Table Of Content1
Oligonucleotide PRINS DNA Synthesis
John R. Gosden and Diane Lawson
1. Introduction
The technique for labeling chromosomes by annealing an oligonucleotide DNA
primer to the denatured DNA of chromosome preparations on glass slides and
extending it enzymatically in situ with the incorporation of labeled nucleotides
was fust described by Koch et al. in 1989 (I). Since then, the technique has been
greatly improved in reliability, sensitivity, and resolution, and now provides a
viable, rapid alternative to conventional fluorescence in situ hybridization
(FISH) for many investigations, particularly the identification of chromosome
aneuploidy in metastatic tissues and antenatal diagnosis and the analysis of the
human chromosome complement of somatic hybrid cell lines (Zd).
2. Materials
2.1. Primed In Situ Syf7thesis
1. Twin-Frost glass slides and 22 x 40 mm coverslips: The slides must be cleaned
by soaking in ethanol to which a few drops of HCl have been added, followed by
polishing with a clean piece of muslin, before the cells are deposited on the slide.
Coverslips must be cleanedi n the samew ay before use.
2. PRINS buffer (10): 500 mM KCl, 100 mil4 Tris-HCl, pH 8.3, 15 mA4M gC12,
0.1% BSA.
3. 2’-Deoxyadenosine 5’-triphosphate (dATP): 100-W solution (Pharmacia
Biotech, St. Albans, UK), diluted 1:1 0 with sterile distilled HzO.
4. 2’-Deoxycytidine 5’-triphosphate( dCTP): 10 0-mM solution (PharmaciaB iotech)
diluted 1: 10 with sterile distilled H20.
5. 2’-Deoxyguanosine S-triphosphate (dGTP): 100~mM solution (Pharmacia
Biotech) diluted 1: 10 with sterile distilled H20.
6. 2’-Deoxythymidine5 ’-triphosphate(d TTP): lOO-mJ4s olution( PharmaciaB iotech)
diluted 1: 100 with sterile distilled H,O.
From. Methods fn Molecular Biology, Vol 71 PRINS and In Situ PCR Protocols
Ed&d by. J. R Gosden Humana Press Inc., Totowa, NJ
2 Gosden and Lawson
7. Biotin-16-2’-deoxyuridine-5’-triphosphate (Bio- 16-dUTP) (Boehrmger Mannheim,
Lewes, Sussex, UK).
8. Digoxigenin-1 I-deoxyuridine-5’-triphosphate (Dig-l l-dUTP) (Boehrmger
Mannherm).
9. FluoroRed (Amersham International, plc, Buckinghamshire, England).
10. FluoroGreen (Amersham International).
11. FluoroBlue (Amersham International).
12. Ohgonucleotide primer(s) at 250 ng/pL (see Note 1)
13 Tuq DNA polymerase (Taq [Boehrmger], AmpliTaq [Cetus], or ThermoprimePrus
[Advanced Biotechnologies Ltd., Leatherhead, England]).
14 Rubber cement (vulcanizing solutron) (e.g., Tip-Top, Stahlgruber, DS-8011
Poing, Germany) (see Note 2).
15. Stop buffer (500 mM NaCl, 50 n1J4 EDTA).
16. Flat-bed thermal cycler (see Note 3).
17. Water bath at 65°C
2.2. Detection
1 Dried skimmed milk powder.
2. Avrdin-DCS-fluorescein isothiocyanate (Av-FITC) (Vector Labs, Burlin-
game, CA).
3. Avidin-DCS-Texas red (Av-TR) (Vector Labs).
4. Antrdigoxigenin-fluorescem (anti-DIG-FITC) (Boehrmger Mannhelm).
5. Antrdigoxigenm-rhodamine (anti-DIG-rhodamine) (Boehrmger Mannheim).
6. Propidium iodide (20 pg/mL) (Sigma).
7. 4’,6-Dtamidino-2-phenylmdole 2 HCl (DAPI) (100 pg/mL) (Sigma).
8. VectaShreld (Vector Labs).
9. 20X SSC: 3.OMNaC1, 0.3OMtn-sodmm citrate, pH 7.3.
10. Wash buffer: 4X SSC (diluted from stock 20X SSC), 0.05% Tnton X-100.
11. Blocking buffer: wash buffer with the addition of 5% skimmed mrlk powder.
12. Incubator or water bath at 37’C and water bath at 45°C.
13. Microscope equipped for eprfluorescence (e g., Zeiss Axioskop or Leitz Ortholux
II with Pleomopak filter system)
3. Methods
3.1. Standard PRINS
1. You will need cells or chromosomes, prepared from peripheral blood lym-
phocytes (71, cultured cells (8), or frozen sections (see Speel et al., Chapter 8)
(see Note 5).
2. Oligonucleotide primers are prepared on an Applied Biosystems (Foster City,
CA) Model 38 1A DNA synthesizer according to the manufacturer’s instructions.
Recommendations for some successful chromosome-specific primers are given
in Table 1 (but see Note 4).
3. The reaction mix is made up as follows: For each slide, put 1 pL of each of the
diluted nucleotide triphosphates, plus 1 @L of the selected labeled dUTP (biotin,
PRINS 3
Table 1
Examples of Chromosome-Specific
Oligonucleotides and a Primer for All Human Centromeres
F673 (20-mer) D16Z1, Satellite II TTCTTTTCATACCGCATTCT
F60 (30mer) D 172 1, alphoid ATTGCACTTCTTTGAGGAGTACCG
TAGTAA
G33 (19-mer) D9Z 1, Satellite III AATCAACCCGAGTGCAATC
168 (17-mer) CenP-B Box CTTCGTTGGAAACGGGA
digoxigenin, or a fluorochrome), 5 pL 10X PRINS buffer, and 1 pL of the appro-
priate oligonucleotide pruner (see Note 6) mto a microcentrifuge tube, and add
distilled water to 50 PI.,,
4. Mix thoroughly and add 1 U of your chosen DNA polymerase. Mix carefully and
place 40 $ on a clean coverslip.
5. Pick the coverslip up with a slide (this spreads the reaction mix evenly, with the
least risk of introducing air bubbles) and seal with rubber cement
6. Dry the seal (a cold air fan is quick and safe) and transfer the slides to the flat
block of a thermal cycler. A suitable basic program for the Hybaid OmniGeneTM
In Situ, or Hybaid OmniSlideTM is 93”C, 3 min; 60°C 5-10 min; 72”C, 15 min.
7. On completion of the program, remove the seal (it peels off easily by rubbing one
comer) and transfer the slides for 1 min to a Coplin jar containing stop buffer at
65°C. Leave the coverslips in place, unless they come off readily with the seal;
they will in any case fall off in the stop buffer. After 1 min, transfer the slides to
a stain dish containing wash buffer. They may be held in this solution overnight
if convenient (but see Note 7)
3.2. Detection
It is important that the slides do not become dry at any time during this
process. The following steps apply only to slides in which the PRINS reaction
has been labeled with biotin or digoxigenin. Slides in which the reaction used a
fluorochrome-dUTP as the label require no detection step, and are simply
mounted (see step 6).
1. Prepare blocking buffer. The milk powder dissolves rapidly if the solution is
warmed to 45“C for a few seconds.
2. Put 40 pL blockmg buffer on a clean coverslip, shake surplus wash buffer from
the slide, and pick up the coverslip containing blocking buffer. Leave (unsealed)
at room temperature for 5 min.
3. Dissolve reporter (avidin-fluorochrome or antidigoxigenin-fluorochrome) in block-
ing buffer. For Av-FITC or Av-TR, 1:500 is a suitable dilution; anti-DIG FITC
and anti-DIG rhodamine are better at 1: 100 dilution. Make sufficient buffer for a
40 &/slide. Spin in a microcentrifuge for 5 min. This precipitates any aggregates that
may have formed during storage and can cause high and nonspecific background.
4 Go&en and Lawson
4. Remove the cover&p from the slide, shake surplus fluid off both the sltde and
the coverslip, and add 40 pL of reporter solution to the same coverslip. Replace
the slide and incubate in a moist chamber (e g., a sandwich box lmed with damp
filter paper) at 37°C for 30 mm.
5. Warm a reagent bottle containing wash buffer to 45OC in a water bath. Remove
covershps and wash slides 3 x 2 min in 50 mL wash buffer at 45°C.
6. After the final wash, shake off surplus fluid and mount slides in VectaShleld
containing the appropriate counterstain: For slides labeled with rhodamine or
Texas red, this should be DAPI (5 pg/lOO pL VectaShield, i e., 5 pL of DAPI
stock/l00 pL VectaShleld); for slides labeled with FITC, this should be a
propidium iodide/DAPI mixture (3.75 & of each stock/l00 pL VectaShield).
Use 20-30 pL mountant/slide, blot surplus by covering slide and covershp with a
tissue and pressing gently to expel excess mountant, and seal with rubber cement.
Slides may be stored m the dark at 4°C for several months. If the stain shows
signs of fading, simply peel off the sealant, soak the slide overnight in 4X SSC,
0.05% Triton X-100 (the covershp will fall off at this point), and remount as above
Figure 1 shows some typlcal results.
7. Multiple sequential PRINS reactions may be performed on the same sample in
order to quantify a number of chromosomes. For details of the method, see Chap-
ter 6 and ref. 6
8. The technique may also be combined with FISH. After the stop buffer, the shdes
are passed through an ethanol series (70, 90, 100%) and air-dried before per-
forming a normal FISH procedure, omitting any denaturation of the chromo-
somal DNA. Detection of the PRINS product and the hybridized FISH probe is
then performed simultaneously (9) This provides a rapid method for identifying
the chromosomal target located by the FISH.
4. Notes
1. Oligonucleotide pnmers can be synthesized on an ABI DNA synthesizer and
used without further purification other than alcohol preclpltatlon and washing. If
this facility is not available, they may be obtained from commercial sources,
but purification steps, such as HPLC, are not needed and only increase the
cost of the product.
2. The requirement for a suitable seal is that it should be reasonably robust, provide
a vapor-tight seal, and be easily and completely removed at the end of the proce-
dure. We have found that Tip-Top fulfills all these parameters and is readily
available from bicycle repair shops.
3. Thermal cyclers with a flat bed for microscope slides are not yet widely avall-
able. Some of the products sold for this purpose are not altogether suitable, since
they are ad hoc modifications of machines designed for PCR in microtubes, with a
plate added to the heated block. Thermal transfer and temperature control m such a
system are rarely satisfactory The procedure can be carried out by transferrmg
slides through a series of water baths at appropriate temperatures, but this too means
that temperature control cannot be precise, and the temperature drop during the
PRINS
Fig. 1. (see color plate number 1 after p. 82) Examples of PRINS reactions with the
primers shown in Table 1. All reactions were labeled with biotin-16-dUTP, and the
label detected with avidin-FITC. Chromosomes were counterstained with a mixture of
DAPI and propidium iodide. (A) Chromosome 16. (B) Chromosome 9. (C) Chromo-
some 17. (D) CenP-B box primer (labels all centromeres).
transfer from water bath to water bath leads to high backgrounds. The most suitable
purpose-built products are the OmniGene In Situ and OmniSlide made by Hybaid
(Teddington, Middlesex, UK), which hold 4 and 20 slides, respectively.
4. As an alternative, complete systems for chromosome identification by PRINS are
becoming available (e.g., Advanced Biotechnologies, Leatherhead, England).
5. Cell suspensions may be stored in fix (methanol:acetic acid [3: 11) at -20°C for
several months. Slides are prepared fresh each week by gently centrifuging the
suspension to precipitate the cells, resuspending in fresh fix, repeating this pro-
cess, and finally resuspending in sufficient fix to give a suitable density and put-
ting one drop on a clean slide, which is allowed to dry at room temperature. The
balance of the suspension may then be diluted suitably with fix and returned
to -2O’C. Using slides more than l-2 wk old can be successful, but may lead to
reduced sensitivity and greater variability.
6. The majority of chromosome-specific alphoid sequences produce adequate sig-
nal with a single primer at a concentration of 250 ng/50 l.tL reaction. In some
Go&en and Lawson
cases, a clearer signal with less background may be produced with paired pnm-
ers, at the same concentration, whereas in others, the concentration of primer
may be reduced, with a concomitant reduction in crossreaction to related chro-
mosomal sequences.
7. Slides that have been labeled directly with fluorochromes may still be held m this
solution overnight if convenient, but should be kept in the dark to prevent bleach-
ing and fading of the label.
References
1. Koch, J E., Kolvraa, S., Petersen, K. B., Gregersen, N., and Bolund, I (1989)
Oligonucleotide-priming methods for the chromosome-specific labelling of alpha
satellite DNA in situ. Chromosoma 98,259-265
2. Gosden, J., Hanratty, D., Starling, J., Fantes, J , Mitchell, A., and Porteous, D.
(199 1) Oligonucleotide primed in situ DNA synthesis (PRINS): a method for chro-
mosome mapping, banding and investigation of sequence organization. Cytogenet
CeEZG enet. 57, 100-l 04.
3. Gosden, J. and Lawson, D. (1994) Rapid chromosome identification by ohgo-
nucleotide primed in situ DNA synthesis (PRINS). Hum. A401 Genet. 3,93 l-946.
4 Gosden, J and Lawson, D. (1995) Instant PRINS: a rapid method for chromo-
some identification by detecting repeated sequences in situ. Cytogenet Cell Genet.
68,57-60.
5. Hindkjaer, J., Koch, J., Terkelsen, C., Brandt, C. A., Kolvraa, S., and Bolund, L.
(1994) Fast, sensitive multicolour detection of nucleic acids by primed in situ
labelling (PRINS). Cytogenet. Cell Genet. 66, 152-l 54.
6. Speel, E. J. M., Lawson, D., Hopman, A. H. N., and Gosden, J. (1995) Multi-
PRINS: multiple sequential oligonucleotide primed in situ DNA synthesis reac-
tions label specific chromosomes and produce bands. Hum. Genet. 95,29-33.
7. Spowart, G. (1994) Mitotic metaphase chromosome preparation from peripheral
blood for high resolution, in Methods in Molecular Biology, vol 29. Chromosome
Analyszs Protocols (Gosden, J. R., ed.), Humana, Totowa, NJ, pp. l-10.
8. Fletcher, J. (1994) Immortalized cells lines: chromosome preparation and bmd-
ing, in Methods in Molecular Bzology, vol. 29: Chromosome Analyszs Protocols
(Gosden, J. R., ed.), Humana, Totowa, NJ, pp. 51-57.
9. Warburton, P. E., Haaf, T., Gosden, J., Lawson, D , and Willard, H. F. (1996)
Characterization of a chromosome-specific chimpanzee alpha satellite subset:
evolutionary relationship to subsets on human chromosomes. Genomlcs 33,220-228
Chromosome-Specific PRINS
Jean-Paul Charlieu and Franck Pellestor
1. Introduction
The identification of mdlvidual chromosomes IS of great Importance in
cytogenetics, in order to detect aneuploidies or chromosomal rearrangements
associated with genetic diseases. This can be achieved by several techniques
based either on the intrinsic staining properties of the chromosomes in produc-
ing bands (the banding pattern being specific for each pair of chromosomes)
(1) or the use of a DNA probe to detect specifically a region of the chromo-
some by fluorescence in sztu hybridization (FISH) (2). The use of centromeric
a satellite sequences as FISH probes is very popular because of the specificity
of these sequences. cz Satellite (or alphoid) DNA 1s a family of tandemly
repeated sequences present at the centromere of all human chromosomes (3).
Subfamilies, some of them specific for one or a small group of chromosomes,
can be identified within alphoid DNA both by the periodic distribution of
restriction sites and the nucleotide sequence of the 171-bp basic motif (4).
These chromosome-specific subfamilies can therefore be used as FISH probes.
This approach is limited, however, since the DNA sequences of some subfami-
lies are very close to each other, and crosshybridization can occur between the
centromeric sequences of several pairs of chromosomes. This is the case with
chromosomes 13 and 2 1, for example, which share 99.7% homology in their
alphoid sequences (5,. The development of the primed in situ (PRINS) tech-
nique of labeling DNA (68) introduced a solution to this problem. The PRINS
procedure consists of the use of a small oligonucleotide (usually 18-22 nucle-
otides) from the sequence of interest as a primer. The primer is annealed to the
denatured DNA of a chromosome or cell preparation. An in situ DNA synthe-
sis reaction is performed with the incorporation of a labeled precursor (biotin-
dUTP or digoxygenin-dUTP), using a thermostable DNA polymerase. A single
From Methods m Molecular B/otogy, Vol 71 PRlNS and In S~tu PCR Protocols
Edlted by. J R Gosden Humana Press Inc., Totowa, NJ
7
8 Charlieu and Pellestor
base mismatch between the target and the probe will produce a less stable
hybrid when using a primer than for a long FISH probe. In addition, if the
mismatching nucleotide is located at the 3’-end of the PRINS primer, it will
prevent any elongation by the DNA polymerase.
We have developed several chromosome-specific a-satellite primers for
PRINS, each of them carrying at least a chromosome-specific nucleotide at its
3’-end, and we describe in this chapter the use of two of them for the detection
of human chromosomes 13 and 21. Other primers are available in the literature
(9,ZO) or on request, but we are presenting only the conditions of use for the
two most difficult, differing only at one position.
2. Material
2.1. Slides
1. Chromosome spreads are prepared from peripheral blood usmg standard meth-
ods (fixation in methanol:acetic acrd 3: 1).
2. 20X SSC: 3M NaCl, 0.3M Nas-citrate (can be stored for several months at
room temperature).
3. 70,90, and 100% ethanol.
4. Formamrde (Prolabo, Paris, France): Formamide must be deionized by mixing
with Amberlite resm (Sigma, St. Louis, MO), allowing to stand for at least 1 h,
and then filtering. Deionized formamide is stored at +4”C.
2.2. PRIM Reaction
1. Primers: Synthetic oligonucleotides are used as primers m the PRINS experi-
ments. Their nucleotide sequences are as follows (11):
13A (chromosome 13): 5’-TGATGTGTGTACCCAGCT-3’
21A (chromosome 21): 5’-TGATGTGTGTACCCAGCC-3’
Precipitate the primers by adding 10 vol of 1-butanol, vortex, and centrifuge for
1 mm at maximum speed in a bench-top microfuge. Dry the pellets under vacuum,
and resuspend in 5 miV Tris-HCl, pH 8.0, to obtain a 50 @4 (50 pmol/pL) solu-
tion. Store small aliquots (50 pL) at -2OT (see Notes 1 and 2).
2. 2’-Deoxyadenosine 5’-triphosphate (dATP) (Boehringer Mannheim, Meylan,
France): Resuspendi n Hz0 to obtain a 100-M stocks olution (store at -2O’C).
3. 2’-Deoxycytosine 5’-triphosphate (dCTP) (Boehringer Mannheim): Resuspend to
obtain a 100~mMs tock solution (-2O’C).
4. 2’-Deoxyguanosine 5’-triphosphate (dGTP) (Boehringer Mannheim): Resuspend
to obtain a 100~mMs tocks olution (-2OT).
5. 2’-Deoxythymidine 5’-triphosphate (dTTP) (Boehringer Mannheim): Resuspend
to obtain a 100-n&f stock solution (-20°C).
6. Biotin-l&dUTP, 1 mM (Boehringer Mannheim) (-2O’C).
7. Glycerol 87% (Prolabo).
8. Tuq DNA polymerase (Boehringer Mannhetm). Store at -2O’C
9. 10X Taq buffer (provided with the enzyme) (-2O’C).
Chromosome-Specific PRIM 9
10. Stop buffer: 500 n&f NaCl, 50 mM EDTA, pH 8.0 (can be stored at room tem-
perature for several months).
11. Sterile, deionized, double-distilled water.
12. Water bath at 60°C.
13. Water bath at 72°C.
14. 1.5~mL microcentrifuge tubes (sterilized by autoclaving).
15. Coverslips (22 x 40).
16. Thermal cycling machine equipped with a flat block (e.g., Techne PHC3).
2.3. Detection
1. Washing solution: 4X SSC, 0.05% Tween 20.
2. Blocking solution: washing buffer plus 5% nonfat dry milk. Make fresh each time.
3. Fluorescein-avidin DCS (FITC-avidin) (Vector Laboratories, Burlingame, CA).
4. Propidium iodide (PI) (Sigma).
5. Antifade solution Vectashield (Vector Labs).
6. Staining Jars.
7. Microscope equipped for detection of FITC and PI fluorescence
3. Methods
3.1. Slides
1. Store slides prepared according to standard methods at room temperature for 5 d
before use.
2. Just before the PRINS reaction, dehydrate the slides by passage through an etha-
nol series (70,90, 100%) at room temperature, 3 min each step, and air-dry.
3. Denature the chromosomal DNA on the slides by immersing them in 70%
formamide, 2X SSC, at 72°C for 2 min, dehydrating through an ice-cold ethanol
series (70,90, lOO%), and an-drying (see Note 3).
3.2. PRINS Reaction
1. Prepare a 10X dNTPs mix: Dilute the stock solutions (100 r&f) of dATP, dCTP,
dGTP, and dTTP l/l 0 in sterile, distilled water. In a sterile microcentrifuge tube,
mix 10 & of each diluted dATP, dCTP, and dGTP, 0.25 pL of diluted dTTP, 25 pL
of 1 m&f biotin-16 dUTP, and 55 pL of glycerol. Mix well and store at -2O’C.
2. Prepare the PRINS reaction mix in a sterile 1.5~mL microtube by mixing (for
each slide) 4 pL of primer (200 pmol), 5 pL of 10X Tag polymerase buffer, 5 pL
of 10X dNTPs mix (from step l), and 0.5 pL of Taq polymerase (2.5 U), and add
sterile distilled water to a final volume of 50 pL.
3. Preheat the reaction mix at 60°C in a water bath.
4. Place the slide (prepared as in Section 3.1.) and a coverslip on the plate of the
thermal cycler.
5. Set up the program for PRINS: 12 min at the annealing temperature (60°C for
primer 13A, 61°C for primer 21A; see Note 4) and 30 min at 72’C.
6. When starting the program, heat the slide(s) and the coverslip at the anneal-
ing temperature for 5 min. Then put the reaction mix onto the slide and cover
10 Char-lieu and Pellestor
by the coverslip. Incubate the slide at the annealing temperature for a further
7 min; the temperature is automatically raised to 72°C at the beginning of the
elongation step.
7. At the end of the elongation time, transfer the slide to 100 mL of preheated stop
buffer (72°C) for 3 min to stop the PRlNS reaction and to remove the coverslip.
Then transfer the slide to 100 mL of washing solution. The shdes can stay m thus
buffer overnight at 4°C if convenient
3.3. Detection
1. Wash the slides twice for 3 min at room temperature in washing solution, with
gentle agitation.
2. Drain the excess washing solution and apply 100 pL of blocking solution to
each slide
3. Incubate for 10 min at room temperature under a coverslip.
4. Remove the covershp, dram excess fluid, and apply 100 pL of FITC-avldin
diluted to 5 pg/mL in blocking solution to the slide. Cover with a new coverslip
and incubate at 37°C for 30 min in a moist chamber.
5. Remove the coverslip and wash the slide three times (5 mm each) m washmg
solution, at room temperature, with gentle agitation.
6 Drain excess fluid and mount the slide (22 x 40 coverslip) with Vectashleld
antifade solution containing 0.5 l.tglmL propidium iodide.
7 Examine the shde by fluorescence microscopy (Fig. 1).
4. Notes
1. Chromosome-spectfic primers sometimes differ from each other by only one
nucleotide at the 3’-end, as for the primers described here. It is therefore advtsable
to purify the primers by HPLC to avoid contammation by shorter products am+
mg from premature stops during syntheses. Storage of the primers in small aliquots
also prevents degradation of the primers by repeated cycles of freeze-thawing.
2. The concentration of the primers can be determined by using the Beer-Lambert
equation:
c = A26d%mi x L (1)
where C is the concentration (M), A260 is the absorbance at 260 nm, E,,,~~i s the
molar extinction coefficient (M-l), and L is the path length (cm) of the spectro-
photometer cuvet. The molar extinction coefficient for an oligonucleottde can be
determined as follows:
&m ax= (number of A x 15,200) + (number of C x 7050) +
(number of G x 12,010) + (number of T x 8400) M-l (2)
3. We describe here formamide denaturation, which gave more consistent results in
our hands, but it is also possible to denature the chromosomes by heating the
slide at 95“C for 3 min as part of the thermal cycle. In this case, omit step 3 of
Section 3.1.) and run the following program on the PCR machine: 95°C for 3 min,