Table Of ContentWurtzetal.MalariaJournal2013,12:34
http://www.malariajournal.com/content/12/1/34
RESEARCH Open Access
Pfhrp2 pfhrp3 Plasmodium
and polymorphisms in
falciparum
isolates from Dakar, Senegal: impact
on rapid malaria diagnostic tests
Nathalie Wurtz1,2, Bécaye Fall3, Kim Bui1,2, Aurélie Pascual1,2,4, Mansour Fall5, Cheikhou Camara6, Bakary Diatta5,
Khadidiatou Ba Fall7, Pape Saliou Mbaye8, Yaya Diémé3, Raymond Bercion3, Boubacar Wade9,
Sébastien Briolant1,2 and Bruno Pradines1,2,3,4*
Abstract
Background: Anaccuratediagnosis is essentialfor the rapid and appropriatetreatmentof malaria. The accuracy of
W
thehistidine-rich protein 2 (PfHRP2)-basedrapid diagnostic test (RDT) Palutop+4 was assessed here. One possible
factor contributing to the failure to detect malaria bythis testis the diversity of theparasite PfHRP2antigens.
W
Methods: PfHRP2detection with the Palutop+4 RDT was carried out. The pfhrp2 and pfhrp3 genes were amplified
and sequenced from 136 isolates ofPlasmodiumfalciparum that were collected inDakar, Senegal from 2009 to
2011.The DNA sequences were determined and statistical analyses of the variation observed between these two
genes were conducted. The potential impact of PfHRP2 and PfHRP3 sequence variation onmalaria diagnosis
was examined.
Results: Seven P. falciparum isolates (5.9% of thetotal isolates, regardless of theparasitaemia; 10.7%of the isolates
withparasitaemia ≤0.005% or ≤250 parasites/μl) were undetected by the PfHRP2Palutop+4WRDT. Low parasite
density is not sufficientto explain the PfHRP2detectionfailure. Three oftheseseven samples showed pfhrp2
deletion (2.4%). The pfhrp3 gene was deleted in12.8%. Ofthe122 PfHRP2sequences, 120 unique sequences were
identified. Of the109 PfHRP3 sequences, 64 unique sequences were identified. Using theBaker’sregression model,
atleast 7.4% of the P. falciparum isolates inDakar were likely to be undetected byPfHRP2 ata parasite density of
≤250parasites/μl (slightly lower than the evaluated prevalence of10.7%). Thispredictive prevalence increased
significantly between 2009 and 2011 (P= 0.0046).
Conclusion: In the present work,10.7%of the isolates witha parasitaemia ≤0.005% (≤250 parasites/μl) were
undetected by the PfHRP2Palutop+4WRDT (7.4% by the predictive Baker’model).Inaddition, allof theparasites
withpfhrp2 deletion (2.4% of the total samples) and 2.1% ofthe parasites withparasitaemia >0.005% and presence
ofpfhrp2 were not detected by PfHRP2RDT.PfHRP2 is highly polymorphic in Senegal. Effortsshould be made to
more accurately determine the prevalence ofnon-sensitive parasites to pfHRP2.
Keywords: Malaria, Plasmodiumfalciparum,Diagnosis,Rapid diagnostic test, Plasmodium falciparum histidine-rich
protein 2, Anti-malarial
*Correspondence:[email protected]
1UnitédeParasitologie,Départementd’InfectiologiedeTerrain,Institutde
RechercheBiomédicaledesArmées,Marseille,France
2AixMarseilleUniversité,UnitédeRecherchesurlesMaladiesInfectieuseset
TropicalesEmergentes,UM63,CNRS7278,IRD198,Inserm1095,Marseille,
France
Fulllistofauthorinformationisavailableattheendofthearticle
©2013Wurtzetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative
CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and
reproductioninanymedium,providedtheoriginalworkisproperlycited.
Wurtzetal.MalariaJournal2013,12:34 Page2of8
http://www.malariajournal.com/content/12/1/34
Background anti-malarial drugs [13-15]. The samples represented
The early and accurate diagnosis of malaria is important three malaria seasons: 14 October 2009 to 19 January
fortheeffectivemanagementandtreatmentofthisdisease 2010, 20 July 2010 to 18 February 2011 and 3 October
toreducemorbidityandmortality.Malariadiagnosisrelies 2011 to 13 January 2012. Informed verbal consent was
on the microscopic examination of blood smears, which obtainedfrompatientsortheirparentspriortobloodcol-
remainsthe standardmethod. TheWorld HealthOrgani- lection. All the tests were performed on the same blood
zation (WHO) recently recommended the adoption of samples used for the malaria diagnosis. The study was
universal testing to confirm the presence of malaria para- reviewed and approved by the ethics committee of the
sites prior to the use of artemisinin-based combination Hôpital Principal de Dakar.
therapy (ACT). In cases where microscopic examination
cannot be performed, rapid diagnostic tests (RDTs) are Diagnosisofmalaria
the best alternative for diagnosis. RDTs can be useful be- The diagnosis of malaria was assessed by microscopic
cause they provide quick and accurate diagnoses, thereby examination, use of HRP2-based RDT and real-time
leadingtotimelyandaccuratetreatmentandreducingthe polymerase chain reaction. At recruitment, thin blood
W
severityandeconomicburdenofthedisease.Today,many smearswerestainedusingaRAL kit(RéactifsRAL,Paris,
RDTs are commercially available, and they utilize immu- France) and were examined to determine the parasite
nochromatographic methods to detect parasite-specific densityanddiagnosis.
W
antigens in lysed blood cells [1]. Most products detect Immunochromatographicrapidtests(RDTPalutop+4 )
Plasmodiumfalciparum-specificproteinsandtargeteither were used to perform the diagnosis for four species of
theP.falciparumhistidine-richprotein2(PfHRP2)orthe Plasmodium. Palutop+4W is a rapid test that uses whole
P. falciparum lactate dehydrogenase (PfLDH). Certain blood for thedetection oftheP.falciparum-specific histi-
RDTscandetectbothP.falciparum-specificandpan-spe- dine rich protein-2 (PfHRP2), the Plasmodium vivax-spe-
cific antigens (aldolase (pALD) or pan-malaria (pLDH)) cific lactate dehydrogenase (LDH) and the pan-malaria-
[1]. Many factors related either to the parasite or to specific pLDH for P. falciparum, P. vivax, Plasmodium
the test may affect the performance of malaria RDTs. Al- ovaleorPlasmodiummalariae(Figure1).
though pALD and pLDH appear to be highly conserved To confirm the diagnosis obtained by the RDTs and
[2,3],ithasbeenreportedthatpfhrp2sequencevariations, the blood smear examination, P. falciparum and P. vi-
particularlywithregardtocertainaminoacidrepeats,can vax detection was performed by real-time PCR using
W
affect the sensitivity of HRP2-based RDTs [3-7]. These a LightCycler (Roche, Meylan, France). The follow-
polymorphisms have been detected in the Asia-Pacific ing oligonucleotide primers and probes, designed with
region [4,5], India [6], Madagascar [3] and in a clinical Primer Express software v2.0 (Applied Biosystems), we-
case in Uganda [7]. In addition, misdiagnosis may also re used: forward 5’-TTTATGTATTGGTATAATTCGG-
arise from gene deletions that prevent the expression of 3’, reverse-5’- GGCAAATAACTTTATCATAGAATTG
proteins by the parasite. More recently, the deletions of AC-3’ and probe-5’-FAM-TACACTACCAACACATG
pfhrp2 and pfhrp3 were reported as the causes of false- GGGCTACAAGAGGT-BBQ-3’ for the P. falciparum
negative diagnoses in populations from Peru [8,9], Mali aquaglyceroporin gene (AJ413249); forward-5’-GTGGC
[10],India[11]andinaclinicalcasefromBrazil[12]. CGCCTTTTTGCT-3’, reverse-5’-CCTCCCTGAAACAA
The aims of this study were to investigate the genetic GTCATCG-3’ and probe-5’-HEX-CATCTACGTGGACA
diversity ofthe pfhrp2 and pfhrp3 genes in P. falciparum ACGGGCTCAACA-BHQ1-3’ for the P. vivax enoyl-acyl
clinical isolates from Dakar, Senegal, and its impact on carrier protein reductase gene (AY423076) (Eurogentec,
predictive HRP2-based RDT diagnostic sensitivity using Angers,France).Eachparasitespecieswasdetectedsepar-
the Baker’s regression model [4]. Then, predictive re- ately. The individual real-time PCR amplifications were
sults were compared to results obtained with use of carriedoutusingthepreviouslydescribedconditions[16].
W
the HRP2-based RDT Palutop+4 (All Diag, Strasbourg,
France), microscopic examination and real-time polyme- Nucleicacidextraction
rasechainreaction. Total genomic DNA of each strain was isolated using
W
the QIAamp DNA Mini kit according to the manufac-
Methods turer’srecommendations(Qiagen,Germany).
Plasmodiumfalciparumisolates
A total of 136 blood samples were selected for analysis pfhrp2sequencing
from the Hôpital Principal de Dakar. The samples, sto- A905-nucleotidefragment ofexon2oftheP.falciparum
red at −20°C, were from patients who came to the hos- histidine-richprotein2(pfhrp2)gene(M13986)wasamp-
pital for a malaria consultation and were recruited for lified by PCR using the pfhrp2-sense 5’- TGTGTAG-
the evaluation of P. falciparum ex vivo susceptibility to CAAAAATGCAAAAGG -3’ and the pfhrp2-antisense
Wurtzetal.MalariaJournal2013,12:34 Page3of8
http://www.malariajournal.com/content/12/1/34
sec; 10 min extension step at 72°C. The PCR products
were loaded on a 1% agarose gel containing 0.5 μg/mL
ethidiumbromide. Theamplicons werepurified usingthe
High Pure 96 UF Cleanup Kit according to the manufac-
turer’s instructions (Roche). The purified fragments were
sequenced using the BigDye Terminator v3.1 Cycle Se-
quencing Kit (Applied Biosystems) using the primers
described above. The sequencing reaction products were
W
purified using the BigDye XTerminator Purification Kit
(Applied Biosystems) in accordance with the manufac-
turer'sinstructions.Thepurifiedproductsweresequenced
using an ABI Prism 3100 analyzer (Applied Biosystems).
The sequences were analysed and translated using the
Vector NTI advance (TM) software (version 11, Invitro-
gen,CergyPontoise,France).Theaminoacidrepeatswere
identifiedbynumericalcode(1–18)asdescribedbyBaker
etal.[5].
pfhrp3sequencing
A 727-nucleotide fragment of exon 2 of the P. falci-
parum histidine-rich protein 3 (pfhrp3) gene (U69552)
was amplified by PCR using the pfhrp3-sense 5’- TG
TTTAGCAAAAATGCAAAAGGACT -3’ and pfhrp3-
antisense 5’- TGTAAGTGATGCGTAGTGGCA -3’ pri-
mers (Eurogentec, Angers, France), which were designed
with the NCBI/Primer-BLAST online tool. The reaction
mixture for the PCR amplification included 2 μl of gen-
omic DNA, 2.5 μl of 10X reaction buffer (Eurogentec,
Angers, France), 0.5 μM of each primer, 200μM of ade-
oxynucleoside triphosphate mixture (dGTP, dATP, dTTP
and dCTP) (Euromedex, Souffelweyersheim, France), 1.5
W
mM MgCl2 and 1 unit of RedGoldStar DNA polymer-
ase (Eurogentec, Angers, France) in a final volume of 25
μl. The thermal cycler (T3 Biometra, Archamps, France)
was programmed as follows: 94°C for 5 min; 40 cycles of
94°C for 30 sec, 54°C for 40 sec and 72°C for 50 sec;
10 min extension step at 72°C. The PCR products were
Figure1MalariadiagnosisbyeitherthePalutop+4Wrapid
loaded on a 1% agarose gel containing 0.5 μg/mL eth-
diagnostictest,whichrecognizesthePlasmodiumfalciparum-
specifichistidinerichprotein-2(PfHRP2),thePlasmodium idium bromide. The amplicons were purified using the
vivax-specificLDHtestforP.vivaxdetectionandthepan- High Pure 96 UF Cleanup Kit accordingto the manufac-
malaria-specificpLDHtestforthedetectionofP.falciparum, turer’s instructions (Roche). The purified fragments were
P.vivax,PlasmodiumovaleorPlasmodiummalariae.
sequenced using the BigDye Terminator v3.1 Cycle Se-
quencing Kit (Applied Biosystems) using the primers
5’- TTAATGGCGTAGGCAATGTG -3’ primers [7]. The described above. The sequencing reaction products were
reaction mixture for the PCR amplification included 5 purified asdescribed intheprevioussection.
μl of genomic DNA, 2.5 μl of 10X reaction buffer
(Eurogentec, Angers, France), 0.5 μM of each primer, Assessmentofpfhrp2andpfhrp3genedeletions
200μMofadeoxynucleosidetriphosphatemixture(dGTP, To confirm gene deletion and not negative PCR reac-
dATP, dTTP and dCTP) (Euromedex, Souffelweyersheim, tions due to poor quality of DNA, independent PCR ex-
W
France),1.5mMMgCl2and1unitofRedGoldStar DNA periments were assessed on samples with no amplicon
polymerase(Eurogentec,Angers,France)toafinalvolume detected by amplification of entire exon 2 of pfhrp2 or
of 25 μl. The thermal cycler (T3 Biometra, Archamps, pfhrp3, described in the previous sections. Further am-
France) was programmed as follows: 94°C for 5 min; 45 plifications were performed across exon 1 and 2 of both
cycles of 94°C for 30 sec, 62°C for 40 sec and 72°C for 90 pfhrp2andpfhrp3usingprimerspreviouslydescribed[8].
Wurtzetal.MalariaJournal2013,12:34 Page4of8
http://www.malariajournal.com/content/12/1/34
Dataanalysisandstatisticaltests ofsamplenumbers(p=0.246,Chi-squaretest)orinterm
The number of repeats were determined for the AHH of parasitaemia between detected (mean = 0.45%; stan-
AHHVAD pattern (type 1), AHHAHHAAD (type 2), AH dard deviation = 1.16%) and undetected samples (mean =
HAHHAAY(type3),AHH(type4),AHHAHHASD(type 0.22%; standard deviation = 0.26%) (p = 0.595, Wilcoxon
5),AHHATD(type6),AHHAAD(type7),AHHAAYtype rank sum test). However, one of these samples was detec-
8),AAY(type9),AHHAAAHHATD(type10),AHN(type tedbythepan-malaria-specificpLDHandtheP.vivax-spe-
11), AHHAAAHHEAATH (type 12), AHHASD (type 13) cificLDH(Table1).Allofthesevensamplesweredetected
andAHHAHHATD(type14)forPfHRP2. asP.falciparumbyreal-timepolymerasechainreaction.
PfHRP2 sequences were classified into four groups Of the isolates detected as P. falciparum by PfHRP2-
W
as a function of the number of type 2 × type 7 repeats: based Palutop+4 , 7.1% were not detected by the pan-
group A PfHRP2 sequences (very sensitive) contained malaria-specific pLDH. The parasitaemia ranged from
more than 100 type 2 × type 7 repeats, group B (sensi- 0.0000% to 0.5% (mean = 0.18%; standard deviation =
tive) contained between 50–100 type 2 × type 7 repeats, 0.24%) for the undetected group and 0.0000% to 15.8%
groupC(non-sensitive)contained<43repeatsand"bor- (mean=0.48%;standarddeviation=1.20%)forthegroup
derline"groupIcontained between 44and49repeats. detectedbythepan-malaria-specificpLDH.Therewasno
The difference in the percentage of isolates belonging significantly difference in term of parasitaemia between
to group C for each malaria season and of detected or thetwogroups(p=0.144,Wilcoxonranksumtest).
undetected parasites was analysed by the Chi-square test.
The parasitaemia was classified into two groups: parasit- Plasmodiumvivaxfalse-positivediagnosesthePfHRP2-based
aemia≤0.005%and>0.005%.Theassociationbetweenthe Palutop+4W
absenceofadiagnosisbyPfHRP2andtheparticulargroup Five of 118 samples were detected as P. vivax by the
W
ofHRP2sensitivity,parasitaemiaortypeofaminoacidre- RDTPalutop+4 (Table2). Thesefive samples were sus-
peat was analysed using the Wilcoxon rank sum test and pected as P. falciparum by microscopy and were con-
theKruskal-Wallisranksumtest. firmed as P. falciparum by real-time polymerase chain
reaction. None of these samples was confirmed as P. vi-
Results vax.Thesefivesamplesshowedaparasitaemia≥0.005%.
Plasmodiumfalciparumdiagnoses
The parasitaemia ranged from 0.0000to 15.8% (median = GeneticdiversityofPlasmodiumfalciparumHRP2andHRP3
0.1%, Q1 = 0.02%; Q3 = 0.5%). 22.8% of the samples sho- For PfHRP2, 122 PCR fragments were successfully amp-
wedaparasitaemia≤0.005%(≤250parasites/μL). lified. No amplicon was detected for three samples (186/
1, 56/3 and 150/3) by the two methods. Thepfhrp2 gene
Plasmodiumfalciparumfalse-negativediagnosesbythe wasdeletedinthesethree samples(2.4% ofthesamples).
PfHRP2-basedPalutop+4W Thirteenofthe14previouslyidentifiedaminoacidrepeats
Of 118 isolates, regardless of parasite density, seven were detected [4] (Table 3). Of the 122 PfHRP2 sequen-
samples were not detected by the PfHRP2-based Palu- ces, 120 unique sequences were identified. Only three
top+4W. Three showed a parasitaemia ≤0.005% (≤250 PfHRP2 sequences did not begin with the type 1 repeat
parasites/μl). There was no significant difference in term (AHHAHHVAD). The type 2 repeat (AHHAHHAAD)
Table1Plasmodiumfalciparumfalse-negativediagnosesbytheHRP2-basedtest
Palutop+4W Microscopy RT-PCR HRP2a HRP3b
Identification Pan Pf Pv Diagnostic Parasitaemia Pf Pv
186/1 + − + Pf 0.5% + − − −
212/1 − − − Pf 0.02% + − +(B) −
55/2 − − − Pf 0.5% + − +(B) −
56/3 − − − Pf 0.5% + − − +
150/3 − − − Pf 0.001% + − − −
157/3 − − − −c + − +(B) −
183/3 − − − Pf 0.004% + − +(C) −
Pf=Plasmodiumfalciparum;Pv=Plasmodiumvivax;RT-PCR=real-timepolymerasechainreaction.
a−Ifdeletionofpfhrp2and+ifpresenceofpfhrp2.
(B)GroupB,sensitivetoPfHRP2,detection,numberoftype2repeats×type7repeatsbetween50to100repeats.
(C)GroupC,nonsensitivePfHRP2detection,numberoftype2repeats×type7repeats<43repeats.
b−Ifdeletionofpfhrp3and+ifpresenceofpfhrp3.
cThinandthickbloodsmearswerenegative.
Wurtzetal.MalariaJournal2013,12:34 Page5of8
http://www.malariajournal.com/content/12/1/34
Table2Plasmodiumvivaxfalse-positivediagnoses Table4ThedistributionofPfHRP2sequences(number,
Palutop+4W Microscopy RT-PCR no;percentage,%)intofourgroupsbasedonthe
numberoftype2×type7repeats:groupA(very
Identification Pan Pf Pv Diagnostic Parasitaemia Pf Pv
sensitive)PfHRP2sequencescontainedmorethan100
146/1 − + + Pf 0.8% + − type2×type7repeats,groupB(sensitive)contained
186/1 + − + Pf 0.5% + − between50to100type2×type7repeats,groupC
81/3 + + + Pf 1.4% + − (non-sensitive)contained<43repeatsandthe"borderline"
groupIcontainedbetween44and49repeats
113/3 + + + Pf 2.0% + −
GroupA GroupB GroupI GroupC
146/3 + + + Pf 0.06% + −
Year no % no % no % no %
Pf=Plasmodiumfalciparum;Pv=Plasmodiumvivax;RT-PCR=real-time
polymerasechainreaction. 2009–2010 9 23.1 30 76.9 0 0 0 0
2010–2011 7 17.5 29 72.5 2 5 2 5
was observed in 100% of the sequenced isolates, the type 2011–2012 5 11.6 28 65.1 3 7.0 7 16.3
3 (AHHAHHAAY) in 89%, the type 5 (AHHAHHASD) 2009–2012 21 17.2 87 71.3 5 4.1 9 7.4
in 75%, the type 6 (AHHATD) in 98%, the type 7
(AHHAAD) in 99%, the type 8 (AHHAAY) in 84% and
the type 10 (AHHAAAHHATD) in 75%. Several of the The number of isolates belonging to group C (non-
repeats occurred in only a few isolates: the type 4 (AHH) sensitivetotheHRP2test)increasedsignificantlybetween
in 20 isolates (16%), the type 9 (AAY) in two isolates, the 2009and2011(P=0.0046,Chi-squaretest).
type 12 (AHHAAAHHEAATH) in only one isolate, the For PfHRP3, 109 PCR fragments were successfully
type 13 (AHHASD) in nine isolates and the type 14 amplified. No amplicon was detected for 16 samples by
(AHHAHHATD) in five isolates. The type 11 repeat the two methods. The pfhrp3 gene was deleted in 12.8%
(AHN) was not detected in P. falciparum parasites from of the samples. Seven of the eight previously identified
Dakar. amino acid repeats were detected [4] (Table 3). Of the
The PfHRP2 sequences were classified as described 109 PfHRP3 sequences, 64 unique sequences were iden-
in the Methods section. The results of the classification tified. The type 1 repeat (AHHAHHAAD) was obser-
of the PfHRP2 sequences into type 2 × type 7 repeat ved in 99% of the sequenced isolates, the type 4 (AHH)
groupsareshowninTable4. in 100%, the type 7 (AHHAAD) in 100%, the type 15
(AHHAHHAAN) in 99%, the type 16 (AHHAAN) in
Table3Thedistributionofaminoacidrepeats(minimum
100%, the type 17 (AHHDG) in 100% and the type 18
tomaximumnumber)inPfHRP2andPfHRP3from
(AHHDD) in 99%. The type 2 repeat (AHHAHHAAD)
PlasmodiumfalciparumisolatesfromDakar,Senegal wasnotdetected inP.falciparumparasites fromDakar.
Code Amino-acidrepeats PfHRP2 PfHRP3
1 AHHAHHVAD 0–8 0–4 ComparisonbetweentheHRP2-basedRDTresultsand
2 AHHAHHAAD 4–17 0 geneticpolymorphismsorexpectedfrequency
3 AHHAHHAAY 0–3 0 determinedbytheBaker’sregressionmodel
4 AHH 0–3 1 The three samples (186/1, 56/3 and 150/3) with deletion
of pfhrp2 (2.4%) were not detected by the PfHRP2-based
5 AHHAHHASD 0–2 0 W
Palutop+4 . One of these three samples (186/1) was
6 AHHATD 0–7 0
detected by the pan-malaria-specific pLDH. Of the 16
7 AHHAAD 0–14 1–2 samples with deletion of pfhrp3 (12.8%), six were not
8 AHHAAY 0–2 0 detected bythePfHRP2-basedPalutop+4W.
9 AAY 0–1 0 Ofthefour samplesnot detected bythePfHRP2-based
W
10 AHHAAAHHATD 0–3 0 Palutop+4 but with PfHRP2,only one(183/3)wasclas-
sified ingroup C (non-sensitive) accordingtothe Baker’s
11 AHN 0 0
regression model. In addition, of the nine samples ex-
12 AHHAAAHHEAATH 0–1 0
pected to be not detected by PfHRP2-based RDT, the
13 AHHASD 0–2 0 sample 183/3 was the only one which was not detected
14 AHHAHHATD 0–1 0 by the PfHRP2-based Palutop+4W. There was no signifi-
15 AHHAHHAAN 0 0–1 cant difference in parasitaemia between the four predict
16 AHHAAN 0 3–19 groups (p = 0.676, Kruskal-Wallis rank sum test). How-
ever, there was a significant association between the ab-
17 AHHDG 0 3–9
sence of a diagnosis by PfHRP2 RDTand the number of
18 AHHDD 0 0–6 type 2repeats(AHHAHHAAD)(P=0.0463).
Wurtzetal.MalariaJournal2013,12:34 Page6of8
http://www.malariajournal.com/content/12/1/34
However, there was a significant association between parasite density. There was no significantly difference in
the absence of a diagnosis by PfHRP2 RDT and the term of parasitaemia between the two groups (p = 0.144,
number oftype 2repeats (AHHAHHAAD) (P= 0.0463). Wilcoxon rank sum test). For the five P. falciparum iso-
There was no significant association between the absence lates (4.2%) misdiagnosed as P. vivax parasites by the P.
of a diagnosis by PfHRP2-based Palutop+4W and the gen- vivax LDH, all of these showed parasitaemia ≥0.005%
etic diversity of other PfHRP2 repeats: type 1 (AHHAHH (≥250parasites/μl).
VAD) (P = 0.4634, Fisher’s Exact test), type 3 (AHHAH Another possible factor affecting the sensitivity of the
HAAY) (P = 0.7852), type 4 (AHH) (P = 1), type 5 PfHRP2-based RDT is the failure of the parasite to ex-
(AHHAHHASD) (P = 0.7589), type 6 (AHHATD) (P = press the antigen, either due to genetic deletions, frame
0.1959), type 7 (AHHAAD) (P = 0.1872), type 8 (AH shift mutations or alterations in protein expression. The
HAAY) (P = 1), type 9 (AAY) (P = 1), type 10 (AH deletions of pfhrp2 and pfhrp3 were reported as the
HAAAHHATD) (P = 0.8402), type 12 (AHHAAAHHE cause of false-negative diagnoses in populations from
AATH) (P = 1), type 13 (AHHASD) (P = 1) and type 14 Peru [8,9], Mali [10], India [11] and in a clinical case
(AHHAHHATD)(P=1). from Brazil [12]. In addition, the levels of pfhrp2 tran-
Among the 109 sequences of HRP3, only one isolate scription and PfHRP2 protein expression varied between
was not detected by PfHRP2-based Palutop+4W. There P. falciparum strains, and this may impact the detection
was no association between the absence of a diagnosis sensitivity of the PfHRP2-based RDT [20]. The three
by PfHRP2-based Palutop+4W and the genetic diversity samples with deletion of pfhrp2 (2.4%) were not detec-
W
ofPfHRP3. ted by the PfHRP2-based Palutop+4 . The deletion of
pfhrp2 is one of the factors of false-negative diagnoses
Discussion using PfHRP2-based RDT. Of the 16 samples with dele-
The WHO recently recommended adopting universal tion of pfhrp3 (12.8%), six were not detected by the
testing toconfirm thepresenceofmalaria parasitesprior PfHRP2-based Palutop+4W. The frequency of pfhrp2 de-
to the use of ACT, and in the cases where microscopic letion observed in Senegal is comparable to those esti-
examinationcannotbe performed,the RDT would be the mated in Africa, like in Mali (2%) [10] or in India (4.2%)
best alternative for confirmation. In 2006, the Senegalese [11] and lower than those estimated in South America
National Malaria Control Programme recommended likeinPeru(25.7and41%)[8,9].Aspreviouslydescribed
ACTasthefirst-linetreatmentforuncomplicatedmalaria in Peru [8], the proportion of parasites lacking pfhrp3 is
and, in 2007, mandated testing for all suspected cases of higher than those lacking pfhrp2 in samples collected in
malaria with P. falciparum using the HRP2-based RDT. Dakar. This suggests that parasites lacking pfhrp3 may
PfHRP2-based RDTs are now commonly used with high have been present in Senegal longer than those lacking
adherence in Senegal [17-19]. These RDTs can provide a pfhrp2.
quick and accurate diagnosis, thereby leading to timely Polymorphisms in the pfhrp2 gene that can affect the
and appropriate malaria treatment and a reduction in the sensitivity of PfHRP2-based RDTs have been detected in
severityandeconomicburdenofthedisease. the Asia-Pacific region [4,5], India [3], Madagascar [3]
In the present work, 5.9% of the total (n = 7) P. falcip- and in a clinical case in Uganda [7]. Prior to this report,
arum isolates and 10.7% of the isolates with parasitae- no data were yet available on the sequence variation of
mia ≤0.005% (≤250 parasites/μl) were undetected by the HRP2 from P. falciparum parasites from Senegal. Con-
W
PfHRP2 Palutop+4 RDT. Moreover, of the isolates sistentwithpreviousreports[5-7],thePfHRP2washighly
detected as P. falciparum by PfHRP2, 7.1% were not diverseinparasiteisolatesfromDakar.Ofthe122PfHRP2
detected by the pan-malaria-specific pLDH. Five P. fal- sequences, 120 unique sequences were identified. In pre-
ciparum isolates (4.2%) were misdiagnosed as P. vivax vious works, all pfhrp2 sequences have begun with a type
parasites bytheP. vivaxLDH. 1 repeat (AHHAHHVAD) [5-7]. However, three of the
Three possible factors can affect the sensitivity of the Senegalese isolate sequences in this study did not begin
PfHRP2-based RDT: parasite density, pfhrp2 deletion with a type 1 repeat. The type 11 repeat (AHN) was not
and pfhrp2 polymorphisms. The parasite density can not detected in P. falciparum parasites from Dakar. This is
explain the failure of the detection by the PfHRP2 Palu- consistentwithisolatesfromAfrica[4],exceptforoneiso-
W
top+4 RDT. There was no significant difference in term latefromCameroon[5]andonefromnorthernMadagas-
ofsamplenumbers(p=0.246,Chi-squaretest)orinterm car [3]. However, the Senegalese PfHRP2 sequences had
of parasitaemia between detected (mean = 0.45%; stan- certain characteristics: only one isolate possessed a type
darddeviation=1.16%)andundetectedsamplesbyHRP2 12repeat(AHHAAAHHEAATH),whilethePfHRP2from
(mean = 0.22%; standard deviation = 0.26%) (p = 0.595, all the previously described isolates from Africa, the Paci-
Wilcoxon rank sum test). In addition, the non-detection fic, South America or Asia contained one type 12 repeat
bythepan-malaria-specificpLDHwasnotassociatedwith [3,5]. The type 9 repeat has not been described in Africa
Wurtzetal.MalariaJournal2013,12:34 Page7of8
http://www.malariajournal.com/content/12/1/34
[3-5]. Interestingly, two isolates from Dakar showed a were different from Indian isolates in that they did not
type 9 repeat. Types 13 and 14 have rarely been ob- containtype1repeats[6].Themostcommonrepeattypes
served in Africa [3-5], yet these two types of repeats between PfHRP2and PfHRP3in Africaare types 1and 7.
were found in nine (7.4%) and five (4.1%) isolates from Thesesharedrepeats,particularlytype7,whichistheonly
Dakar,respectively. typedescribedbothinAfricaandIndia,arelikelythebasis
Finally,usingtheBaker’sregressionmodel,itwasshown for the observed cross-reactivity between PfHRP3- and
thatatleast7.4%ofP.falciparumisolatesinDakar(group PfHRP2-specific monoclonal antibodies [21,22]. In addi-
C) were likely to be undetected by PfHRP2-based RDTat tion, the type 7 repeat is one of the two selected types in
a parasite density of ≤250 parasites/μl. In Madagascar, 9% the Baker’s regression model to predict non-detection of
of the isolates at a parasite density of ≤250 parasites/μl parasitesbyPfHRP2atadensityof≤250parasites/μl.
were predicted to be undetected by PfHRP2-based RDT.
The number of isolates predicted to be non-sensitive to
Conclusion
the PfHRP2-based RDT increased significantly between
In the present work, 10.7% of the isolates with a parasit-
2009 and 2011 (0% in 2009, 5% in 2010 and 16.3% in aemia ≤0.005% (≤250 parasites/μl ) were undetected by
2011;P=0.0046).Onehypothesistoexplainthisincrease W
the PfHRP2 Palutop+4 RDT (7.4% by the predictive
is the selection of parasites which contain less than 43 Baker’model). In addition, all of the parasites with pfhrp2
repeats(type2×type7repeats).PfHRP2-basedRDTsare
deletion (2.4% of the total samples) and 2.1% of the para-
now commonly used with high adherence in Senegal sites with parasitaemia >0.005% and presence of pfhrp2
[17-19].PatientswithnegativePfHRP2-basedRDTarenot W
were not detected by PfHRP2 Palutop+4 RDT. PfHRP2
treated for malaria. If the parasites are undetected by the
(and PfHRP3), the most common target of malaria RDTs,
PfHRP2-based RDT, the delay of diagnose before treat-
ishighlypolymorphicin Senegal. Futureeffortsshould be
ment might permit an increase in the time required for
made to more accurately determine the prevalence of
development of sexual stages (gametocytes) and in their
parasites that are non-sensitive to HRP2-detection-based
transmission to mosquitoes during a blood meal com-
assays. Better understanding of the structure of PfHRP2
paredtoparasitestreatedquickly.Thetransmissionofpa-
and its diversity at the polymorphism and protein levels
rasites undetected by the PfHRP2-based RDT might be
willcontributetotheevaluationandimprovementofmal-
more important, leading to faster dissemination of these
ariaRDTs.
genotypes. The frequency of these genotypes could in-
creaseincomingyears.Thisevolutionshouldcontinueto
Competinginterests
bemonitoredinSenegal. Theauthorsdeclarethattheyhavenocompetinginterests.
In the Dakar samples with low parasite density, the
predicted prevalence was slightly lower than the evalu- Authors’contributions
ated prevalence (7.4% versus 10.7%). The predictive re- NW,KBandAPcarriedoutthediagnostictestsandthemoleculargenetic
studies.BF,MF,CC,BD,KBF,PSM,YD,RBandBWsupervised,carriedoutand
gression model developed by Baker cannot explain all of coordinatedthefieldcollectionsofpatientisolates.NW,SBandBP
the PfHRP2 non-detection in Senegal. Of the four sam- conceivedandcoordinatedthestudy.SBandBPanalysedthedata.NW,AP,
ples not detected by the PfHRP2-based Palutop+4W but SBandBPdraftedthemanuscript.Alltheauthorsreadandapprovedthe
finalmanuscript.
with PfHRP2, only one (183/3) was classified in group C
(non-sensitive) according to the Baker’s regression mo-
Acknowledgements
del. In addition, of the nine samples expected to be not TheauthorsthankthepatientsofHôpitalPrincipaldeDakar,NdeyeFatou
detected by PfHRP2-based RDT, the sample 183/3 was DiopandMauriceGomisfortechnicalsupportandthestaffoftheclinical
units.ThisworkwassupportedbytheEtatMajordesArméesFrançaises
the only one which was not detected by the PfHRP2-
(grantschemadirecteurpaludismeLR607).
W
based Palutop+4 . However, this sample was the only
onewith parasitaemia ≤0.005% (≤250parasites/μl). Authordetails
1UnitédeParasitologie,Départementd’InfectiologiedeTerrain,Institutde
It has been reported that, due to PfHRP3 and PfHRP2
RechercheBiomédicaledesArmées,Marseille,France.2AixMarseille
structural homology, PfHRP3 can cross-react with HRP2- Université,UnitédeRecherchesurlesMaladiesInfectieusesetTropicales
coated antibodies in the RDT. PfHRP3 has also contribu- Emergentes,UM63,CNRS7278,IRD198,Inserm1095,Marseille,France.
ted to the detection of P. falciparum malaria infections 3Laboratoired’étudedelachimiosensibilitédupaludisme,Fédérationdes
laboratoires,HôpitalPrincipaldeDakar,Dakar,Sénégal.4CentreNationalde
[21]. In this study, the genetic diversity of pfhrp3 (64 dif- référenceduPaludisme,Marseille,France.5Servicederéanimationmédicale,
ferent sequences) was less than that of pfhrp2 (120 dif- HôpitalPrincipaldeDakar,Dakar,Sénégal.6Servicedesurgences,Hôpital
PrincipaldeDakar,Dakar,Sénégal.7Servicedepathologieinfectieuse,Hôpital
ferent sequences). All of the previously described repeat
PrincipaldeDakar,Dakar,Sénégal.8Départementdemédecineinterneet
types,otherthantype2,werepresent(99%to100%).The spécialitésmédicalesdepathologietropicale,HôpitalPrincipaldeDakar,
type 2 repeat hasneverbeen described in HRP3inAfrica Dakar,Sénégal.9Chefferie,HôpitalPrincipaldeDakar,Dakar,Sénégal.
[3,4]. The Senegalese HRP3 sequences had characteristics
Received:24October2012Accepted:21January2013
in common with those of other African isolates [3,4] and Published:24January2013
Wurtzetal.MalariaJournal2013,12:34 Page8of8
http://www.malariajournal.com/content/12/1/34
References falciparummalaria:assessingaccuracyandcost-effectivenessinthevillages
1. MurrayCK,GasserRA,MagillAJ,MillerRS:Updateonrapiddiagnostic ofDielmoandNdiop,Senegal.MalarJ2010,9:153.
testingformalaria.ClinMicrobiolRev2008,21:97–110. 18. ThiamM,ThiorM,FayeB,NdiopM,DioufML,DioufMB,DialloI,BaFallF,
2. LeeN,BakerJ,BellD,McCarthyJ,ChengQ:Assessingthegenetic NdiayeJL,AlbertiniA,LeeE,JorgensenP,GayeO,BellD:Majorreduction
diversityofthealdolasegenesofPlasmodiumfalciparumand inanti-malarialdrugconsumptioninSenegalafternation-wide
Plasmodiumvivaxanditspotentialeffectonperformanceofaldolase- introductionofmalariarapiddiagnostictests.PLoSOne2011,3:18419.
detectingrapiddiagnostictests.JClinMicrobiol2006,44:4547–4549. 19. ThiamS,ThwingJ,DialloI,FallFB,DioufMB,PerryR,DiopM,DioufML,
3. MarietteN,BarnadasC,BouchierC,TichitM,MenardD:Country-wide CisseMM,DiawMM,ThiorM:Scale-uphome-basedmanagementof
assessmentofthegeneticpolymorphisminPlasmodiumfalciparumand malariabasedonrapiddiagnostictestsandartemisinin-based
Plasmodiumvivaxantigensdetectedwithrapiddiagnostictestsfor combinationtherapyinaresource-poorcountry:resultsinSenegal.
malaria.MalarJ2008,7:219. MalarJ2012,11:334.
4. BakerJ,HoMF,PelecanosA,GattonM,ChenN,AbdullahS,AlbertiniA, 20. BakerJ,GattonML,PetersJ,HoMF,McCarthyJS,ChengQ:Transcription
ArieyF,BarnwellJ,BellD,CunninghamJ,DjalleJ,EcheverryDF,GamboaD, andexpressionofPlasmodiumfalciparumhistidine-richproteinsin
HiiJ,KyawMP,LuchavezJ,MembiC,MenardD,MurilloC,NhemS,Ogutu differentstagesandstrains:implicationsforrapiddiagnostictests.PLoS
B,OnyorP,OyiboW,WangSQ,McCarthyJ,ChengQ:Globalsequence One2011,6:22593.
variationinthehistidine-richproteins2and3ofPlasmodiumfalciparum: 21. WellemsTE,HowardRJ:Homologousgenesencodetwodistinct
implicationsfortheperformanceofmalariarapiddiagnostictests.Malar histidine-richproteinsinaclonedisolateofPlasmodiumfalciparum.Proc
J2010,9:129. NatlAcadSciUSA1986,83:6065–6069.
5. BakerJ,McCarthyJ,GattonM,KyleDE,BelizarioV,LuchavezJ,BellD,Cheng 22. SharmaYD:Genomicorganization,structureandpossiblefunctionof
Q:GeneticdiversityofPlasmodiumfalciparumhistidine-richprotein2 histidinerichproteinsofmalariaparasites.IntJBiochem1988,20:471–477.
(PfHRP2)anditseffectontheperformanceofPfHRP2-basedrapid
diagnostictests.JInfectDis2005,192:870–877. doi:10.1186/1475-2875-12-34
6. KumarN,SinghJPN,PandeV,MishraN,SrivastavaB,KaporR,ValechaN, Citethisarticleas:Wurtzetal.:Pfhrp2andpfhrp3polymorphismsin
AnvikarAR:GeneticvariationinhistidinerichproteinsamongIndian PlasmodiumfalciparumisolatesfromDakar,Senegal:impactonrapid
Plasmodiumfalciparumpopulation:possiblecauseofvariablesensitivity malariadiagnostictests.MalariaJournal201312:34.
malariaofrapiddiagnostictests.MalarJ2012,11:298.
7. WurtzN,BriolantS,LemariéD,PommierDeSantiV,PascualA,RoodtT,
BenoitN,HupinC,PradinesB:Retarddediagnosticd’unaccèspalustreà
PlasmodiumfalciparumchezunmilitaireenOuganda:négativitédes
testsdediagnosticrapideassociéeàunpolymorphismedel’antigène
HRP2.MedSanteTrop2013,accepted(ms120029).
8. GamboaD,HoMF,BendezuJ,TorresK,ChiodiniPL,BarnwellJW,Incardona
S,PerkinsM,BellD,McCarthyJ,ChengQ:AlargeproportionofP.
falciparumisolatesintheAmazonregionofPerulackpfhrp2andpfhrp3;
implicationsformalariarapiddiagnostictests.PLoSOne2010,5:8091.
9. MalthaJ,GamboaD,BendezuJ,SanchezL,CnopsL,GilletP,JacobsJ:
RapiddiagnostictestsformalariadiagnosisinthePeruvianAmazon:
Impactofpfhrp2genedeletionsandcross-reactions.PLoSOne2012,
7:43094.
10. KoitaOA,DoumboOK,OuattaraA,TallLK,KonaréA,DiakitéM,DialloM,
SagaraI,MasindeGL,DoumboSN,DoloA,TounkaraA,TraoréI,Krogstad
DJ:False-negativerapiddiagnosistestsformalariaanddeletionofthe
histidine-richrepeatregionofthehrp2gene.AmJTropMedHyg2012,
86:194–198.
11. KumarN,PandeV,BhattRM,ShahNK,MishraN,SrivastavaB,ValechaN,
AnvikarAR:GeneticdeletionofHRP2andHRP3inIndianP.falciparum
populationandfalsenegativemalariarapiddiagnostictest.ActaTrop
2013,125:119–121.
12. HouzéS,HubertV,LePessecG,LeBrasJ,ClainJ:Combineddeletionsof
pfhrp2andpfhrp3genesresultsinPlasmodiumfalciparummalariafalse-
negativerapiddiagnostictest.JClinMicrobiol2011,49:2694–2696.
13. FallB,DiawaraS,SowK,BaretE,DiattaB,BaFallK,MbayePS,FallF,Diémé
Y,RogierR,WadeB,BercionR,PradinesB:Exvivosusceptibilityof
PlasmodiumfalciparumisolatesfromDakar,Senegal,tosevenstandard
anti-malarialdrugs.MalarJ2011,10:310.
14. GaillardT,FallB,TallA,WurtzN,DiattaB,LavinaM,BaFallK,DieneSarrF,
BaretE,DiéméY,WadeB,BercionR,BriolantS,PradinesB:Absenceof
associationbetweenexvivosusceptibilitytodoxycyclineandpftetQand Submit your next manuscript to BioMed Central
pfmdtcopynumbersinPlasmodiumfalciparumisolatesfromDakar, and take full advantage of:
Senegal.ClinMicrobiolInfect2012,18:E238–E240.
15. WurtzN,FallB,PascualA,DiawaraS,SowK,BaretE,DiattaB,FallKB,Mbaye
PS,FallF,DiemeY,RogierC,BercionR,BriolantS,WadeB,PradinesB: • Convenient online submission
PrevalenceofmolecularmarkersofPlasmodiumfalciparumdrug • Thorough peer review
resistanceinDakar.Senegal.MalarJ2012,11:197.
• No space constraints or color figure charges
16. WurtzN,MintLekweiryK,BogreauH,PradinesB,RogierC,OuldMohamed
SalemBoukharyA,HafidJE,OuldAhmedouSalemMS,TrapeJF,BascoLK, • Immediate publication on acceptance
BriolantS:VivaxinMauritaniaincludesinfectionofaDuffy-negative • Inclusion in PubMed, CAS, Scopus and Google Scholar
individual.MalarJ2011,10:336.
• Research which is freely available for redistribution
17. LyAB,TallA,PerryR,BarilL,BadianeA,FayeJ,RogierC,TouréA,SokhnaC,
TrapeJF,MichelR:UseofHRP-2-basedrapiddiagnostictestforPlasmodium
Submit your manuscript at
www.biomedcentral.com/submit
