Table Of ContentAnim. Syst. Evol. Divers. Vol. 37, No. 2: 129-134, April 2021
https://doi.org/10.5635/ASED.2021.37.2.004
Short communication
New Records of Two Dorylaimoides Species
(Nematoda: Dorylaimida: Mydonomidae) from Korea
Taeho Kim1, Jiyeon Kim2, Joong-Ki Park3,*
1Department of Ecology and Conservation, National Marine Biodiversity Institute of Korea,
Seocheon 33662, Korea
2Animal & Plant Research Department, Nakdonggang National Institute of Biological Resources,
Sangju 37242, Korea
3Division of EcoScience, Ewha Womans University, Seoul 03760, Korea
ABSTRACT
The genus Dorylaimoides Thorne and Swanger, 1936 comprises over 70 species and predominantly inhabits soil;
however, some species are found in semiaquatic or aquatic habitats. In this study, D. elegans (de Man, 1880) Thorne
and Swanger, 1936 and D. limnophilus (de Man, 1880) Loof, 1964, collected from sediments in the Hangang River,
are reported for the first time in Korea. These two Dorylaimoides species are distinguished from other Dorylaimoides
species by their morphological characteristics: a didelphicamphidelphic reproductive system, short tail, and digitate
terminus in D. elegans and a monoopisthodelphic reproductive system and long tail in D. limnophilus. Here, we
provide detailed information on the morphological characteristic (description and illustration) and morphometrics of
the two Dorylaimoides species, using optical microscopy. Additionally, 18S rDNA sequences of the two species from
the Korean isolates are provided as molecular evidence.
Keywords: Nematode, Dorylaimida, Dorylaimoides elegans, Dorylaimoides limnophilus, new record, fresh
water, Korea
INTRODUCTION Each specimen was transferred to 2 mL of water, to which 4
mL of 80°C triethanolamineformalin (TAF, 2% triethanol
The genus Dorylaimoides Thorne and Swanger, 1936 belongs amine and 7% formaldehyde) solution was added for fixation.
to the family Mydonomidae Thorne, 1964. To date, the genus Fixed nematodes were dehydrated using glycerin (Seinhorst,
comprises over 70 species; however, only three species have 1959) and mounted on hydroglyceric slides (Shirayama et al.,
previously been reported in Korea: D. leptus Husain and Khan, 1993). Under an Imager A2 optical microscope, with differ
1968; D. micoletzkyi (de Man, 1921) Thorne and Swanger, ential interference contrast, equipped with an Axiocam 506
1936; D. punctatus Khan and Park, 1999 (de Man, 1921; Hu color camera, morphological and morphometric characters of
sain and Khan, 1968; Khan and Park, 1999). In this study, we the specimens were observed and measured from digital photo
report D. elegans (de Man, 1880) Thorne and Swanger, 1936 graphs using the Axiovision SE64 Rel. 4.9.1 software (Zeiss,
and D. limnophilus (de Man, 1880) Loof, 1964 collected from Oberkochen, Germany).
Korea for the first time and provide detailed descriptions Total genomic DNA was extracted using a nematode lysis
of their morphological characters, morphometrics, and 18S buffer (Holterman et al., 2006) consisting of 0.2 M NaCl,
rDNA sequences. 0.2 M TrisHCl (pH 8.0), 1% (v/v) β-mercaptoethanol, and
Live specimens were collected from freshwater and sedi 800 μg/mL proteinase-K. DNA was stored at -20°C if not
ment samples (Wangdaeri, Neungseomyeon, Yeojusi, used immediately. The 18S rDNA gene primer sets used in this
Gyeonggido, Korea [GPS coordinates: 37°19′43.82″N, 127° study were 988F (5′CTCAAAGATTAAGCCATGC3′)/
36′15.40″E]) from the Hangang River and then isolated by 1096R (5′GGTAATTCTGGAGCTAATAC3′)/1912R
sieving and the Baermann funnel method (Baermann, 1917). (5′TTTACGGTCAGAACTAGGG3′), 1813F (5′CTGC
This is an Open Access article distributed under the terms of the Creative *To whom correspondence should be addressed
Commons Attribution NonCommercial License (http://creativecommons.org/ Tel: 82-2-3277-5948, Fax: 82-2-3277-2385
licenses/bync/3.0/) which permits unrestricted noncommercial use, distribution, E-mail: [email protected]
and reproduction in any medium, provided the original work is properly cited.
eISSN 2234-8190 Copyright The Korean Society of Systematic Zoology
Taeho Kim, Jiyeon Kim, Joong-Ki Park
A B C D
E
A
B, D, E
C
Fig. 1. Dorylaimoides elegans (de Man, 1880) Thorne and Swang er, 1936. A, Entire female; B, Female neck region; C, Female repro-
ductive system; D, Female posterior region; E, Male posterior region. Scale bars: A-E 100 µm.
=
GTGAGAGGTGAAAT3′)/2646R (5′GCTACCTTGTTAC sequences of available congeneric nematode species using
GACTTTT3′) (Holterman et al., 2006). PCR (50 μL) was Clustal X with default options (Thompson et al., 1997).
performed using 2 μL template DNA, 10 pmol of each primer,
10 Ex Taq buffer, 0.2 mM dNTP mixture, and 1.25 U of SYSTEMATIC ACCOUNTS
TaKaRa Ex Taq polymerase (TaKaRa, OtsuShiga, Japan). The
×
conditions were as follows: initial denaturation at 95°C for Order Dorylaimida Pearse, 1942
1 min, 40 cycles of denaturation at 95°C for 30 s, annealing Superfamily Tylencholaimoidea Filipjev, 1934
at 50°C for 30 s, extension at 72°C for 1 min, and final ext- Family Mydonomidae Thorne, 1964
ension at 72°C for 10 min. PCR products were purified with Genus Dorylaimoides Thorne and Swanger, 1936
a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany)
and then sequenced using a 3730xl DNA Analyzer (Thermo 1*Dorylaimoides elegans (de Man, 1880)
Fisher Scientific, Waltham, MA, USA). The resulting 18S Thorne and Swanger, 1936 (Table 1, Fig. 1)
rDNA sequences were deposited in GenBank. Sequence analy Dorylaimus elegans de Man, 1880: 86.
ses were performed using Geneious v11.0.5 (Biomatters, Dorylaimoides elegans: Thorne and Swanger, 1936: 129-130,
Auckland, New Zealand) (Kearse et al., 2012) and aligned with Pl. XXIX, fig. 174.
Korean name: 1*예쁜창선충 (신칭)
130 Anim. Syst. Evol. Divers. 37(2), 129134
Two Dorylaimoides Species from Korea
Table 1. Morphometrics of Dorylaimoides elegans and D. limnophilus
D. elegans D. limnophilus
Character
♀, n 1 ♂, n 1 ♀, n 3
L 1,318=.2 1,241=.2 1,207.3±154.0 (1=,037.8-1,338.8)
Body width 36.6 35.5 32.3±3.8 (28.6-36.1)
Pharynx length 192.7 209.1 209.1±16.4 (192.7-225.6)
Tail length 42.0 32.6 126.9±20.3 (105.0-145.1)
Anal body diameter 25.3 25.1 19.5±2.5 (16.8-21.6)
a 36.1 35.0 37.4±1.3 (36.4-38.8)
b 6.8 5.9 5.8±0.3 (5.4-6.0)
c 31.4 38.1 9.5±0.3 (9.2-9.9)
c′ 1.7 1.3 6.5±0.2 (6.3-6.7)
V 45.6 - 31.0±0.9 (29.9-31.5)
Lip region diameter 9.2 8.2 8.2±0.2 (8.0-8.3)
Lip region height 4.1 3.9 3.4±0.4 (3.0-3.8)
Amphid aperture 6.7 6.0 6.0±0.1 (6.0-6.1)
Odontostyle (ventral side) 7.7 7.6 5.7±0.3 (5.4-6.0)
Odontophore 15.8 14.9 15.8±0.5 (15.2-16.2)
Pharyngeal bulb length 63.7 58.6 65.2±2.8 (62.5-68.0)
Cardia diameter 7.3 7.1 12.0±1.0 (11.1-13.0)
Cardia length 7.5 7.6 8.1±0.7 (7.5-8.8)
Guiding ring from anterior end 8.1 8.0 6.3±0.2 (6.1-6.5)
Nerve ring from anterior end 105.4 96.2 99.3±4.4 (94.8-103.5)
Nerve ring (% pharynx) 54.7 46.0 47.6±1.7 (45.9-49.2)
Vulva from anterior end 601.7 - 375.0±57.4 (311.1-422.2)
Vulva to anus 674.5 - 705.5±76.4 (621.7-771.5)
Vulva to anus/tail length 16.1 - 5.6±0.3 (5.3-5.9)
Vagina diameter 18.3 - 14.5±1.7 (13.0-16.4)
Vagina length 20.9 - 15.3±1.6 (13.9-17.0)
Vagina/body diameter 0.6 - 0.5
Reproductive tract length (G1) 185.1 - -
Reproductive tract length (G2) 207.5 - 210.7±58.0 (147.9-262.1)
G1 (%) 14.0 - -
G2 (%) 15.7 - 17.2±2.7 (14.3-19.6)
Spicules - 37.1 -
Spicules/anal body diameter - 1.5 -
Spicules/tail length - 1.2 -
Ventromedian supplements - 5.0 -
Rectum 33.2 32.2 22.6±2.2 (20.6-25.0)
Rectum/anal body diameter 1.3 1.3 1.2±0.1 (1.1-1.2)
All measurements are in μm and in the form mean±SD (range).
L, body length; a, body length/body diameter; b, body length/distance from anterior to base of esophageal glands; c, body length/tail length; c′, tail
length/diameter at anus region; V, % distance of vulva from anterior end/body length; G1, % length of anterior female gonad in relation to body length;
G2, % length of posterior female gonad in relation to body length.
Material examined. 1♀, 1♂, Korea: Gyeonggido, Yeoju fixation, length 1,318.2 μm, width 36.6 μm (maximum width
si, Neungseomyeon, Wangdaeri, 37°19′43.82″N, 127°36′ at level of vulva). Cuticle with fine transverse striations, 1.2
15.40″E, 25 Feb 2019. Voucher specimens were deposited in μm thick at anterior region, 2.0 μm at mid-body, and 5.1 μm
the Nakdonggang National Institute of Biological Resources at tail. Lip region rounded, slightly offset, about 2.2 times as
(NNIBR), Korea. wide as high. Amphid funnelshaped aperture 6.7 μm, about
Measurements. See Table 1. 0.7 times as wide as lip region width. Odontostyle asymmet
Description. Female: Body slender, ventrally curved after rical and slightly arched, ventral side length 7.7 μm. Odon
Anim. Syst. Evol. Divers. 37(2), 129-134 131
Taeho Kim, Jiyeon Kim, Joong-Ki Park
A
B
C D
A
B
C, D
Fig. 2. Dorylaimoides limnophilus (de Man, 1880) Loof, 1964. A, Entire female; B, Female neck region; C, Female reproductive sys-
tem; D, Female posterior region. Scale bars: A-D 100 µm.
=
tophore arcuated, narrowing posteriorly, about 2.1 times as with digitate tip. Male: General morphology similar to fe
long as odontostyle. Guiding ring distinct and single, located male, except for posterior region. Body ventrally hooked after
8.1 μm from anterior end. Pharynx with a slender anterior and fixation, length 1,241.2 μm, width 35.5 μm (maximum width
cylindrical bulb, 63.7 μm in length, and about 28% of total at midbody). Cuticle annuli 1.0 μm thick at anterior region,
neck length. Cardia rounded and distally enclosed by intesti 1.5 μm at mid-body, and 4.9 μm at tail. Lip region width 8.2
nal tissue, about 2.2 times as long as body width. Nerve ring μm. Amphid aperture 6.0 μm. Odontostyle ventral side length
located 105.4 μm from anterior end, 54.7% of pharynx length. 7.6 μm. Odontophore 1.9 times odontostyle length. Nerve ring
Excretory pore obscure. Female reproductive system didel located at 46% of pharynx length. Genital system opposite.
phicamphidelphic. Vulva transverse, located at 45.6% of Spicules dorylaimoid, 37.1 μm long, 1.1 times anal body dia-
body length. Vagina length 0.5 times body diameter. Uterus meter, with 11.0 μm long lateral accessory pieces. Supple-
length 2.3-3.3 times body diameter. Oviduct length 1.8-3.0 ments mammiform, five ventromedians. Tail similar to female,
times body diameter. Ovary reflexed, usually reaching junc with digitate terminus.
tion of oviduct and uterus, anterior reproductive tract (Q1) Habitat. Freshwater and sediment.
185.1 μm, posterior (Q2) 207.5 μm long. Rectum length about Distribution. America, Canada, Estonia, India, Korea (this
1.3 times anal body diameter. Tail dorsally convex conoid, study), the Netherlands, Romania.
132 Anim. Syst. Evol. Divers. 37(2), 129134
Two Dorylaimoides Species from Korea
1*Dorylaimoides limnophilus (de Man, 1880) 1990 for D. limnophilus), except for spicule length (37.1 vs.
Loof, 1964 (Table 1, Fig. 2) 30-32 μm) (Goseco et al., 1976) for D. elegans. The two Dory -
Dorylaimus limnophilus de Man, 1880: 96. laimoides species reported in this study were distinguished by
Thornenema limnophilum Andrássy, 1959b: 195. their morphological characteristics: a didelphicamphidelphic
Dorylaimoides riparius Andrássy, 1962: 6-8, Abb. 3. reproductive system, short tail, and digitate terminus in D. ele-
Dorylaimoides (Tarjania) limnophilus: Loof, 1964: 287. gans and a monoopisthodelphic reproductive system and long
tail in D. limnophilus (Ahmad and Jairajpuri, 1983; Peralta
Material examined. 3♀♀, Korea: Gyeonggido, Yeojusi, and PeñaSantiago, 1995a, 1995b; Khan and Park, 1999; Ah
Neungseomyeon, Wangdaeri, 37°19′43.82″N, 127°36′ mad et al., 2003; Ahmad and Mushtaq, 2004; Pedram et al.,
15.40″E, 25 Feb 2019. Voucher specimens were deposited in 2011; Gagarin and Gusakov, 2015). In addition, we obtained
the Nakdonggang National Institute of Biological Resources partial 18S rDNA sequences for the two Dorylaimoides
(NNIBR), Korea. species and assessed sequence similarity with other Dory-
Measurements. See Table 1. laimoides species from GenBank. The 18S sequences of our
Description. Female: Body slender, ventrally curved after fix specimens are almost identical to those of D. elegans (AY146
ation, length 1,037.8-1,338.8 μm, width 28.6-36.1 μm (maxi- 486.2, AY911976.1, AY911977.1; 99.8-100%) and D. limno-
mum width at level of vulva). Cuticle with fine transverse philus (AY284829.1, AY593950.1; 99.5-100%) deposited on
striations, 1.5-1.7 μm thick at anterior region, 2.0-2.3 μm at GenBank.
midbody, and 4.2-4.6 μm at tail. Lip region angular, offset by
a constriction, about 2.6 times as wide as high. Amphid cup
shaped, aperture 6.0-6.1 μm, about 0.7 times as wide as lip ORCID
region width. Odontostyle asymmetrical and slightly arched,
ventral side length 5.4-6.0 μm. Odontophore arcuated, nar Taeho Kim: https://orcid.org/0000000319733100
rowing posteriorly, about 2.8 times as long as odontostyle. Jiyeon Kim: https://orcid.org/0000000313174870
Guiding ring distinct and single, located 6.1-6.5 μm from JoongKi Park: https://orcid.org/0000000206073329
anterior end. Pharynx with a slender anterior and cylindrical
bulb, length 62.5-68.0 μm and about 30% of total neck length.
Cardia rounded and distally enclosed by intestinal tissue. CONFLICTS OF INTEREST
Nerve ring located at 94.8-103.5 μm from anterior end, 45.9-
49.2% of pharynx length. Excretory pore obscure. Reproduc No potential conflict of interest relevant to this article was
tive system monoopisthodelphic. Vulva transverse, located reported.
at 29.9-31.5% of body length. Vagina length 0.5 times body
diameter. Uterus short. Oviduct short. Ovary reflexed, with
numerous oocytes. Rectum length about 1.2 times anal body ACKNOWLEDGMENTS
diameter. Tail long, filiform, tapering to terminus. Male: Not
found. This work was supported by a grant from the Nakdonggang
Habitat. Freshwater and sediment. National Institute of Biological Resources (NNIBR) funded by
Distribution. Belgium, Germany, Holland, Hungary, Italy, the Ministry of Environment (NNIBR202001107), Korea Res
Japan, Korea (this study), the Netherlands, Romania, Slovakia, earch Fellowship Program through the National Research
Spain, Sweden, Switzerland, Uzbekistan. Foundation of Korea (NRF) funded by the Ministry of Science
Molecular sequence information. Molecular sequences (par and ICT (2020R1A2C2005393) of the Republic of Korea and
tial 18S rDNA sequences) deposited in GenBank: D. elegans the National Marine Biodiversity Institute of Korea (2021M00
(Gen Bank accession no: MN880408) and D. limnophilus 300).
(GenBank accession no: MN880407).
Diagnosis and molecular analysis. Morphological and mor
phometric characters reported herein generally match those REFERENCES
previously reported for these two Dorylaimoides species (de
Man, 1880; Thorne and Swanger, 1936; Jairajpuri and Ahmad, Ahmad W, Jairajpuri MS, 1983. Descriptions of new species of
1992 for D. elegans; de Man, 1880; Andrássy, 1959a, 1959b, Dorylaimoides and Culolaimus (Dorylaimida) from India.
1962; Loof, 1964; Peralta and PeñaSantiago, 1995b; Loof, Revue de Nématologie, 6:6572.
Korean name: 1*담수긴꼬리창선충 (신칭)
Anim. Syst. Evol. Divers. 37(2), 129-134 133
Taeho Kim, Jiyeon Kim, Joong-Ki Park
Ahmad W, Mushtaq P, 2004. Five new species of Dorylaimoides rock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer
Thorne & Swanger (Nematoda: Dorylaimida) from Singa T, Ashton B, Meintjes P, Drummond A, 2012. Geneious basic:
pore. International Journal of Nematology, 14:99110. an integrated and extendable desktop software platform for the
Ahmad W, Mushtaq P, Baniyamuddin M, 2003. Descriptions organization and analysis of sequence data. Bioinformatics,
of three new species of Dorylaimoides Thorne & Swanger, 28:16471649. https://doi.org/10.1093/bioinformatics/bts199
1936 (Nematoda: Dorylaimida). Journal of Nematode Mor Khan Z, Park SD, 1999. Description of Dorylaimoides punctatus
phology and Systematics, 5:153162. n. sp. and Paractinolaimus acutus n. sp. (Nematoda: Dory
Andrássy I, 1959a. Taxonomische Übersicht der Dorylaimen laimida) from Korea. Journal of AsiaPacific Entomology,
(Nematoda), I. Acta Zoologica Academiae Scientiarum Hun 2:4550. https://doi.org/10.1016/S12268615(08)600308
garicae, 5:191240. Loof PAA, 1964. Freeliving and plantparasitic nematodes from
Andrássy I, 1959b. Taxonomische Übersicht der Dorylaimen Venezuela. Nematologica, 10:201-300. https://doi.org/10.
(Nematoda), III. Acta Zoologica Academiae Scientiarum 1163/187529264X00042
Hungaricae, 5:143532. Loof PAA, 1990. Systematic observations on some species of
Andrássy I, 1962. Zwei neuen Nematoden-Arten aus dem Über Dorylaimoididae (Nematoda: Dorylaimida). Revue de Néma
schwemmungsgebiet der Donau (Danubialia Hungarica, XIII.). tologie, 13:161170.
Opuscula Zoologica, Budapest, 4:38. Pedram M, Pourjam E, Vinciguerra MT, 2011. Description of
Baermann G, 1917. Eine einfache methode zur auffindung von Dorylaimoides alborzicus sp. n. (Dorylaimida: Nematoda)
ankylostomum (Nematoden) larven in erdproben. Genee from Iran, with updated compendium and key to the species of
skunding Tijdschrift voor NederlandschIndië, 57:131137. Dorylaimoides. Zootaxa, 3022:58-68. https://doi.org/10.
De Man JG, 1880. Die einheimischen, frei in der reinen Erde und 11646/zootaxa.3022.1.4
im süssen Wasser lebende Nematoden. Bericht und de scrip Peralta M, PeñaSantiago R, 1995a. Nematodes of the order Dory
tivsystematischer Theil. Tijdschrift der Nederlandsche Dier laimida from Andalucia Oriental, Spain: the genus Dorylai-
kundige Vereeniging, 5:1104. moi des Thorne & Swanger, 1936, 1. Didelphic species. Funda
De Man JG, 1921. Nouvlles recherches sur les nematodes libres mental and Applied Nematology, 18:3553.
terricoles de la Hollande. Capita Zoologica, 1:362. Peralta M, Peña Santiago R, 1995b. Nematodes of the order Dor
Gagarin VG, Gusakov VA, 2015. Two new species of freeliving ylaimida from Andalucía Oriental, Spain: the genus Dorylai-
nematodes of the genus Dorylaimoides Thorne, Swanger, 1939 moides Thorne & Swanger, 1936. 2. Pseudodidelphicopistho
from fresh waterbodies of Vietnam. Inland Water Biology, delphic species. Fundamental and Applied Nematology, 18:
8:121129. https://doi.org/10.1134/S1995082915010071 167180.
Goseco CG, Ferris VR, Ferris JM, 1976. Revisions in Lepton Seinhorst JW, 1959. A rapid method for the transfer of nematodes
choidea (Nematoda: Dorylaimida) Dorylaimoides in Dorylai from fixative to anhydrous glycerin. Nematologica, 4:67-69.
moididae, Dorylaimoidinae; Calolaimus and Timmus n. gen. https://doi.org/10.1163/187529259X00381
in Dorylaimoididae, Calolaiminae and Miranema in Mira Shirayama Y, Kaku T, Higgins RP, 1993. Doublesided micro
nematidae. Research Bulletin, Purdue University, Agriculture scopic observation of meiofauna using an HSslide. Benthos
Experiment Station, 941:1-46. Research, 1993:4144. https://doi.org/10.5179/benthos1990.
Holterman M, van der Wurff A, van den Elsen S, van Megen H, 1993.44_41
Bongers T, Holovachov O, Bakker J, Helder J, 2006. Phylum Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins
wide analysis of SSU rDNA reveals deep phylogenetic rela DG, 1997. The CLUSTAL_X windows interface: flexible
tionships among nematodes and accelerated evolution toward strategies for multiple sequence alignment aided by quality
crown clades. Molecular Biology and Evolution, 23:1792 analysis tools. Nucleic Acids Research, 25:48764882. https://
1800. https://doi.org/10.1093/molbev/msl044 doi.org/10.1093/nar/25.24.4876
Husain SI, Khan AM, 1968. Basirotyleptus modestus n. sp. and Thorne G, Swanger HH, 1936. A monograph of the nematode
two new species of Dorylaimoides Thorne & Swanger, 1936 genera Dorylaimus Dujardin, Aporcelaimus n.g., Dorylaimoi-
from India. Nematologica, 14:362368. https://doi.org/10. des n.g. and Pungentus n.g. Capita Zoologica, 6:1223.
1163/187529268X00039
Jairajpuri MS, Ahmad W, 1992. Dorylaimida: freeliving, pre
daceous and plantparasitic nematodes. E.J. Brill Publishing
Received January 14, 2021
Company, Leiden, pp. 1458.
Revised February 25, 2021
Kearse M, Moir R, Wilson A, StonesHavas S, Cheung M, Stur Accepted February 26, 2021
134 Anim. Syst. Evol. Divers. 37(2), 129134