Table Of ContentTThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
ISSN1346-756S ActaPhytotax,Geebot.6e(1)1:-18(2009)
Molecular Systematicsof Malesian Litsea Lam. and Putative Related
Genera (Lauraceae)
Izu A. FIJRIDIYANTOip A2ND NoRIAKI MURAKAMI3.
'Department ofBotttGnrMaduateSchoolofScien1c<e),,otoUiniversityK,itashirakawaS,akyok-ku,1<voto606-8502.
Japan; 2Centerfor Plant Conservation BogorBotanical Gardens ,indonesian Institui eofScienc eJsl,. fr .H, hiandu,
13 ,Bogor i6003 ,M'le sJatva, inclonesia ;3Mlikino .Elerbaffi ultbnk,yo Metropolitan Universit) L1-1 IL4inami-Osawa,
fiZichioj i7,b 'kyo 192-03PZ Jt{pan ."nmurak@tmu,ac,1)i (inuthorf coorrre,!pondencoj
Phylogenetic rclationships ",ithin Litse a(Luurace aande )pessibl yrelated genera (Actinodop Lhinn-e,
de"a and rveolitsea )in the tribe Laureae in the Malesian rcgion were investigat aetd the moleculat level,
The nucleetide scquences of chloroplast matK and the nuctear ribosomal DNA ITS regions were afia-
lyzed .The results were corripared with sequence data in a publjcation based on materials from China.
Among the four sections reeognized in Litsea, the molecular data confirmed monophyly only of sect.
Litsea S.eiier aslpecies of sect. Conodaphne iiv'ere nested within sect. C);licodap hSencet.. 7biningoday)h-
ne and sect. Litsea were found to be more closcly related to several speeies efthe Lindera than to Lltsea
sections Conodaphne and q,licedaph nAect.inodaphne and Neolitsea ,were fbund to be monophyletic,
Cembined analysis of the matK sequences of the Malesian and Chinesc taxa suggested that a carefu1 re-
examination ot' the taxa in China is ncccssary. Mapping merphological characters on tli emolecular trees
revealed th at dimerous f iowers wcrc derive dfrom trimerous flewers and two-celled anthers were derivcd
from four-celle danthers.
Key words: Charaetcr eN'olution, ITS, Lit,sea,Malesia ,matl<,melecularphylogeny
Litsea, with about 400 species, is one of the Bentham (1880 L)i,tsea can be divide dinto 'fbur
four larges tgenera among the 52 genera recog- sections: Sect .Eulitse aBcnth, define das haNiing
nized in the Lauraceae .The other three largest incomplet eor absent periant hsegments, a peri-
genera are Cinnamomum, CnyptocaFl)i a and anth tube not enlarged or only slightly entarged
Ocotea. Each consists ofabout 350 species (Ro- in fruit sa,nd often more than 12 stamens; Sect.
hwer 1993). Litsea is distinguish efdk'o mother Conodophne <Blume )Benth. with cornplete peri-
genera in the same family by having umbeilate anth segments, usualty nine stamens and a fla tto
inflorescenc eusni,sexual and trimerous flowers, slightly enlarged perianth tube in fruit sS;ect.
usually nine stamens, fbur-cell eandthers, tepals IVk]olit sBeecnxth, with triplinerve dleaves ,dimer-
equal to each other and some of them reduced in ous flowers ,four perianth segments, six stamcns
numbers, fruit swjth fia tto deeply cup-shaped and fruit ssimilar to these of sect, Conodaphne;
cupules, and leave salternate or sometimes oppo- Sect. Clyiicoduphne (Nees B)enth. with penni-
site (va nder Werff 2001), Specie sofLitsea occur nerved leaves ,trimerous fiowers ,sjx perianth
mostly in Asia, with several species in Australia segments, 12 stamens and an enlarged perianth
and the Pacifi cislands ,and a few in America tube with cup-shaped cupules. Hooker (1890)
(Rohwe rl993), used deciduous versus persisten tleaves to distin-
Taxonomists havc difLfZ] roepinntions on the guish a fifi hsection, 7bmingoduphne (Blume)
infi'agene rrielcationship of Litsea .According to Hook. £
NNIII-IE-leEcltreoncitcronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
2 A.ctaPhytotax,Geobot. Vol.60
Based on the same characters as in previous genera .This group, referred to as the Litsea com-
classifications, Pax (1g9 1tr)ansferred sect, Nbolit- plex, consists of 10 genera :Litsea, Lindera,
sea from Litsea to a new genus, 7latraden iPaax. Neotitsea , Actinoclaphne, Dodecadenia, ftea-
He retained the other four sections recognized by daphne, Parasassafra sS,inosassdyas ,Uhibellu-
HoQker (189 0u)nder Litsea in hjs classification, lari aand Lattrus .Most ofthese genera are mem-
Kostermans (1957 d)ivided Litsea int othree sub- bers ef the tribe Laureae of van der Werff and
genera :plant sof subgcn. Litsea are monoeciQus; Richer (1996 T)h.e outcome of the study by Li &
those of subgcn Dodecacleni a(Nees K)osterm, Christophe (l2000 d)id not clearly show the rela-
are bisexual ;and those of subgen. Octolitsea tionships within the complex, Bascd on the mo-
L{ou-Ho are dioecious .The flower sin subgen. lecula trrees obtained from nucleotide sequences
Octolitse haave eight tcpats .Kostcrmans recog- of the matK gene of the chloroplast genome and
nized Nleiolii sase adistin cftrom Litsea. the interna ltranscribed spaccr (ITS )regions of
Based on Chinese species, Li et aL (198 2d)i- ribosomal DNA of thc nuclear genome fbr the
vided Litsea into two subgenera: Litsea and L・lai-same species examined by Li & Christophel
,fZo sYang et P, H, Huang. Within subgen. Litsea (2000 L)i, et al. (2004 c)oncluded that most gen-
they recegnized four sections: Litsea ,7bmingo- era of the Litse acomplex are polyphy]etic .Con-
claphne (Blume H)ook. £ Conodaphne (Blume) fiic tbsetwecn their matK and ITS data ,however,
,
Bcnth. and Cylicoclaphn (eNecs B)enth, Thc sub- gavc low bootstra psupport for their combined
genus U7iijl oiss monotypic, represented by Lit- tree .Their molecular analysis, however, was
sea monantha Yang et P, H, Huang. They also based on only fbur species ofLitsea.
considered Neoliths 'toe abe distinc Stu.bsequentfy, Despite the above studies, the delimitation,
Li (198 5r)ecognized L. Fnonantha of subgen. phylogeneti rcelationships, systematics and evo-
UitijI oo'sf Li et al. (198 2t)o bc conspecific with lutio nofthe Lixsea complex remain poorly under-
Dodecadenia grandijlora Nees, leavin gLitsea stood. Owing to the widc distribution t,he large
with the four scctions of Li et al. (198 2m)inus number of specieg and extensive morphological
subgen, UnWos, variaLion, thc relationships ofthc sections in Lit-
A close relationship between Litsea ,Actino- sea and rclated genera are still problemati cT.o
d(u)hne L,indera and Neolitsea, has been suggest- understand the relationships, we decided to fo-
ed by Li (1995 R)o,hwer (200 0an)d Chanderba]i cusing on the species of a particul agreographic
et aL (200 1T)he. study by Li (199 5wa)s based on area, the Malesian region, where the Lauraceae
morphological analysis, while the other two stud- are an impertan tcomponent of marry fbrest sand
ies were based on molecular analysis. Li C1995)whcre Litse ais one of the larges tgenera .The
uscd the number ofanther cells (2 vs. 4) and fiow- number of species efLitsea is still unknown and
er arrangement (dimero vus.s trimerous) to infer no monograph exists for thc rcgion. Our study
the phylogeneti crclationship among these gen- did not aim to rcsolvc the phylogeneti crelation-
era. The number ofanther cells has been one of ships of the entire Litsea complex, but instea dto
the most important characters in the classifica- understand the infi'ageneri crelationships orLit-
tion of Lauraceae (e, gB.entham 1880, Koster- sea in the Malesian region using molecular data
mans 1957, Huchinson 1964). Jnstab{lit yof this to provide a basis for furthe rst udies ofthe gcnus
character was recently found in some genera (van within thc rcgion. For this purposc ,wc cxamined
der Werff & Richter 1996), making relationships materials from Indonesia and Malaysia, Most of
and dclimitations ofLitsea and relatcd genera ob- the species wc cxamincd are widely distributed.
scure. Wc also include dsome ofthe related genera men-
A comprehensive systematic study ofLitsea tioned above. Ofthe 1O genera in the Litsea com-
by Li & Christophel (2000 u)ging gross morpho- plex (L i& Christophcl 2000; Li etal, 2004), only
logica tand ]eaf cuticle characters attcmptcd to five occur within thc Malcsian region: Actino-
elucidate thc rcEationships of Litsea and re]ated dophne, Lindera, Liis'e aN,eolitsea a,nd lteacla-
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
Mareh 2009 FIJRmlyANTo&MuRAKAMI-MolecularSystematicsol'Litsea 3
phne. We excluded freadnphne ,since this mono- species examined in this study, along with vouch-
typic genus is now considered more closely er, GenBan kfDDBJIEMBL accessions and source
related to Lindera than to Litse a(Kostermaninformation is in Table 1.
1957; Tsui 1987; van der Werff 2001). In our
study, we sequenced the matK and ITS regions DAC4 extraction
for rnolecular phy]ogeneti acnalyses, since these Leaf samples tbr DNA extraction were col-
regions have been useftt[ for resolving interge- lecte din the ficl dor from cultivated plants and
neric and infrageneri crelationships (Solt &is dried in silica ge] .Tbta lDNA was extracted 'fbl-
Solti s1998), Although thesc rcgions gave conflict lowing the procedure of Kawahara et al, (1995).
results in Lj et al. (2004 o)ur, preliminar ystudy Polysaccharid esand oils were removed using
using a BLAST program search (Altsch uetl al, washing buflf ts]otrution (0. 1M HEPES pH 8.0,
1997) revealed that some of the tTS sequences of 29, 62-mercaptoethano l1,% polyvinylpyrrolidene
Li et al. (200 4sh)owed significant sequcnce ho- and O,05 M ascorbic acid). Some DNA samples
mology with fungal sequences. We suspect that a required furthe rpurificati ousning a Qiagcn-tip
fungal contaminant in some oftheir samples may 20 column (Qiage nHi,]dcn ,Germany) and we
explain the discrepanci eisn their results. applied the procedure sdescrib eidn Kawahara et
The main objectives of our study were (1 )to al, (1995),
provid ea molecular phylogeneti ctree ofLitsea
and related genera using materials firo mpart of Polymerase chain reaction (:PC Ra)mplijieation
the Males'ia rnegion, (2 )to compare our data with andnucleotidesequencing
those o'fthe previou sstudy by Li et al. (2004 u)s- Double-strande dDNA of the chloroplast
ing Chincse materials, and (3 )to discus scharac- matK region was amplified using the primer pair
ter evolution ofa number of morphological traits of trnK 3914 and trnK 2R (Johns o&n Soltis
formally uscd for classification of this plant 199S), The amplification reaction used anti-Taq
bigh (TOYOBO,Osaka,Japan)in
group. polymerase a
total volume of25 pL. The PCRprofile consisted
Materials and Methods ofan initi adlenaturati oant 940C for 2 min, fo1-
lowedby 35 94eC for1
cycles ofdenaturatiQn at
Plant mate"ials min, annealing at 50eC lbr 2 min and cxtension at
We perfbrmed molecular analysis of 39 spe- 720C for 3 min, with a fina lextension at 720C for
cies of Litsea ,Lincler aN,kfolith saenda Actino- 7 min on a Model 9700 thermal cycler (Applied
dnphne, which are the main genera ofthe Laure- Biosystems, Foste rCity ,CA, USA).
ae distribute din the Malesian regjon. Wc examined The amplification ofthe nuclear ITS region of
24 species ofLitsea, one species of sect. 7bmin- double-stranded DNA was carried out us{ng the
godophne, two species of sect Litsea, nine spe- priiner pair of LAURI (Chanderb eat laLi 2001)
cies of sect. Conoclaphne and 12 species of sect. and ITSB (Blatt n1e99r9). The amplification re-
(lyiicoclaphn e.We also included six species of action used TaKaRa Ex TaqTM DNA poiyrnerase
Actinoclaphnef,bur IVbolitsea five (TaKaRaBio,Otsu,Shiga,Japan);109x6DMSO
species of and
species of Lindera in our study. The plant swere was added to reach atotal volume of20 pL. The
collectcd in thc Bogor Botanic Garden and Cibo- PCR profil econsjsted of initia ldenaturation at
das Botanic Garden in Indonesia L,ambir Nation- 94eC fbr3 min, followe dby 30 cycles ofdenatur-
al Park in Malaysia, and in Kyoto and Kochi in ation at 940C for 1 min, annealing at 55eC for 1
Japan. We used .A4tfchii urstmosa and Phoebe ex- min and extension at 720C fbr 1 min, with a finaJ
elsa (tri Pbeerseeae) as outgrQups, because tribe cxtension at 720C for 10 m{n on a Model 9700
Perseae has been shown to be a sister to the tribe thermal cycler,
Laureae, to which our taxa belong (Rohwe 2r000, Aftcr amplification, the PCR products were
Chanderbal iet al. 2001) .A complete lis tof the checked by clectrophoresis in 1.09' eagarose gels
NNIII-IE-leEcltreoncitcronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
4 Acta Phvtotax G.eobot, Vol, 60
TABLE 1. Plant materials examined in this study. Thc materials wcre collected from Bogor Botanical Garden (BBG) and Cibo-
das Botanical Garden (CBG). Indoncsia ;Lambir Natiunal Park (LNP )Ma,laysia; Kechi (KOC) and Kyoto (KYO) ,Japan.
The sampLes were collcctcd by I.A .Fijridiya nCtIoZ )or T. Iwasaki (TI )V.buchers are dcposit eidn the Makino Herbarium.
Tokyo Metropolitan Univcrsil y(MAK).
AccessionNo,
Spccics VOuchcr Source OriginfRange
tnatKflTS
Actinodophne gtomerata (Blume )Nees IZ 802IZ BBG WcstMalesia AB258991,LAB260849
ActinodLu)hne macroph.vlla (Blum cN)ccs 854 BBG PeninsularMalaysia AB258990YAB260850
var, angttstijbiia Koerd, & Valet. to Papua
Actinodaphne mainga.vi Hook. f. IZ 2068iZ LNPLNPLNPLBNoPrKnOeCoLBNoPrKnYeOoCBBoGrKnYeOoLBNoPrLnANeBPo2LJ5NaPp9Ca0Bn6GB2CorBr'GnLeANoBPJ2La6Np0Pa8LnNW5Pe1BsBtGLNPLNPBBGLNP
A('tinodophne malaccensis Hoolc .f 2053iZ2052JZ2057fl AB2589921AB260852
Actinodtu)hnemp,rianthaMerr. AB259063[AB260853
ActinomphneproceraNees AB259064,tAB260854
Lindera eo,throcaipa Makine 526IZ2010T:( AB259065,・AB260855
Lindera iucid o(Blum eB)eer], AB2590661AB260856
Lindera ebtusiloba Blume 3402IZS76Zr AB259067iAB2608S7
Lindei"a polyantha (Blume )Becrl, Java AB2590681AB2608S8
Linde"a umhettata Thunb, 3477IZ JapanBo-ieoBorncoBorneAoBC2o5c9h0i6n9cthAiBn2a6,eCgh5i9na
Litsea aeeedens (Blume )Boerl, 2066fZ AB2590701AB260860
Litsea eautocaJlpct Merr. 2043IZ AB259071ltYB260861
Litse acostalis (Nees K)osterm. 2041IZ863IZ AB2S90721AB260862
Litse acubeba (Lour .P)ers. AB259073,AB260863
LitseadiversijbiiaB]urne 864IZ WestJava AB2590741AB260864
Litsea ereetinervia Kosterm, 2032iZ BorneoBorneeBorneoWestAB259075,AB260865
Litseajbnestrata Gamblc 2031.iZ AB2590761AB260866
Litsea.fbrrugine a(Blume )B]ume 2016rz AB2590771AB26e867
Litsea.fiFmaHook. tl 835IZ Kalimantan AB259078,AB260868
Litsea garciae S.Vidal 2025U2044IZ BorneoBorneoMalesiaBorAnBe2o590811AB26e869
Litsea gtohutaria Ng AB259079,iAB260870
Litse aglutinosc r(Loun C). B. Rob. 824IZ AB259080/AB260871
Litse agrandis (WalL .Ho)ok, f. 2042 AB259082/AB260872
Liiseataneij?]tHoioak. L
IZ2047 LNP BorneoBorneeBorneoWestAJBa2v5a9083rAB260873
var. grandtfblia (Stap tNg)
Litsea machitijbtia Gamble IZ2037iZ2007JLZN8P7L1NLPZCBGBBGLNPBBGLNPLNPCBGBBGCABBG2K5Y9O0B8B4G,CiBAGBB2B6G0C8B7G4
Litsea maingco)i Hook. f. AB259085,AB260875
Litsea nicuzpacea (Blume )Boerl. AB259086,,AB260876
LitseanoronhaeBlume 818IZ2034iZ JavaBorneoSumatraBorneAoBB2o5r9n0e8o7W1cAsBt260877
Litsea ochracea (Blum eB)oerl. AB259088,・AB260878
Litgea resinosa B[umc 839iZ2026IZ AB259089JAB260879
Litsea rubicunda Kosterm. AB259090,AB260880
LitseasaravvacensisGamble 2049IZ874IZ AB2590911AB26e8Sl
LitseatometitosaBlume Java AB259092,LAB2608g2
l.itse aumbellata Mcrr. 809IZ870iZ West Java AB259093,OXB260883
Machilus rimosa Blume JavaJapanSumatraWest AB25909glAB260888
7Vkrolits eaacicutata (Blume )Koidz, 10017Z AB259094iAB260884
,Nbotits ecaassia (L. )Kesterm, 831JZ869IZ AB259095,(AB26088S
?Vleolitsea,J'avani(cBalume)Backer Java AB259096/AB260886
Neolitsea sericea (BLume )Koidz. 852rz JavaJava AB259e97,AB2608g7
Phoebe excelsa Nccs 868 AB259099,LAB260889
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnSyts teSmaytsictsematics
March 2009 FIiRIDIyANTo&MuRAKAMI-MolccularSystematicsot'Litsea 5
and the amplified fragments were purifie udsing a (Appli eBidosystems). After the overlapping se-
QIAqui cGekl Extractio Knit (Qiage Fnor) n.ucle- quences had been checked, a connected sequence
rrbrminator
otide sequencing, the BigDyeTM v3.1 for each species was generated .The connected
Cycle Sequencing Kit (Appti eBidosystems) was sequences fbr all taxa were realigned using Se-
used, The cycling consisted ofan initi adlenatuiL quenceNavigator ver. 1,O, 1<Applie Bdiosystems),
ation at 96eC for 10 s, followe dby 25 cycles of and then adjusted manually fotlowin gguidelines
denaturatio ant 960C for 10 s, annealing at 50eC in Kelchner (2000 t)o produce a fina ldata matrix,
for 5 s and extension at 600C fbr 4 s. Sequencing We performed a homology search for all species
was pcrformcd using a 3100 Genetic Analyzer using the BLAST program (Altsc hetu alL 1997)
(Appl iBeiodsystems). Atl primers used for se- to yerify that the sampies were free ofcontamina-
quencing in this study are ]iste din Table 3. tion.
1[b compare our data with data from diffkirent
Sequence alignment geographica lregions, we created a combined
The nucleotide sequenccs of the matK and data set using data by Li et aL (2004 w)hi,ch were
ITS regions obtained for each plant species were mostly obtained from samples from China. Their
aligned using Aute Assembler ver. 1.4. 0software sequence data were retrieved from the DNA data-
'LxBLE
3.Primer sused for PCR amplification and sequencing of ntatK und ITS regions.
Primer sequencc 5L3 ' Source
matKForward909(trnK3914F)
GGGGTTGCTAACTCAACGG Johnsen & Soltis(1995)
44880510841318matKLAF(}TGTCAGATATACTAATACC Rohwcr(2000)
ACCCTATGGTTC}TTCAAAGAC Rohwer(200e)
CTATTAAGAAATTCGAGACC Rohwer (2000)
TGTGCTAGAACTTTGTCTCG Rohwcr(2000)
CTArrATCCACTTATCTTTCAGGAGT Ooi et al. (1995)
matK-BF TCAGAGGGATTTGCGTTTATTGTGG Ooi et al. (1995)
Revcrse2288UrnKL2R)
AACTAGTCGGATGGAGTAG Johnson & Solti(s199S)
8059411166]4221847n2aGtTKCLTRTmTaGtAlA<CLA8ARCCAJI'AC}(',GT Rohwer(2000)
CC(}GTT(}AGACCACAAGT Roh",er(2000)
ACGGCTTACTAMGGGATGCC Rohwer (2000)
TTGGGAAGATCAAAGAAAGA Rohwer (2000)
ACTAGTCGGATGGA(}TAGA Rohwer (2000)
CTGCATATACGCCCAAATCGGTCAA Ooi et aL (1995)
AAAGTTCTAGCACAAGAAAGTCGA Ooi et aL (1995)
ITSForwardLAURIITS3
ACCACCACCGGCAACCA Cliandcrbalietai.(2001)
GCATCGATGAAGAACGCAGC W'hite et ai. {i990)
ReveTseITS2I')7SB
GCTACGTTCTTCATCGATGC W'hite et al. (1990)
CTTTTCCTCCGCTTATTGATATG Blattnei'(1999)
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
6 ActaPhytotax.Geobot, Vol.60
TABLE2,DNA sequence ot' maiK data analyzed by Li et aL (2004 i)ncluded in the analyses of this study.
Species AceessionNo.
Litsea gtutino,s a(Lour C). B. Rob. AF 244396
Litse aumbeilata (Lou rMe)rr. AF 244395
LinseadilleniijbPJ.iYa, Pai& P.Ii.Huallg AI・'244397
Lindbra meguphytta Hcmsl, AF 244404
Lindera refiexa Hemsl. AF 244401
LinderametcalLfianaAllen AF 244403
LinderafruticosaHemsl. AF 244405
Lin de ra obtzfsiloba Blurrie AF 244402
Lindera commttnis Hemsl. AF 244406
Actinodaphne obovata (Nees )Blume AF 244410
Actinodaphneforrestii(Allen)Kosterm. AF 244411
Neolitsea (,onjertijbtia (Hemsl .M)err. AF 244394
A'eolitsealevineiMerr. AF 244393
Iteack;phne caudota (Nees )II. W. Li AF 244408
Parasassqfi' acospziUi'tijIora (Meiss nT..e)ng AF 244392
Sinosass'cof)'as'.flaCvAinIeIrevnHi,)aW. Li AF 244390
Lattru snobilis L. AF 244407
Scrs・s'o ftz'tatsmu (Hem sl.) IIcmsl. AF 244391
U)vabelh{ta craitaijbrv:i(:a (Hook &. Arn,) Nutt. AF 244389
base of DDBJ (http:iVwww.ddbj.nig .Tahcejp)p.hJ・'ll at)o be too similar. We did not, therefore,
combined data sets were analyzed separately use the ITS data from the studics of Li et aL
fror nsets based on only our data ,We include d20 (2004),
oF the 23 species of Li et aL (2004 i)n the com-
bined matK data set. Sequence data for the other Pdy'logenet aincalyses
thrce gpccies were not include din our analyses Phylogenetic analyses based on maximum
because there were several `tN" characters in parsimony criteria were performed using PAUP*
their matl< sequences. A lis otfthe DNA sequence version 4,OblO (Swoffb 2r0d02) for two kinds of
data reported by Li et al, (2004 a)nd, which were data sets. The firs atnalysis was based only on our
used for comparison in this study, i' sshown in Ta- own data sets, which consisted of matK, ITS, and
ble 2. a combination of the two, The second analysis
We combined our data with only the matK was based on combined matK data ,ours and
data of Li et aL (2004 s)in,ce their ITS data need- those of Li et al. (2004 I)n.sertions and deletions
ed further clarification, as indicatc dby our ho- were treated as missing data .All characters werc
mology search using the BLAST program. The equally "'eighted and unordered (Fit c1h971).
results showed that the sequences from their sam- Both data sets were analyzed by the heuristic
ples ,such as froi iiLindera tienchuanensis search methDd with tree bisection-reconnection
(AY265412 ),.Meolityea coizl?irttf?)lia (AY265400) (TBR )branch-swapping and the MULTREES
and Sinosasscijka s.flavinervi a(AY265394 )m,ay option on, ten replications ef sequence addition
have contained errors duc to contamination by with the stepwise addition option, and all ofthe
ene or more species ofAspergillus. Their data most parsimoniou strees (MPTs) were saved. The
also showed ITS sequences from differcn tgenera evaluation of internal support of clades was con-
(e, gA.ctinodnphne forres tanidi Lindera mega- ducted by bootstra panalysis (Felsenst e1i9n85)
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
March 2009 FIJRJDIYAN T&O MLJRAKAMI-Molccular Systematics of I.itsea 7
Pheebe exceLga
Aetinoclapfuneglomerata
simchitus rmiosa Actinodupkne myriantha
Actinockmphnemaingto・
99.8
Actinoclaphneprocera
Actinodophn emactztpfp;tla var. angttstLfblm
rictinodqphnemalaccensis
63,3 Aieolitse aaciculat"
98.3 Nbolitseasericea
99,2 litse caassia
litseajavanica
60.7 Litse acubeba
Liiseaglutinosa
Litse atoinentosa
Litseaumbeilata
Li.tsea.firpna
99.468.4
Lilse amappacea
Liisea grandis
Liisea.fenestrata
Litye amachilij?)lia
Litseaglobztgaria
Litse acostatisLitsea
noronhae
Lithv eeraectinervia
Litse aochracea
Litseagarciae
98.0
Litsea
accedens
Litsea cauloearpa
Litsea ctiversijblia
Lilsea lbrruginea
Litsea lancijbti avar. grandll?)lia
Litse amaingq.vi
Litsea rubicuncia
dera
en,ihffo(rarpa
87.3 Lindera tuciact
derapoCyantha
dera
blnibeXtata
Ltncteraobtus'itoba
1
changc
FIG, 1. 0ne ot' 66 most parsimonious trecs derived from analysis ofmatK sequcnccs Clcng t= h 107; CI = O.g97; R] = 0.929).
Internal supporL was examined by bootstrap analysis of 1.eOO rep]icatcs, Bootstrap valucs are shown abovc bTanches.
BrHnch ]engt hcorresponds to nurnbcr ot'nuc]eotide subsLitutions; scale bar is sho",n on lo-,e rleft.
utilizing 1,OOO replicates with TBR branch-swap- MPTs in each analysis using the TREE SCORE
ping and the MULTREES option off. The num- command in PAUP*. The congruence between
ber of steps, consistency indice s(Cl )and rcten- matK and ITS data was tcsted with the incongru-
tion indice s{RI )were calculated using one ofthe ence lengt hdifferenc e(sILD )test (M{ckevi &ch
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnSyts teSmaytsictsematics
8 ActaPhytotax.Geobot. Vol,60
Faris 1.981, et ai. 1994) as iinple]nent eidn geneti ctree obtained from our data matrix of thc
PAUP" (the"parFtitioan-hormogenieitystest")・ combined matK and ITS sequences using Mes-
quite ver. 1.06 (Maddig o&n Maddison 2005).
.Wbst parsimonious reeonstruetion (MPR? of' Morphological data were based on information in
character evoZution publishe dflora s(Hooke rl890, Ridley 1924,
Two phenetic characters (arrangeme notf Backer & van den Brink 1963 ,Ohwi 1965, Li et
flower parts and numbcr of anther cells), which al, 1982) as well as on our own observation of
have been uged to distingui sghenera ofthe Litsea herbarium specimens deposited in the herbari aof
complex, werc mapped onto the molecular phylo- Kyoto Universit y(KYO) and the Sarawak Forest
Phoebe excelsa
mmosa
71.9
Actinocmphneglomexnta
2Actinoclaphneprocera
Actinodophne
macrztphyila var. angustijZ)l
Actinodtny)hneinaingayi
litse aaeieutata
IVdeoiits seearieea
Nboiiiseajavanica
Litsea tometztosa
Litseaglutinosa
Lmdera obtusiloba
Litsea cubebaLinde]'a
erythrocarpa
derapolyantha
Litsecr,firma
Litse amafzpaeea
Litse agrancfis
Litseagarciae
Litsea
cosfarih'
Liitseamachilij2)lia
icundL]
Litseacaulocatr?a
Lit.yea mainga.vi
Litsea.fenestrata
Litsea cfivenstfblia
Litsea erectinervia
Lityeaochracea
Litseagtobularia
LiLs'ea.7lerrasginea
Litsea lancij2) vlari,a grandLlrilia
Litsea sarawacensis
5 changes
FIa, 2. 0ne ofsix most parsimonious trees deriye fdrom analysis oftTS sequences (leng t= h506: CI = -O,484 R;I E O,642 )I.n-
ternal support was examined by bootstrap analysis of 1,OOO rep]icates. Bootstrap values ar¢ shown abQve branches.
Braneh IengLh eorresponds to nurnber efiiueleolide substitulions; scule bur is shown on lovv' elreft.
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
March 2e09 FTJRIDTyANTO&MURAKAMT-rvTolecularSystematicsofLitsea 9
ResearchCenter(SAR). Nucleotide offTIS
sequences and phylogenetic
analysis
Results We removed some variable sites from our ITS
sequence data set because of diMcultie sin align-
IVticleot isedqeuences ofmatK andph.ylogenetic ing them. The resultant ITS data set contained
analysis ITSI, 5.8S and ITS2 sites. It comprjsed 632 char=
The atigned nucleotide matK sequences, in- acters after alignment. Of these, 447 (70.79ta)
cluding small part sof the trnK intro fclomprised were constant, 74 (119 tweare) parsimony-uninfor-
1,628 characters, Among these, 1,534 (94.2%)mative and i11 (17.6 "%'e)re parsimony- informa-
were constant, 46 (2.8% w)ere parsimony-unin- tive characters (Tabl 4e) .The most parsimenious
formativ eand 48 (2.99 w'er6e) parsimony-infor- analysis resulted in six MPTs with a tengt hof506
mative characters (Tab l4e). The nucieotide se- steps, CI of O.484 and Rl of 0.642. 0ne of the
quence of the four species ofActinoclaphne was most parsimoniou strees demonstrated that only
identica lT.wo pairs of identic aslequences were a few groups were supported by BPs greater than
also found in Litsea ,one ofwhich was shared by 50% (Fi g2). .The tree in Figure 2 also shewed
three and the other by two differen tspecies. The that bothActinoclaph naned .Neolitsea were mono-
parsimony analysis resulted in 66 MPTs with a phyletic with BP values of 71.9% and 80.29/ 6re,-
length 107 CI O,897 RI O,929. InLitsea, joineidn
of steps, of and of spectively, most species "iere
One of the most parsimonious trees with boot- onc clade witb BP 77e/ 6cx,cept fo rLitsea crubeba,
strap percentages (BP )is shown in Fig .1 ,Mono- Litsea tomen tosa and Litse aglutinosa w,ho se po-
phyly was shown fbr Actinodaphne with a BP of sitions remained obscure, The relationships
99.8%, and for AJeolitse awith a BP of98,3%. Lit- among the species ofLindera were also unclear.
sea was divided into three main lineage swith
BPs of 60.7%, 99.4% and 90.7%. The latte trvLro (lbmbined analysis ofmatK and JTI Sduta
lineagesfbrmed lowBP The ITSdata
a clade with a support of combined matK and sets passed
63.2%. Litsea cubeba did not joi nwith any of the ILD test (P = O.987) ,suggesting that nuclear
these three lineage sI,n Lindera ,only two species and chleroplast data sets are congruent for the
(Linde rpoalyantha and Lindera Xucidb uw)ere data set as a whole (Darl &u Lecointre 2002).
shown to be ctosely related, with moderate BP Combined analysis can produce results s'uperior
support ef 87.3%. Relationships among the other to single gene analysis (Gontcha reto vaL 2004).
species o'f Lindera were not clear based on this Our analysis ofthe combined data sets proyided a
analysis, bette rresolved tree than any individL Ldaalta set.
The aligncd matrix for the combincd matii
'1'ABT.E
4. Statisti ecasleu[atcd from parsimony analyses ofthe scparate amd combincd datamatric cofsmatK and ITS as weEl as
combined matK with thosc ofLi et al, (2004).
Li
tnatKwith et at.
matK ITS matK & ITS (2004)
No. of sites l,628 632447 2,260 1,405
No. ofconstant sites (%) 1,534(94.2%) (7e.7%) 1,982 (87.7%) 1,29 2(91.9%)
No. of variable sites (%) 46 (2.8%) 74 (11.7%) 116 (5.1%) 68 g,8%)
No. ofinformative sites <%) 48 (2.9%) 111(17.6Vi) 162 (7,2%) 4S (3.2%)
No. of' steps (substitutjon) 107 506 620 I25
Ne. efMPTs 66 6 12 lgo
CIRI O.897 O.484 O.548 O.912
O.929 O,642 O.699 O.932
NNIII-IE-leEcltreoncitcronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
10 ActaPhytotax.Gcobot. Vol.60
and ITS analysis comprised 2,260 characters. .fructicosa )that had been analyzed by Li et al.
The analysis rcsulted in 12 MPTs with a length of (2004 w)it,h BP support of64.8%. The other spe-
620 steps, Cl ofO.548 and RI o'f O.699 (Tab l4c). cies ofLitsea, includin tgw'o species analyzed by
The strict consensus tree of MPTs is shown in Li et al. (2004 f)b,rmed two monophytetic groups
Fig, 3. According to the tree obtained, the mono- with BPs of 99.0Y 6and 92,4%. Polytomie swere
phyly ofboth Actinodtrphne and ofAieolitgea "'as also shown by several species of Lindera. The
also supported by BPs of 98,5e, aand 99.3gi6 ,re- phylogcneti cposition osf other genera analyzed
spectively. These two gcnera showed a sister by Li et aL (2004 s)uch as Laurws, Iteadaphne
group relationship, with a BP of 54.lg, I6n. Litsea, and Umbeltutaria, were obscure in the tree ob-
members of sect. Litsea were in the same clade, tained.
with a BP of 58,3%. Sectio n7lomingodaphne,
represented by only one species (L .cuheba), was MPR ofphenet ickearacter evolution in Litsea
in the same lineag ewith somc species ofLinctera andrelatedgenera
but with a BP les sthan 50%, Members of sect. T"io phencti ccharacters (arrangem eonft
Conoclaphne were divide dinto t-so clades. Spe- flower part sand numbcr of anther cclls), which
cies with alternatc leavc sof sect. Cbnodtu?hne have been used to distingui sghenera in tribe
fbrmed a clade with a BP of99,70/u, whilc species Laurcae in most classifications of Lauracae, were
with opposite ieave sor sect. Conodnphne were applied fbr MPR analyses (Fig s5-.6). The evolu-
ncsted with members of sect, Cylicodcu?hn weith tien of these phenetic characters was examined
a BP of 85,9%, Those two clades were sLsters, by guperimposing the characters on a combined
with a BP of 89.6V6 ,In Linctera ,three species niati< and ITS tree based on our own data ,since
(Linde rpoalyanthcr ,Lindera lueicl aand Lindera the combined data provided a better-resolve dtree
ei:vthocarpa) were shown to be closely related to than either single data set, Trimcrous fiowers,
each other with a BP support of81.2%, which occur in Actinodophne ,Liiidera and Lit-
sea, were shown to be more primitive than the
Phylogenetic analysis of matK dLit acombined dimerous flower sof Neotitsea (Fi g5,). In number
with dLita.fi' oLnii et al. (2004) ofanther cells, fbur-cellc danthers, which are dis-
The combined matK data, which included tributcd in the tree genera, Aetinodai?hne ,Liilsea
data from Li et al. (2004 re)su,lted in aligned se- and ,]Veolitse awe,re cstimated to be more primi-
quences of 1,405 characters. Of these, 1292 tive than the two-celled anthers of Lindera (Fig,
(91.9 %we)re constant, 68 (4,8% w)ere parsimo- 6),
ny-uninformative and 45 (3,2% w)erc parsimony-
informativ echaracters. The analysis resulted in Discussion
180 MPTs with a length of 125 steps, CI ofO.912
and RI of O.932 (Tab ]4e). One ef the most parsi- iWblecular xrees based on matK andI71S dttta
monious trees is shown in Fig. 4, Neolityea, in- ITS data had a greate rnumber of parsimony-
cluding species analyzed by Li et al. (2004 w)as, informative sites (17.6 %th)an matikJ data (2.99'6).
shown to be a monophyletic group BP support of The ITS region, however, was more homopla-
85.6g/ T6h.e polyphyly of many genera of the Lit- sious, as indicate bdy lower CI and RI values (Ta-
sea complex is shown in the tree obtained. For ble 4). The matK trcc demonstratc dmore highly
example: Lindera metcaLfiana was nested in the supported cladcs, but the rclationships among
Malesian Actinodo1)hne group with BP support of some lineagcs were not weli resolved. The ITS
99.8`>6 ,while Actinode1)hneforresti iand Lindera tree showed better-resol vreeldationships but with
megaphylla were in the same lineag ewith Litsea 1ower bootstra psupport. The combinedmatK and
gluiinosa and Litsea tomentosa with BP support ITS showed a betteiLresolve dtree than was gen-
of 64.8%. Litsea cubeba nestcd within two other crated by a single data set. The combined tree
species ofLindera (Linct erereeaxa and Linctera showcd clear positions for each section of Litsea,
NII-Electronic Library Service