Table Of ContentRezaeietal.VirologyJournal2013,10:20
http://www.virologyj.com/content/10/1/20
RESEARCH Open Access
No association between XMRV or related
gammaretroviruses in Australian prostate
cancer patients
Simin D Rezaei1,2, Anna C Hearps1,3, John Mills1,3,4, John Pedersen4 and Gilda Tachedjian1,2,3*
Abstract
Background: Xenotropic murine leukemia virus-related virus (XMRV) is a gammaretrovirus reported to be
associated with prostate cancer (PC) and chronicfatigue syndrome (CFS). While theassociation of XMRV withCFS
and PC has recently been discredited, nostudies have been performed inAustralian patients to investigate the
association between PC and XMRV or related murine leukemia virus (MLV) inmatched PC and normal tissue.
Methods: Genomic DNA (gDNA) was purified from matched normal and cancer formalin-fixed paraffin-embedded
(FFPE) prostate tissue from 35 Australian PCpatientswith Gleason scores ranging from 7 –10. The presence of the
ribonuclease L (RNase L) polymorphismR462Q was determined by allele specific PCR. Sampleswere screened for
XMRV and related murine leukemia virus (MLV) variantsby qPCR. Contaminating mouse DNA was detectedusing
qPCR targeting mouse intracisternal A particle long terminal repeat DNA.
Results: gDNA was successfully purified from 94% (66/70) ofnormal and cancer FFPE prostate tissues. RNase L
typing revealed 8% were homozygous (QQ), 60% were heterozygous (RQ) and 32% were wild-type (RR)for the
RNase L mutation.None of the 66 samples tested were positive for XMRV or related MLV sequences using broad
MLV or XMRV specific primers withdetectionsensitivities of 1 viral copy ofMLV/XMRV and XMRV DNA, respectively.
Conclusions: Using highly sensitive qPCRwefound no evidence of XMRV or related gammaretroviruses inprostate
tissues from 35 Australian PCpatients. Our findings are consistent withother studies demonstrating that XMRV is a
laboratory contaminant that has no rolein the aetiology ofPC.
Introduction homozygous (QQ) cases using a novel DNA microarray
Prostate cancer (PC) is one of the most commonly diag- (Virochip) containing oligonucleotides comprising con-
nosed cancers in men resulting in approximately 3,300 served sequences from known viral genomes [2]. How-
deaths in Australia per year. While the aetiology of PC ever, the association of XMRV with the QQ RNASEL
remains poorly understood, infection and associated in- variant was observed in some [3] but not all studies
flammation are risk factors in PC development [1]. The [4,5]. XMRVwasreportedly linked with higher-gradePC
rationale for a recent search for aviral origin for PC was cancers suggesting that its presence may be a useful bio-
based on the observation that a reduced activity variant marker for severe disease [4]. However, there was dis-
of the antiviral RNASEL gene (R462Q) was associated cordance with regard to the cellular location of XMRV
withfamilial PC[2].Agammaretrovirusnamed xenotro- in the prostate where positive signals by fluorescence
pic murine leukemia virus-related virus (XMRV) was in situ hybridization (FISH) and immunohistochemistry
identified in cDNA samples from seven of 11 R462Q assays were observed in either malignant epithelium [4]
orstromalcells[2,3].
Gammaretrovirusescompriseagroupwithin thelarger
*Correspondence:[email protected]
1RetroviralBiologyandAntiviralsLaboratory,CentreforVirology,Burnet retrovirus family that reverse-transcribe viral RNA to a
Institute,85CommercialRoad,Melbourne,Victoria3004,Australia cDNA during replication that is inserted into the host
2DepartmentofMicrobiology,MonashUniversity,Clayton,Victoria3168, cell chromosome. As the name indicates, XMRV is
Australia
highly related to murine leukemia virus (MLV) sharing
Fulllistofauthorinformationisavailableattheendofthearticle
©2013Rezaeietal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative
CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and
reproductioninanymedium,providedtheoriginalworkisproperlycited.
Rezaeietal.VirologyJournal2013,10:20 Page2of9
http://www.virologyj.com/content/10/1/20
96%sequence identity [2].In additiontoPC,XMRVwas (QQ), 60% were heterozygous (RQ) and 32% were wild-
also associated with chronic fatigue syndrome (CFS) [6], type (RR).
which wasremarkable since noothergammaretroviruses
have been described that infect humans. However, HumanVAMP2qPCRconfirmsintegrityofDNApurified
XMRV related xenotropic-MLV (X-MLV) are known to fromFFPEsamples
infect other species including mice, koalas, cats and DNA derived from FFPE samples is expected to be frag-
non-human primates and cause leukemias, lymphomas, mented due to the fixation process and may contain
neurological diseases and immunodeficiencies in these substances that are inhibitory for PCR amplification.
species suggestingaplausible rolefor XMRVinPC[4]. Therefore, to evaluate the suitability of genomic DNA
In addition to the original report by Urisman and col- (gDNA) derived from FFPE tissue for qPCR, we deter-
leagues (2006) several other groups demonstrated an as- mined whether we could amplify a region of the single
sociation of XMRV with PC using nucleic acid detection copy human vesicle-associated membrane protein 2
and immune based assays [3-5]. However, many other (HuVAMP2) gene. The size of the amplimer (78 bp) was
studies either failed or were only able to detect XMRV designed to be similar to the expected amplimer sizes
in a minority of PC tissue samples [7-19]. While the rea- for qPCR detection of XMRV and MLV-related viruses
son for the reported disparity of XMRV prevalence in (Table 1). The linear range and sensitivity of human
PC was unclear, it was initially attributed to differences VAMP2qPCRwas1to107copiesperreaction(Figure2A).
in geography or assay sensitivity. However, subsequent All samples tested gave HuVAMP2 values within the ac-
studies demonstrated that positive signals in sensitive ceptable range and were thus deemed suitable for further
PCR assayscould beascribed toeithermouseDNAcon- qPCR analysis. Mean HuVAMP2 copy numbers from
tamination or contamination with XMRV DNA from a gDNApurifiedfromnormalandcancertissueweresimilar
commonly used PC cell line (22Rv1), which harbours (P=0.7,n=33,Mann–WhitneyUTest).
10–20 copies of XMRV [20-26]. The discovery that
XMRV was generated by recombination of two mouse XMRVorrelatedMLVsequenceswerenotdetectedin
endogenousretrovirusesfollowingpassage ofaPCxeno- gDNAfrompairednormalandcancertissue
graft in nude mouse demonstrated that XMRV was gen- To detect XMRVand related MLVsequences in a single
eratedinthelaboratory[27]. qPCRreactionwe used broad MLV(BMLV)primerstar-
Due to public health consequences of potential infec- geting the conserved reverse transcriptase regions of
tion with XMRV or MLVs in humans, we considered it XMRV and Moloney murine leukemia virus (MoMLV)
isimportant to refuteor confirm their associationwith PC (Figure 1). The linear range and sensitivity of the BMLV
in an Australian context. This study describes the first primers/probe used for amplification of XMRV and
evaluation in Australian PC patients for the presence of MoMLV was determined to be 1 to 107 and 1 to 106
XMRV and related gammaretroviruses in matched nor- copies per reaction, respectively (Figures 2B and 2C).
mal and PC tissue and the elucidation of the RNASEL We also evaluated the linear detection range and sensi-
genotype in Australian PC patients. In addition, patient tivity of XMRV specific primers targeting the integrase
samplesweretested for the presence of mouse DNAcon- region of XMRV (Figure 1) [28] and determined it to be
taminationusingasensitivequantitativePCR(qPCR)assay from 1 to 107 copies of XMRV per reaction (Figure 2D).
that detects mouse intracisternal A-type particle (IAP) Taken together these data demonstrate that the qPCR
sequences. We failed to detect XMRV or related MLVs in assays reproducibly detected as little as 1 copy of XMRV
AustralianPCpatientsconfirmingthatthesegammaretro- andMoMLVinatotalof1μgofcarriernucleicacid.
virusesarehighlyunlikelytobeinvolvedinPC. We performed qPCR using BMLV primers on gDNA
purified from 33normalprostate and33PCFFPE tissue.
Results DNA was subjected to three independent assays except
PatientcharacteristicsandRNaseLgenotype for 10/33 cancer and 16/33 normal tissues where only
The patient population comprised individuals with one qPCR assay was performed due to limited amounts
higher-grade PC as determined by Gleason scores of gDNA. All patient samples were negative using the
(median 7, range 7 – 10). Consistent with PC predomin- BMLV primers (Table 2). We also subjected DNA puri-
atelypresentinginoldermen,themedian ageofpatients fied from 19 normal and 27 cancer samples to qPCR
was 64 (range 49 – 78). The RNase L genotype was using the XMRV specific primers and again found that
determined using purified DNA recovered from 70 all samples were negative (Table 2). For both the BMLV
formalin-fixed paraffin-embedded (FFPE) normal and and XMRV specific qPCR assays, no amplification was
cancer tissue from each of 35 patients. The RNase L observed in any of the 12 negative control wells while all
genotype of both samples from each patient was 100% positive control wells (containing 22Rv1 DNA) were
concordant and 8% of the patients were homozygous consistently positive. These data demonstrate that XMRV
Rezaeietal.VirologyJournal2013,10:20 Page3of9
http://www.virologyj.com/content/10/1/20
Table1PCRprimersandprobes
Target AmpliconSize Method PrimersandTaqManProbe(5’-3’)
HuVAMP21 78bp qPCR HuVAMP2-F CAGCATCTCTCCTACCCTTTCAC
HuVAMP2-R CCCCACACTTCTGGTTTTCTG
Huvamp2-Probe 6FAM-AGCAGGGATATCTAAGC-MGBNFQ2
BMLV3 76bp qPCR BMLV-F GCCTGTCCAGGATCTGAGAG
BMLV-R GAGGTTGTAAGGGTTGGGCA
BMLV-Probe 5FAM-AAGTCAACAAGCGGGTGGAAGABHQ4
XMRVIN5 70bp qPCR XMRVIN-F CGAGAGGCAGCCATGAAGG
XMRVIN-R GCGTATACGGGGTTGAGTCC
XMRVIN-Probe 6FAM-AGTTCTAGAAACCTCTACACTC-MGB
IAP6 71bp qPCR MIAP-F GCCGCGCCCACATT
MIAP-R CGCAGATTATTTGTTTACCACTTAGAA
MIAP-Probe 6FAM-CCGTTACAAGATGGTGCTGA-MGBNFQ
RNASEL 137bp PCR 462R-F GTGGAAAATGAGGAAGATGAATTTGCCAG
462Q-F GTGGAAAATGAGGAAGATGAATTTGCCAA
462-R ATTGGGGACTCACCTATTAAGATGTTTTG
1Humanvesicleassociatedmembraneprotein2.
2Minorgroupbinding(MGB)non-fluorescentquencher.
3PrimerscandetectbothXMRVandMLVsequences.
4Blackholequencher.
5Primers/probespecificallydetectconservedintegrasesequences.
6Mouseintracisternal-Aparticl.
orrelatedMLVwerenotdetectedinprostatetissuetested (data not shown). These data show that 23% (15/66) of
inthisstudy. patient samples were positive for low-level mouse DNA
contamination.
EvidenceofmouseDNAcontaminationinPCsamples
To determine whether patient samples were contami- Discussion
nated with mouse DNA we performed qPCR with pri- Using highly sensitive qPCR neither XMRV nor related
mers that detect the mouse IAP retrotransposon [28,29]. MLV were detected in any of the prostate tissue samples
The mouse genome contains approximately 1000 IAP inour Australian cohort.TheBMLV qPCR assay usedin
copies [30], thus detection of IAPs is a highly sensitive this study reproducibly detected as little as one copy of
method for assessing mouse DNA contamination. Evalu- XMRV or MoMLV DNA in a total of one μg of carrier
ation of the linear range and sensitivity of the qPCR IAP nucleic acid. While several studies have reportedly used
assay using purified Balb/c mouse gDNA showed that primers that simultaneously detect XMRV and related
the assay was highly sensitive, detecting 2 fg to 20 ng of MLV in PC samples [10,12,13,18,31], only one of these
mouse gDNA (Figure 2E). The BMLV qPCR assay studies reported a similar sensitivity of XMRV detection
detected from 20 fg to 20 ng of endogenous MLV [18] compared to this study. Also, in contrast to our
present in Balb/c gDNA (Figure 2F) indicating that this study, validation of the sensitivity of primers for detect-
assay was 10-fold less sensitive in detecting Balb/c ing other MLV such as MoMLV was not reported. The
gDNAthantheqPCRIAPassay. reverse transcriptase target of the BMLV qPCR assay is
We assessed mouse DNA contamination in gDNA highly conserved demonstrating 97-100% sequenceiden-
from FFPE patient samples in qPCR IAP assays and tity with preXMRV-1, preXMRV-2, Friend MLV, Friend
found that 5/33 and 10/33 of normal and cancer tissues, spleen focus-forming virus and Rauscher MLV indicat-
respectively were positive for mouse IAP (Table 2). The ing that our assay could potentially detect other MLV
levelofmouseDNAcontaminationvariedfrom2–20fg gammaretroviruses apart from XMRV and MoMLV.
Figure1GenomicorganizationofXMRVandMLVshowingthetargetsofbroadMLVforward(BMLV-F)andreverse(BMLV-R)primers
andtheXMRVspecificforward(XMRVIN-F)andreverse(XMRVIN-R)primers.
Rezaeietal.VirologyJournal2013,10:20 Page4of9
http://www.virologyj.com/content/10/1/20
A B
50
R2=0.999 50 R2=0.999
40
40
30
T 30
C T
C
20
20
10 10
0 0
100 101 102 103 104 105 106 107 100 101 102 103 104 105 106 107
Human VAMP2 (pHuVAMP2) copies XMRV pVP62 copies (BMLV primers)
C D
50
R2=0.999 50 R2=0.999
40
40
30
T 30
C T
C
20
20
10 10
0 0
100 101 102 103 104 105 106 107 100 101 102 103 104 105 106 107
pNCS copies (BMLV primers) XMRV pVP62 copies (XMRV primers)
E F
50 R2=0.999 50 R2=0.996
40 40
30 30
CT CT
20 20
10 10
0 0
10-15 10-14 10-13 10-12 10-11 10-10 10-9 10-8 10-7 10-14 10-13 10-12 10-11 10-10 10-9 10-8 10-7
Mouse DNA quantity (g) (IAP primers) Mouse DNA quantity (g) (BMLV primers)
Figure2LinearregressionanalysisdemonstratingthelinearrangeandsensitivityofqPCRassaysusedtodetecthumanVAMP2in
pHuVAMP2usingHuVAMP2primer/probes(A),XMRVinVP62usingBMLVprimers/probe(B),MoMLVinpNCSusingBMLVprimers/
probe(C),XMRVinVP62usingXMRV-INspecificprimers/probe(D),Balb/cDNAusingIAPprimers/probe(E)andBalb/cDNAusingthe
BMLVprimers/probe(F).PlasmidtargetsattheindicatedcopynumbersorBalb/cDNAattheamountsshownweresubjectedtoqPCRinthe
presenceof1μgoftRNAasthecarriernucleicacidandthelogarithmofthesevalueswereplottedagainstthethresholdcycle(CT)value.All
datapointswerederivedfromtriplicatewellsandtheerrorbarsdenotethestandarddeviation.Datashownarerepresentativeofthree
independentassaysexceptfordetectionofXMRVinVP62withXMRVINspecificprimers(D)andBalb/cDNAdetectionwiththeBMLVprimers/
probe(F),whichwereperformedonce.R2denotesthePearsoncorrelationcoefficient.
Thus the absence of XMRV or related MLV in PC tissue μm patient tissue slices that are likely to be a mixture of
samples in this study is consistent with previous findings both cancer and normal tissue [4]. Our strategy also
negatingarolefor these viruses inPC. enabled us to maximise the amount of cancer tissue
We obtained paired normal and cancer tissue from the recovered to increase the probability of detecting XMRV
same patient to determine whether there was a differ- or related MLV in samples. We were able to selectively
ence in prevalence of XMRV or related MLV in these obtain cancer and normal tissue by using histological
tissues to provide clues to their role in PC pathogenesis. staining of tissue slices to identify appropriate regions in
This is in contrast to previous studies that have used 10 the FFPE prostate tissue for obtaining the punch
Rezaeietal.VirologyJournal2013,10:20 Page5of9
http://www.virologyj.com/content/10/1/20
Table2AmplificationofXMRV,MLVsequencesand 2 fg of mouse gDNA. While we did not detect XMRV
mouseIAPsincancerandnormalprostatetissuebyqPCR or related MLV by qPCR in any of the patient sam-
Target ples, 15% of normal and 30% of cancer tissues were
PatientTissue BMLV1 XMRV MouseIAP positive for mouse IAP, which was reproducibility
Normal 0/332 0/193 5/332 observed in 2/3 independent assays in three samples and
3/3assaysin12samples.Thelevelofcontaminationwas
Cancer 0/332 0/273 10/332
low and in the range of 2 – 20 fg/μg of patient DNA,
1DetectionofbothXMRVandMLVsequences.
2qPCRperformedin3independentassays,exceptfor10/33cancerand16/33 which likely explainsthe failure todetect mouse DNA in
normalprostatetissue,whereqPCRwasperformedonce. these samples using the BMLV qPCR, which has a limit
3qPCRperformedonce. ofdetectionof20fg/μggDNA.
WhilemouseDNAcontaminationwasdetectedinseven
cancer samples in the IAP qPCR assay, no signal was
biopsies. In addition, we developed methods to purify observed in normal samples from the corresponding
DNA from FFPE tissue core biopsies suitable for down- patients.DuetothelimitedamountofgDNAwewereun-
stream qPCR analysis that may be valuable for other ableto test normal prostate tissue from one ofthese seven
studies requiring recovery of DNA for nucleic acid patients.Incontrast,bothnormalandcancersamplesfrom
detection. threepatientswerepositiveformouseDNAcontamination.
Previous studies have raised serious doubts regarding The greater number of mouse DNA positive samples in
the role of XMRV in PC and CFS. The first studies to cancer compared to normal tissue is unlikely due to
cast doubt on this association demonstrated that PCR increased processing of the former samples because the
reagents and nucleic acid purification columns were samples were all handled a similar number of times. In
contaminated with mouse DNA that harbours MLVs addition,itisunlikelythatPCRreagentsused inthisstudy
detected by highly sensitive PCR [20-24]. In addition, were contaminated with mouse DNA as none of the no
the specificity of putativeXMRV-specificprimers detect- template controls (12 wells per plate) or DU145 and
ing a 24-nucleotide gag-leader deletion was challenged LNCaPgDNA negative controls (3 wells of each per plate)
with the finding that these primers were able to amplify were positive for XMRV or related MLV in our qPCR
endogenous MLVsequences present in the gDNA of 12 assays. Furthermore, we avoided using a Taq polymerase
different mouse strains [25]. These studies advocated the thatreliesonamonoclonalantibodytoachievea“hotstart”
inclusionofsensitivecounterassaystodetectmouseDNA asthishaspreviouslybeenimplicatedasasourceofmouse
contamination to verify XMRV positive samples [13,28]. DNA contamination [22,23]. The DU145 and LNCaP
However, the remarkable nucleotide sequence identity of gDNA controls were also included to determine whether
XMRV from diverse patient samples remained a conun- there was mouse DNA contamination from DNA extrac-
drum since retroviral polymerases are error prone and tion columns [24]. While we did not observe any positive
therefore XMRV detected from distinct sources would be signals in these controls, the sporadic nature of this con-
expected to show greater sequence diversity. This finding tamination makes it difficult to exclude this possibility. In
pointedtoyetanothersourceofpatientsamplecontamin- addition, procedures were implemented to prevent cross
ation. Phylogenetic analysis of XMRV sequences from contaminationofsamplesduringtissuebiopsycollectionat
unlinked patients and a commonly used PC cell line TissuPath; however, the presence of mouse DNA during
(22Rv1)showed that thesesequencesformedamonophy- the original processing of the samples cannot be excluded.
letic clade and that the cell line-derived sequences were Therefore, the contamination observed is likely to be ran-
ancestraltothepatient-derivedsequences(posteriorprob- domandpossiblyduetotheDNAextractioncolumnsand/
ability >0.99). These findings led to the conclusion that or contamination during the original fixation and paraffin
XMRV contamination originated from the 22Rv1 cell embedding of the prostate tissue, microtome sectioning of
line [25,26]. Furthermore, the possibility that XMRV in samplesorpreparationofthepunchbiopsiesforthisstudy.
22Rv1cells originatedfromabonefidehumaninfection One potential limitation of our study is that we used
was debunked by Paprotka and colleagues who showed naked plasmid DNA for determining the analytical
that XMRV was a laboratory virus generated by a rare range of the qPCR assays used in this study while the
recombination event between two mouse endogenous samples were formalin-fixed DNA from tissue. This
retrovirusesduringpassageoftheCWR22PCxenograft may have led to possible overestimation of the sensitiv-
in nude mice from which the 22Rv1 cell line was ity of the assays. Regardless, our findings are consistent
derived[27]. with previous studies demonstrating no association be-
We used a previously published IAP qPCR assay [28], tweenXMRVandrelatedgammaretrovirusesinprostate
to detect mouse DNA contamination in samples, which cancer patients undertaken in regions geographically
in our hands achieved a similar detection sensitivity of distinctfromAustralia.
Rezaeietal.VirologyJournal2013,10:20 Page6of9
http://www.virologyj.com/content/10/1/20
The original premise for determining the RNASEL concluding that XMRVand related MLV positive signals
genotype of patients in our cohort was to establish if in patient samples are due to contamination and that
there was an association with the homozygous (QQ) there is no causal link between these gammaretroviruses
RNaseLvariantandXMRVorrelatedMLVs.TheRNase andPC.
L enzyme is an interferon-induced ribonuclease, which Added in proof: Following submission of our study a
has antiviral activity and can also induce apoptosis report by Lee and colleagues [40] demonstrated that
[32,33]. Men that are heterozygous or homozygous for archival RNA from prostate cancer samples used in the
the mutant form of the allele have 50% and greater than first study reporting an association between XMRV and
2-fold increased risk, respectively of PC than non- PC [2] was contaminated with XMRV originating from a
carriers [34]. Given the role of RNase L in antiviral XMRV-infected cell line which led to the retraction of
defense, it has been proposed that a viral infection may the original report in PLoS Pathogens. In addition, a
contribute to PC [2]. Since none of our samples were multicenter-blinded analysis headed by Ian Lipkin which
positive for XMRV or related MLVs, an association be- analyzed peripheral blood from well-characterized and
tween RNASEL mutation and infection with these geographically diverse populations of CFS and myalgic
viruses could not be investigated. Regardless, we suc- encephalomyelitis (MS) patients demonstrated no asso-
cessfully determined the RNASEL genotype for all DNA ciation witheitherXMRVorpolytropic MLV[41].
samples purified from FFPE cancer and normal prostate
tissue using a previously published allele specific PCR
Methods
assay [34]. The genotypes determined for cancer and
Studypopulationandspecimens
normal prostate tissue from the same patient, which
Prostate samples used in this study were archival FFPE
were performed blinded, were 100% concordant. To our
tissue obtained from patients in the greater Melbourne
knowledge this is the first time that the RNASEL geno-
area who had radical prostatectomies performed with
type of Australian PC patients has beendetermined. The
tissues submitted to TissuPath Specialist Pathology
overall allele distribution in our small cohort appears to
(Mount Waverley, Victoria, Australia) for diagnostic
be similar to non-hereditary PC cases observed in the
pathology between 2007 and 2011. For this study, the
USA where the heterozygous (RQ) allele has the greatest
samples were prepared by TissuPath scientists from nor-
prevalence (~47%) and the homozygous (QQ) allele the
mal and cancer affected regions of the prostate, guided
lowest prevalence (9.9 – 15.2%) [4,35]. Further studies
by the associated haematoxylin and eosin (H&E) stained
with a larger cohort would be of interest to determine
tissue sections which had been evaluated by light micros-
whether the RNASEL allele distribution in Australian PC
copy. Samples were received as 2–3 FFPE punch biopsies
patients are distinct to normal men in the same geo-
of2mm×2mm(diameter×depth).Specimens,codedto
graphical region, if there are racial differences, and
mask whether they were normal or cancer tissue and to
whether there is an association of this allele with disease
maintain patient confidentiality, were provided to investi-
severity.
gators at the Burnet Institute. Samples were unblinded
following completion of the assays at which time the age
Conclusions
and Gleason scores for each patient was provided. The
The Blood XMRV Scientific Working Group’s findings,
study was approved by the Alfred Health Human Ethics
along with the discovery that XMRV is avirus generated
Committee(ProjectNumber32/11).
by a rare recombination event in the laboratory has pro-
vided irrefutable evidence that XMRV or related MLV
are not associated with CFS [27,36,37]. These reports Celllines
have lead to the retraction of the original study describ- Thehumanprostatecarcinomacellline22Rv1[42]andthe
ing the association of XMRV with CFS [6,38]. In human embryonic lung fibroblast cell line MRC-5 [43],
addition, a separate study has confirmed that XMRV or wereobtainedfromtheAmericanTypeCultureCollection
closely related viruses were not present in the primary (ATCC, Manassas, VA, USA). Human prostate carcinoma
tissues from which the XMRV-infected cell line 22Rv1 cell lines, DU145 [44] and LNCaP [45] were provided by
was derived [31]. Furthermore, strong evidence for Renee Taylor and Gail Risbridger (Monash University,
XMRV infection of human cells in the prostate as Clayton, Australia). Human peripheral blood mononuclear
demonstrated by XMRV DNA joined to human DNA cells (PBMCs) were isolated from donor buffy coat packs
sequences has been found to be due to DNA contamin- (fromdonorsscreenedfortheabsenceof bloodpathogens)
ation from XMRV infected DU145 PC cells used in the obtained from the Australian Red Cross (Melbourne,
™
same laboratory [26,39]. The absence of XMRV and Australia) and purified by Ficoll-Paque PLUS centrifuga-
related MLV in Australian PC patients using a highly tionaccordingtomanufacturer’sinstructions(GEHealthcare,
sensitive pPCR assay is consistent with previous reports Uppsala,Sweden).
Rezaeietal.VirologyJournal2013,10:20 Page7of9
http://www.virologyj.com/content/10/1/20
Plasmids detect either the wild-type R462 (462R-F) or the mutant
The plasmid, pVP62, encodes the full length molecular R462Q (462Q-F) allele, while the reverse primer (462-R)
cloneofXMRVinsertedinthemammalianexpressionvec- detects both alleles (Table 1). Each assay included control
tor pcDNA3.1(−) and was obtained from the NIH AIDS DNA from DU145, LNCaP and 22Rv1 PC cell lines that
Research & Reference Reagent Program [2]. pNCS, a gift have the RQ, RR and QQ RNase L genotypes, respectively
fromStephenGoff(ColumbiaUniversity,NewYork,USA) and 20 ng of gDNA from FFPE samples, and was per-
encodesthefulllengthmolecularcloneofMoMLVandisa formedinthreeindependentassays.
derivative of pNCA carrying an SV40 origin of replication
in the plasmid backbone [46]. pHuVAMP2, harbouring the
Humanvesicle-associatedmembraneprotein2
human vesicle-associated membrane protein 2 (VAMP2)
(HuVAMP2)qPCR
gene,wasgeneratedbyPCRamplificationfromgDNApuri-
To verify the quality of gDNA purified from FFPE tissue
fied from DU145 cells using HuVAMP2-Fand HuVAMP2-
and to rule out the presence of PCR inhibitors, patient
R primers (Table 1). The 78 bp amplicon was cloned into
samples were subjected to a qPCR assay targeting the
theTOPOTAvectoraccordingtomanufacturer’sinstruc-
humanVAMP2geneasdescribedpreviously[28].Quanti-
tions (Invitrogen, Carlsbad, CA, USA) and the identity of
tative standards of pHuVAMP2 was prepared as 10-fold
thecloneverifiedbynucleotidesequencing. serialdilutionsfrom107to100copiesinthepresenceof1
μg Saccharomyces cerevisiae transfer RNA (tRNA) carrier
Laboratorytechniquestopreventsamplecontamination
nucleic acid per reaction (Sigma-Aldrich). PCR was per-
To avoid cross contamination each tissue sample was formed using 10 μl of diluted pHuVAMP2 containing the
obtained using a separate sterile 2 mm punch biopsy. To required plasmid copy numbers or 1 μg of sample gDNA
minimize the exposure of patient samples to potential inafinalvolumeof25μl.Thresholdcycle(Ct)valuesthat
sourcesofmouse,XMRVandMLVDNA,standardlabora- were not within the average Ct±SD (8.9×105±5.4×105
tory procedures for sterile DNA extraction were practiced copies/μg) for gDNA from 22Rv1, LNCaP, DU145 and
whenhandlingandprocessingspecimensforpurificationof
human PBMCs were considered unsuitable for further
gDNAandPCR.Thesemeasuresincludedtheuseofsterile
analysisbyqPCR.
UV irradiated microcentrifuge tubes, filter-barrier pipette
tips and dedicated micropipettes. All tissue processing was
qPCRdetectionofXMRVandMLVusingbroadMLV
performed in a biosafety class II cabinet and equipment
wasexposedtoUVlightfor15–20minpriortouse. (BMLV)andXMRVspecificprimers/probe
To detect XMRV and related MLV sequences we used
primers (BMLV-F and BMLV-R) and the TaqMan probe
GenomicDNApurificationfromFFPEprostatetissueand
(BMLV-Probe)targetingconservedregionsinthereverse
celllines
transcriptaseregionofXMRVandMoMLVpol(Figure1)
gDNA was purified from FFPE patient tissue using the
W (Table 1) [47]. These BMLV primers/probe also have 97-
QIAamp DNAFFPETissueKitandtheQIAGENDepar-
100% nucleotide sequence homology to Friend MLV,
afinisation solution (DPS, QIAGEN, Hilden, Germany).
Rauscher MLV, Friend spleen focus forming virus,
SincetheQIAampkitrecommendsextractinggDNAfrom
tissuesectionsof10μminthickness,weintroducedmodi- preXMRV-1 and preXMRV-2. In addition, we also used
the XMRV specific primers (XMRVIN-F, XMRVIN-R)
fications to optimise DNA recovery from the thicker core
and probe (XMRVIN-Probe) (Table 1), which target the
biopsies used in this study. These modifications included
integrase region of XMRV (Figure 1) as published previ-
trimmingexcessparaffinfromthecorebiopsies,dissecting
ously [28]. Quantitative standards of XMRV (pVP62)
the tissues into a maximum of five pieces prior to the
and MoMLV (pNCS) were prepared by subjecting plas-
addition of DPS, and an overnight incubation of tissues
mids to serial dilutions from 107 to 100 copies and 106
withproteinaseK.gDNAwasextractedfrom atotal of 70
to 100 copies, respectively. PCR was performed as pub-
prostate tissue punch biopsies. gDNA was purified from
lished [47] using the required copies of plasmid DNA
DU145, LNCaP, MRC-5, 22Rv1 cells and PBMCs using
(inthepresenceof1μgofcarriertRNA)or1μgofsam-
theDNeasyBloodandTissueKit(QIAGEN)accordingto
manufacturer’sinstructions. ple gDNAinafinal volume of25μl.
Amplificationrefractorymutationsystem(ARMS)to qPCRdetectionofmouseIAP
detectRNaseLR462Qpolymorphisms qPCR for mouse IAP sequences was used as a marker of
TheRNaseLR462Qpolymorphisminpatientsampleswas mouseDNAcontaminationaspreviouslydescribed(Table1)
determined using the ARMS assay as previously published [28]. Serial dilutions (2 fg to 200 ng) of Balb/c gDNA
[34]. ARMS is an allele specific PCR assay that uses two (Sigma) were used as quantitative standards. PCR reac-
forward primers with different 3’-termini to specifically tions included the required amounts of standard Balb/c
Rezaeietal.VirologyJournal2013,10:20 Page8of9
http://www.virologyj.com/content/10/1/20
DNA (in the presence of1 μg of carriertRNA) or 1 μg of 3. ArnoldRS,MakarovaNV,OsunkoyaAO,SuppiahS,ScottTA,JohnsonNA,
samplegDNAinafinalvolumeof25μl. BhosleSM,LiottaD,HunterE,MarshallFF,LyH,MolinaroRJ,BlackwellJL,
PetrosJA:XMRVinfectioninpatientswithprostatecancer:novelserologic
assayandcorrelationwithPCRandFISH.Urology2010,75:755–761.
InterpretationofqPCRsignalsdetectedinpatientsamples 4. SchlabergR,ChoeDJ,BrownKR,ThakerHM,SinghIR:XMRVispresentin
malignantprostaticepitheliumandisassociatedwithprostatecancer,
For detection of XMRV/MLV or mouse DNA contamin-
especiallyhigh-gradetumors.ProcNatlAcadSciUSA2009,106:16351–16356.
ation, signals that were greater than two standard devia-
5. DanielsonBP,AyalaGE,KimataJT:Detectionofxenotropicmurineleukemia
tions (SD) from the average Ct of the lowest standard virus-relatedvirusinnormalandtumortissueofpatientsfromthe
tested(i.e.,1copyofplasmidor2fgofmouseDNA)were southernUnitedStateswithprostatecancerisdependentonspecific
polymerasechainreactionconditions.JInfectDis2010,202:1470–1477.
considered negative. Samples where a signal was detected
6. LombardiVC,RuscettiFW,DasGuptaJ,PfostMA,HagenKS,PetersonDL,
within the linear range of the assay and in the majority of RuscettiSK,BagniRK,Petrow-SadowskiC,GoldB,DeanM,SilvermanRH,
independentassaysperformed,wereconsideredpositive. MikovitsJA:Detectionofaninfectiousretrovirus,XMRV,inbloodcellsof
patientswithchronicfatiguesyndrome.Science2009,326:585–589.
7. SfanosKS,SauvageotJ,FedorHL,DickJD,DeMarzoAM,IsaacsWB:A
Abbreviations
molecularanalysisofprokaryoticandviralDNAsequencesinprostate
XMRV:Xenotropicmurineleukemiavirus-relatedvirusXMRV;PC:Prostate
tissuefrompatientswithprostatecancerindicatesthepresenceof
cancer;CFS:Chronicfatiguesyndrome;gDNA:GenomicDNA; multipleanddiversemicroorganisms.Prostate2008,68:306–320.
FFPE:Formalin-fixedparaffin-embedded;RNaseL:RibonucleaseL; 8. D’ArcyF,FoleyR,PerryA,MarignolL,LawlerM,GaffneyE,WatsonRGW,
MLV:Murineleukemiavirus;qPCR:QuantitativePCR;X-MLV:Xenotropic-MLV;
FitzpatrickJM,LynchTH:NoevidenceofXMRVinIrishprostatecancer
IAP:IntracisternalA-typeparticle;PBMCs:Peripheralbloodmononuclearcells;
patientswiththeR462Qmutation.EurUrolSuppl2008,7:271.
VAMP2:Humanvesicle-associatedmembraneprotein2;
9. FischerN,HellwinkelO,SchulzC,ChunFK,HulandH,AepfelbacherM,
DPS:Deparafinisationsolution;ARMS:Amplificationrefractorymutation
SchlommT:PrevalenceofhumangammaretrovirusXMRVinsporadic
system;Ct:Thresholdcycle;tRNA:TransferRNA;SD:Standarddeviation; prostatecancer.JClinVirol2008,43:277–283.
MoMLV:Moloneymurineleukemiavirus;BMLV:BroadMLV.
10. HohnO,KrauseH,BarbarottoP,NiederstadtL,BeimfordeN,DennerJ,Miller
K,KurthR,BannertN:Lackofevidenceforxenotropicmurineleukemia
Competinginterests virus-relatedvirus(XMRV)inGermanprostatecancerpatients.
Theauthorsdeclarethattheyhavenocompetinginterests. Retrovirology2009,6:92.
11. SakumaT,HueS,SquillaceKA,TonneJM,BlackburnPR,OhmineS,Thatava
Authors’contributions T,TowersGJ,IkedaY:NoevidenceofXMRVinprostatecancercohortsin
TheprojectwasconceivedandfundingobtainedbyGT.Projectprotocol theMidwesternUnitedStates.Retrovirology2011,8:23.
andethicswaspreparedbyGTandACH.TissuewassuppliedbyJPandJM. 12. AloiaAL,SfanosKS,IsaacsWB,ZhengQ,MaldarelliF,DeMarzoAM,ReinA:
ExperimentswereperformedbySDR.DataanalysiswasperformedbySDR XMRV:anewvirusinprostatecancer?CancerRes2010,70:10028–10033.
andACH.StatisticalanalysiswasperformedbyGT.Themanuscriptwas 13. SwitzerWM,JiaH,ZhengH,TangS,HeneineW:Noassociationof
draftedbyGTandSDRandallauthorswereinvolvedincriticalrevisionof xenotropicmurineleukemiavirus-relatedviruseswithprostatecancer.
themanuscriptandapproveditforsubmission. PLoSOne2011,6:e19065.
14. Martinez-FierroML,LeachRJ,Gomez-GuerraLS,Garza-GuajardoR,Johnson-
Acknowledgements PaisT,BeutenJ,Morales-RodriguezIB,Hernandez-OrdonezMA,Calderon-
WethankJennyLAndersoncontributingtomethodsdevelopment,Renee CardenasG,Ortiz-LopezR,Rivas-EstillaAM,Ancer-RodriguezJ,Rojas-
TaylorandGailRisbridgerforprovidingtheLNCaPcellline,StephenGofffor MartinezA:Identificationofviralinfectionsintheprostateand
pNCSandtheNIHAIDSResearch&ReferenceReagentProgramfor evaluationoftheirassociationwithcancer.BMCCancer2010,10:326.
providingpVP62.ThisstudywasfundedthroughtheResearchProgramof 15. VerhaeghGW,deJongAS,SmitFP,JanninkSA,MelchersWJ,SchalkenJA:
ProstateCancerFoundationofAustralia(PCFA)CG0710grantawardedtoGT. Prevalenceofhumanxenotropicmurineleukemiavirus-related
GTwassupportedbytheNationalHealthandMedicalResearchCouncilof gammaretrovirus(XMRV)inDutchprostatecancerpatients.Prostate
Australia(NHMRC)SeniorResearchFellowship543105.Theauthorsgratefully 2011,71:415–420.
acknowledgethecontributiontothisworkoftheVictorianOperational 16. FurutaRA,MiyazawaT,SugiyamaT,KuratsuneH,IkedaY,SatoE,MisawaN,
InfrastructureSupportProgramreceivedbytheBurnetInstitute.Thefunders NakatomiY,SakumaR,YasuiK,YamagutiK,HirayamaF:Noassociationof
hadnoroleinstudydesign,datacollectionandanalysis,decisiontopublish, xenotropicmurineleukemiavirus-relatedviruswithprostatecanceror
orpreparationofthemanuscript.Theresultsandtheconclusionsofthis chronicfatiguesyndromeinJapan.Retrovirology2011,8:20.
reportarethoseoftheauthors. 17. StielerK,SchindlerS,SchlommT,HohnO,BannertN,SimonR,MinnerS,
SchindlerM,FischerN:NodetectionofXMRVinbloodsamplesand
Authordetails tissuesectionsfromprostatecancerpatientsinNorthernEurope.PLoS
1RetroviralBiologyandAntiviralsLaboratory,CentreforVirology,Burnet One2011,6:e25592.
Institute,85CommercialRoad,Melbourne,Victoria3004,Australia. 18. RobinsonMJ,TukePW,ErlweinO,TettmarKI,KayeS,NareshKN,PatelA,
2DepartmentofMicrobiology,MonashUniversity,Clayton,Victoria3168, WalkerMM,KimuraT,GopalakrishnanG,TedderRS,McClureMO:No
Australia.3DepartmentofMedicine,MonashUniversity,Melbourne,Victoria EvidenceofXMRVorMuLVsequencesinprostatecancer,diffuselarge
3004,Australia.4TissuPath,SpecialistPathology,MountWaverley,Victoria B-celllymphoma,ortheUKblooddonorpopulation.AdvVirol2011,
3149,Australia. 2011:782353.
19. MendozaR,SilvermanRH,KleinEA,MillerAD:NoBiologicalEvidenceof
Received:27July2012Accepted:3January2013 XMRVinBloodorProstaticFluidfromProstateCancerPatients.PLoSOne
Published:10January2013 2012,7:e36073.
20. OakesB,TaiAK,CingozO,HenefieldMH,LevineS,CoffinJM,HuberBT:
References ContaminationofhumanDNAsampleswithmouseDNAcanleadto
1. SilvermanRH,NguyenC,WeightCJ,KleinEA:ThehumanretrovirusXMRV falsedetectionofXMRV-likesequences.Retrovirology2010,7:109.
inprostatecancerandchronicfatiguesyndrome.NatRevUrol2010, 21. RobinsonMJ,ErlweinOW,KayeS,WeberJ,CingozO,PatelA,WalkerMM,
7:392–402. KimWJ,UiprasertkulM,CoffinJM,McClureMO:MouseDNA
2. UrismanA,MolinaroRJ,FischerN,PlummerSJ,CaseyG,KleinEA,MalathiK, contaminationinhumantissuetestedforXMRV.Retrovirology2010,7:108.
Magi-GalluzziC,TubbsRR,GanemD,SilvermanRH,DeRisiRL:Identification 22. SatoE,FurutaRA,MiyazawaT:Anendogenousmurineleukemiaviral
ofanovelGammaretrovirusinprostatetumorsofpatientshomozygous genomecontaminantinacommercialRT-PCRkitisamplifiedusing
forR462QRNASELvariant.PLoSPathog2006,2:e25. standardprimersforXMRV.Retrovirology2010,7:110.
Rezaeietal.VirologyJournal2013,10:20 Page9of9
http://www.virologyj.com/content/10/1/20
23. TukePW,TettmarKI,TamuriA,StoyeJP,TedderRS:PCRmastermixes 42. SramkoskiRM,PretlowTG2nd,GiaconiaJM,PretlowTP,SchwartzS,SyMS,
harbourmurineDNAsequences.Caveatemptor!PLoSOne2011, MarengoSR,RhimJS,ZhangD,JacobbergerJW:Anewhumanprostate
6:e19953. carcinomacellline,22Rv1.VitroCellDevBiolAnim1999,35:403–409.
24. ErlweinO,RobinsonMJ,DustanS,WeberJ,KayeS,McClureMO:DNA 43. JacobsJP,JonesCM,BailleJP:Characteristicsofahumandiploidcell
extractioncolumnscontaminatedwithmurinesequences.PLoSOne designatedMRC-5.Nature1970,227:168–170.
2011,6:e23484. 44. StoneKR,MickeyDD,WunderliH,MickeyGH,PaulsonDF:Isolationofa
25. HueS,GrayER,GallA,KatzourakisA,TanCP,HouldcroftCJ,McLarenS, humanprostatecarcinomacellline(DU145).IntJCancer1978,
PillayD,FutrealA,GarsonJA,PybusOG,KellamP,TowersGJ:Disease- 21:274–281.
associatedXMRVsequencesareconsistentwithlaboratory 45. HoroszewiczJS,LeongSS,KawinskiE,KarrJP,RosenthalH,ChuTM,Mirand
contamination.Retrovirology2010,7:111. EA,MurphyGP:LNCaPmodelofhumanprostaticcarcinoma.CancerRes
26. GarsonJA,KellamP,TowersGJ:AnalysisofXMRVintegrationsitesfrom 1983,43:1809–1818.
humanprostatecancertissuessuggestsPCRcontaminationratherthan 46. ColicelliJ,GoffSP:Sequenceandspacingrequirementsofaretrovirus
genuinehumaninfection.Retrovirology2011,8:13. integrationsite.JMolBiol1988,199:47–59.
27. PaprotkaT,Delviks-FrankenberryKA,CingozO,MartinezA,KungHJ,Tepper 47. ZhangYA,MaitraA,HsiehJT,RudinCM,PeacockCD,KarikariC,BrekkenRA,
CG,HuWS,FivashMJJr,CoffinJM,PathakVK:Recombinantoriginofthe StastnyV,GaoB,GirardL,WistubaI,FrenkelE,MinnaJD,GazdarAF:
retrovirusXMRV.Science2011,333:97–101. Frequentdetectionofinfectiousxenotropicmurineleukemiavirus
28. ShinCH,BatemanL,SchlabergR,BunkerAM,LeonardCJ,HughenRW, (XMLV)inhumanculturesestablishedfrommousexenografts.Cancer
LightAR,LightKC,SinghIR:AbsenceofXMRVretrovirusandother BiolTher2011,12:617–628.
murineleukemiavirus-relatedvirusesinpatientswithchronicfatigue
syndrome.JVirol2011,85:7195–7202. doi:10.1186/1743-422X-10-20
29. OakesB,QiuX,LevineS,HackettJJr,HuberBT:FailuretoDetectXMRV- Citethisarticleas:Rezaeietal.:NoassociationbetweenXMRVor
SpecificAntibodiesinthePlasmaofCFSPatientsUsingHighlySensitive relatedgammaretrovirusesinAustralianprostatecancerpatients.
ChemiluminescenceImmunoassays.AdvVirol2011,2011:854540. VirologyJournal201310:20.
30. DupressoirA,HeidmannT:ExpressionofintracisternalA-particle
retrotransposonsinprimarytumorsofoncogene-expressingtransgenic
mice.Oncogene1997,14:2951–2958.
31. DasGuptaJ,LukKC,TangN,GaughanC,KleinEA,KandelES,HackettJJr,
SilvermanRH:AbsenceofXMRVandcloselyrelatedvirusesinprimary
prostatecancertissuesusedtoderivetheXMRV-infectedcellline22Rv1.
PLoSOne2012,7:e36072.
32. Diaz-GuerraM,RivasC,EstebanM:ActivationoftheIFN-inducibleenzyme
RNaseLcausesapoptosisofanimalcells.Virology1997,236:354–363.
33. CastelliJC,HasselBA,WoodKA,LiXL,AmemiyaK,DalakasMC,TorrencePF,
YouleRJ:Astudyoftheinterferonantiviralmechanism:apoptosis
activationbythe2-5Asystem.JExpMed1997,186:967–972.
34. CaseyG,NevillePJ,PlummerSJ,XiangY,KrumroyLM,KleinEA,Catalona
WJ,NupponenN,CarptenJD,TrentJM,SilvermanRH,WitteJS:RNASEL
Arg462Glnvariantisimplicatedinupto13%ofprostatecancercases.
NatGenet2002,32:581–583.
35. WangL,McDonnellSK,ElkinsDA,SlagerSL,ChristensenE,MarksAF,
CunninghamJM,PetersonBJ,JacobsenSJ,CerhanJR,BluteML,SchaidDJ,
ThibodeauSN:AnalysisoftheRNASELgeneinfamilialandsporadic
prostatecancer.AmJHumGenet2002,71:116–123.
36. SimmonsG,GlynnSA,HolmbergJA,CoffinJM,HewlettIK,LoSC,Mikovits
JA,SwitzerWM,LinnenJM,BuschMP:Thebloodxenotropicmurine
leukemiavirus-relatedvirusscientificresearchworkinggroup:mission,
progress,andplans.Transfusion2011,51:643–653.
37. SimmonsG,GlynnSA,KomaroffAL,MikovitsJA,ToblerLH,HackettJJr,
TangN,SwitzerWM,HeneineW,HewlettIK,ZhaoJ,LoSC,AlterHJ,Linnen
JM,GaoK,CoffinJM,KearneyMF,RuscettiFW,PfostMA,BethelJ,Kleinman
S,HolmbergJA,BuschMP:FailuretoconfirmXMRV/MLVsinthebloodof
patientswithchronicfatiguesyndrome:amulti-laboratorystudy.Science
2011,334:814–817.
38. AlbertsB:Retraction.Science2011,334:1636.
39. DongB,KimS,HongS,DasGuptaJ,MalathiK,KleinEA,GanemD,DerisiJL,
ChowSA,SilvermanRH:AninfectiousretrovirussusceptibletoanIFN
antiviralpathwayfromhumanprostatetumors.ProcNatlAcadSciUSA
2007,104:1655–1660. Submit your next manuscript to BioMed Central
40. LeeD,DasGuptaJ,GaughanC,SteffenI,TangN,LukKC,QiuX,UrismanA, and take full advantage of:
FischerN,MolinaroR,BrozM,SchochetmanG,KleinEA,GanemD,DerisiJL,
SimmonsG,HacketJ,SilvermanRH,ChiuCY:In-DepthInvestigationof
• Convenient online submission
ArchivalandProspectivelyCollectedSamplesRevealsNoEvidencefor
XMRVInfectioninProstateCancer.PLoSOne2012,7:e44954. • Thorough peer review
41. AlterHJ,MikovitsJA,SwitzerWM,RuscettiFW,LoSC,KlimasN,KomaroffAL,
• No space constraints or color figure charges
MontoyaJG,BatemanL,LevineS,PetersonD,LevinB,HansonMR,GenfiA,
BhatM,ZhengH,WangR,LiB,HungGC,LeeLL,SameroffS,HeneineW, • Immediate publication on acceptance
CoffinJ,HornigM,LipkinWI:Amulticenterblindedanalysisindicatesno • Inclusion in PubMed, CAS, Scopus and Google Scholar
associationbetweenchronicfatiguesyndrome/myalgic
• Research which is freely available for redistribution
encephalomyelitisandeitherxenotropicmurineleukemiavirus-related
virusorpolytropicmurineleukemiavirus.MBio2012,3:e00266–12.
Submit your manuscript at
www.biomedcentral.com/submit