45
6 10 11 12
m
—
f_
Fig.5. Fingerprintsgeneratedbythe20-mer(NUSZG10)in 12speciesoffishes. LanesMand 1-12areasinFig. 4.
as supporting markers for taxonomic identifica- and systematics, species-specific RAPD markers
tion. Further confirmation can be achieved by could be an invaluable tool for species verification
consideringthe RAPD markersgeneratedbymore and in establishing the status of organisms of
than one primerforthe same species. Intaxonomy controversial systematics. RAPDs that are di-
854 K. R. Dinesh, T. M. Lim et al.
agnostic at different taxonomic levels can be CarlsonJE,TulsieramLK, GlaubitzJC,LukVWK,
generatedbyemployingdifferentprimersandthey KauffeldtC, Rutledge R (1991) TheorAppl Genet
83: 194-200
can be used to determine the relatedness between
taxa for which diagnostic RAPD fingerprints have PCohwaellmlerWs (K1J9,92W)auHegrhedRit,yS6p9r:e4nt65J-I4,72Simsons AL,
been established [7]. However, for RAPD finger- Dinesh KR, Chua KL, Phang VPE, Lim TM, Tan
printing to provide supporting evidence for tax- TW (1992) In "Proc. International Workshop on
onomic relationships in fishes, data should be Genetics in Aquaculture and Fisheries Manage-
generated using adequate sample size for each ment" Ed by D Penman, N Roongratri, B McAn-
species. RAPD markers can play an important drew, Stirling, U.K. pp125-127
Dinesh KR, Phang VPE, Lim TM, Chua KL, Tan
role in fishery management and conservation TW In "Proc. 3rd Asian Fisheries Forum", Asian
genetics such as studying the genetic effects of Fish Soc, 26-30 Oct 1992. Singapore (in press)
mixing cultured fish with wild populations. Such EchtCS,ErdahlLA,McCoyTJ(1992) Genome35:
DNA markers could also be used to assess the 84-87
impact of intentional or accidental release of HadrysH,BalickM,SchierwaterB(1992) MolEcol
farmed fishes to the wild [9]. From the point of 1: 55-63
view offish culture, RAPD methodology has been HMeernrgiinegsAJJD,(I1n9g8l2is)NJFC,liOnjeMhi,croCbKi,olSn16o:dg4r7a3s-s47D7R,
shown to be useful in preliminary pedigree analy- Hindar K (1992) In "Conservation of Biodiversity
ses [5] and in the detection of phenotypic-specific for sustainable development" Ed by OT Sandlund,
DNA polymorphic markers in different colour K Hindar, AHD Brown, Scandinavian Univ Press,
mutants of two freshwater aquarium fishes [4, 5]. Norway, pp168-184
Our results show that RAPD can be used to 10 KubotaY, Shimada A, ShimaA (1992) Mutat Res
283: 263-270
generate useful fingerprints characteristic of fish
11 Martin GB, Williams JGK, Tanksley SD (1991)
species and for genotyping individuals within the Proc Natl Acad Sci USA, 88: 2336-2340
species. Thus, itprovides anefficient and sensitive 12 Michelmore RW, Paran I, Kesseli RV (1992) Proc
method which can be used to estimate genetic Natl Acad Sci USA, 88: 9828-9832
variability, relatedness, inbreeding levels, species/ 13 Nanda I, Feichtinger W, Schmid M, Schroder JH,
strain verification, pedigree analyses, detection of Zischler H, Epplen JT (1990) J Mol Evol 30:456-
462
economic traits and in other marker-based studies
14 Paran I, Kesseli R, Michelmore R (1991) Genome
in fishes.
34: 1021-1027
15 Quiros CF, Hu J, This P, Chevre AM, Delseny M
ACKNOWLEDGMENTS (1991) TheorAppl Genet, 82: 627-632
16 Rafalski JA, Tingey SV, Williams JGK (1991)
We thank Mr. H. K. Yip for developing and printing Agbiotech News Inf3: 645-648
the gel photographs. Support for this study came from 17 Welsh J, McClelland M (1990) NuclAcids Res 18:
National University ofSingapore. 7213-7218
18 WilliamsJGK,KubelikAR,LivakKJ, RafalskiJA,
Tingey SV (1990) Nucl Acids Res 18:6531-6535
REFERENCES
1 Caetano-Anolles G, Bassam BJ, Gresshoff PM
(1991) Bio/technology 9: 553-557