Molecular and Cytological Studies of an Interspecific Hybrid in Schoenoplectus (Cyperaceae)

2010·1.2 MB·English

by  Yano, Okihito

TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
ISSN I346-7S65 Acta Phytotax, Gcobot, 60 (3) [:41-149 (2010)
Molecular and Cytologica lStudie sof an Interspecific
Hybrid inSehoenoplectus(Cyperaceae)

OKIHITo YANol,HIRosHI IKEDAi T A K u J I H O S H I N O 2*
and
JDqpartment ofBota,UuhliversitMyiiseuJn,Uhiversityof7})dHybon,go 7-3-LBunltyo-ku,7bkyo 113-O033.Japan;

'Deepartment ofMLithemati acndaEnlvironmental Syste Smcience, Gradzaate School qf'InjTormatic sO,kayama
U}iivenyit yqfScienee, Ridtii-cho J-J .Okayama-shi, Okayama 700-OOO5 ,JZrpun ."hoshino@bigous,ac,ip
(ZiuthorforccJrresponclencoj
ITS sequence and chromosome data were used as evidence ofnatural hybridization in plants e'f Schoeno-
ptectus (Cyperacea fer)om Yawata moer, Hiroshirn Parefectur eJ,apan .The hybrids were intermediate
morphologically between both S, hotarw iand S. gemmtfe4 and S, hotaru iand S. ti"iangugatu sa,nd re-
sembled S, xtrqpezoideus. Chromosome numbers were observed to be 2n = 76 fbr S. geniniijl e2rn, ± 44
for S. hotarui ,2n =･=- 42 for S. triangulatus, and 2n = 60 for the putative hybrid .The ITS sequence data
shewed that the hybrid had sequences from both S. gemmijler <2n - 76) and S. hotaru i(2 n- 44) ,Our cy-
telogica land ITS sequence results suggested that the putative hybri dwith 2n = 60 arose by natural hy-
bridizati obnetween S. gemmij2]r (2 n- 76) and S. hotaru i(2 n== 44),
Keywords: Chromosomc number, Cyperaceae ,hybrid, ITS sequence, Sehoenopiectus
The genus Schoenoplectu s(Rchb .P)all a(C)y-and Yano & Hosh ino (2005 O)t.zen (196 r2ep)ort-
peraceae) ,includin gabout 77 species, is distrib- ed chromosome numbers of2n ::: 42 fbr three hy-
uted worldwide, mainly in marshes and other brids ,between S. tabernaemontani (C .C. Gmel,)
wetland habitat (sHayasa k2a002). Within the ge- Palla and S. triqueter (L. P)alla, between S. Ia-
nus, many natural interspeci fhiycbrids have been custris (L, )Palla and S. tabeTnaemontani, be-
reported by numerous authors (Koyama 1958, tween S. Iacustri asnd S, triqueter. Greef& Tlriest
Smith 1969, Hayasaka 2002, Hayasaka & Ohashi <1999 )and Fay et al. (2003 r)eported evidence of
2000, Yhshiro 2004, Hayasaka 2005). Hayasaka natural interspeci fhiycbrid between S. tabernae-
(2002 r)ecognized 22 hybrids in his monograph montani and S. trieuete4 based on random ampli-
of Schoenoplectzas, 12 hybrids ofwhich are mem- fied polymorphic DNA (RAPD) or amplified
bers of section Actaeogeton (Rchb .J). Raynal. fragment length polymorphism (AFLP )analysis.
Most ofthese reports were inferred to be natural Most ofthese works, however, were conducted on
interspecifi chybrids based on intermediat meor- hybrids involvin gS. tabernaeneontani, S. Iacus-
phologica lcharacters between their putativ epar- tris, and S. trigueter within section Schoenoplec-
ents and were growing sympatrically with their tus. Yiino & Hoshino (2005 r)eported that two hy-
brids,S. (Koidz.Ha)yas,& H.
putatlve parents, xtrapezoideus
Cytotogical or molecular studies ofnatural in- Ohashi and S. xuzenensis (T .Koyama) Hayas. &
terspecific hybrids and their parental species in H. Obashi, had an intermediate chromosome
Schoenoplectushave been by Otzen betweenboth in
reported number putative parents seetion
(1962)G,reef& Triest(1999F)a,y (2003),Actaeogeton, Hayasaka (2002)
et al. respectively. re-
NNIII-IE-leEcltreoncitcronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
142 AciaPhvtotax,Gcobot. vb].6e

ported that intcrsection haylbrids are not known tween the putative hybrid and Schoenoplectus
in Schoenoplectus [.Ib clarifying the parentag eof xtrapezoideu,s' and the parental species.
natural hybrids in the genus, more cytolog'ical
and moLecular studies of hybrids within section Materials and Methods
Actaeogeton, including interspecifL
rnany natural
ic hybrids (Hayasa k20a02), are neeessary, Karyomorphologica lobse'rvations were con-
Recently, nuclear ribosomal interna ltran- ducted on two individua ]osf the putative hybrid,
scribed spacer (ITS s)equences have been com- fiv eindividua losf Schoenoplectu shotarui ,two
monly used in phylogeneti canalyses and have individuals ofS. gemmijZir ,and three individuals
proven useful in lower-lev erlelationships in Cy- of S. triangulatus from Yawata moor. ITS se-
peracea¢ (Sta rert al. 1999, Hendrichs ei aL quences of the putativ ehybrids and allied species
2004a, b, Roalson & Friar 2000, 2004, Yano et ai. were determined for the one individual ofthe pu-
2004, Yano & Hoshino 2005, 2006). With ITS se- tativ ehybrid from Yawata moor, one individual
quence data it is necessary to consider the pres- of S, .uemmijbr, two individua losf S. trianguta-
ence of TTS intraspeci fpioclymorphisms, paralo- tus, and two individua losf S. xtropezoideus, We
gous copies oflTS in the genome, and pseudogene also used our previously published ITS data of
eopies of the nrDNA repeat (Roals o&n Friar sect'ion Actaeogeto nin Schoenoplectt t(sYan o&
2004). Y2Lno & Hoshino (2005 )reported that Hoshino 2005). Vbucher specimens and their lo-
po]ymorphic sequences derivcd from paralogous calities are liste din Table l. Voucher specimens
or pseudogene copies of the nrDNA were not are deposite din the herbari aofOkayama Univer-
fbund in the iTS region of the genus Schoeno- sity of Science (OKAY) and Tohoku University
plectus, but hybrids of Schoenopleetu swere not (TUS).
inc]ude din their study. In the hybrids ,the ITS se- Somatic chromosomes were observed in the
quences often show genic recombination of the rneristematic cells ofroot tips .Root tips were pre-
sequenccs from the parenta lspecies or a poly- treated in 2 mM 8-hydroxyquinoli nseolution for
morphic pattern indicati veof the presence of 1 h at 230C and then 15 h at 40C. They were fixed
both parental repeat types (Alvar e&z Wendel in acetic alcohol (1: 3fb)r more than 16 h at -2eOC
2003) ,Analyses using ITS sequences provide im- or fbr 1,5 h. The fixed roots were hydrated in an
portant evidence fbr clarifying natural hybridiza- alcohol series (70 3,0, 15%, respectively) and dis-
tion in Schoenoplectus. tille dwater, then hydrolyzed with IN HCI for 10
We found putativ ehybrids of Schoenoplectzts min at 600C, and stainedwith Ieuco-basic fuchsin
from Yawata moor in the northwestern part of Hi- fbr 1 h at 230C. The sampies were thel lmacerated
roshima Prefecture in western Honshu, Japan. in a mixture of 29, 6pectinase and 2% cellulase for
Yawata moor is situated on the Yliwata highland, 1 h at 370C, restained in 1% aceto-orcein, and
about 800 m above sea ieve l(Horika weai aL squashed.
1959) ,where S. gemmijZ]r C, Sato ,T, Maeda & Tbtal DNA was extracted from O.1 g fres hma-
Uchino, S. hotartt (iOhwi )Holub, S. nipponicus terial using a Nucleon Phytopure p) ant and fu ngal
(Makino S)ojak, S. tabernaemontani, S. triangu- DNA extraction kit CAmersha mInc,) .Amplifica-
latu s(Roxb. S)ejEk, and S. triqueter were found. tion of the nrTTS region was performed by poly-
The putativ ehybrid was morphologica]ly inter- merase chain reaction (PCR) with Taq poly-
mediate bet"fee nboth S. hotarui and S. geminijlar. merase (TaKaR aInc.) .Reactions were perfbrmed
and S. hotarui and S. triangttlatt tasn,d rescmbled using a DNA thermal cycier <Progra mTemp
S. Xtrapezoideus. Control System PC-320, Astec Inc.) for the ITS
The goal of the presen tstudy was to clarify regien, fo11owin gthe protocol of Hsiao et ai.
the hybrid origin of the putative hybrid from (1994 T)h.e entire ITS-region was amplified with
Yawata moor using chromosome and ITS se- primers ITSL (Hsia eot aL 1994) and ITS4 (White
quences data and to discus sthe relationship be- et al. 1990) .PCR products were electrophoresed
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
March 2010 YANo & .･u..-Hybri Sdpecies in Schoenoplectus 143
TABLE [ .Lecatity ,voucher, and chromosomenurnbers ofputativc hybrids andparental speices used in this study. Genbank ae-
cession numbers tiste d['o rITS data .Vouchers are deposited in OKAY andTUS. Asteris ikndicat cchsromosome numbers
from previou rseport by Yano & Hoshino (200S).
Chromosome AcccssionNo.
Taxon
number (2n ) ITS
Schoenoplectus gemmijle rC. Sato & aj.
Japan ,Hireshima PreC, Yamagata-gun, Ya-N'ata ;Hoskino & aL 19678 (OKAY) 7676
Japan ,Hiroshima Pref, ,Yamagata-gun, Yawata; Hoshino & aL 19685 (OKAY) AB523848
S.hotarui(Ohwi)Helub

Japan ,Hiroshima PreE, Yamagata-gun, Yawata; Hoshino & al. I967Zf, L967Z2 44
(OKAY)

Japan, Hiroshima Pre£, Yamagata-gun, Yawata; Hbshino & at. 19682-J ,19682-3, 44
i96S2.4(OKAY)

S.triangulatus (Roxb.S)Qtak

Japan, Shizuoka PreC, Hamamatsu-shi, Higashi-kandagawa; Kritamuxa 19556 424242 AB523849
<OKAY)

Japan ,Hiroshima Pref. ,Yamagata-gun, Yawata; Hbshino & al. i9680-2 (OKAY) AB523850
Japan ,Hiroshima Prcf, Y,amagata-gun, Yawata; Hbshino & at. JP681-1 ,IP681-2
(OKAY)

S. xtrqpezoideus (Koidz .Ha)yas. & H. Ohashi
Japan ,Miyagi Prefl ,Sendai-sh iS,aikachi; fiq})asaka 2483 (TUS) 43* AB523851
Japan, [[bchig iPrefL ,Utsunomiya-shi, Tsuruta ;?Vbgueh i20489 (OKAY) ABS23852
hybrid
Japan ,Hiroshima Pref, ,Yamagata-gun, Yawata; Hoshino & al. Ig619 (OKAY) 60 AB523853
on 1.4% agarose geis to confirm a single product, Results and Discussion
and purifie dusing a Qiaqui cPkCR purification
Kit (Qiag enInc. ).Cycle sequencing reactions Morphological characters
were perfbrmed using the purifie dPCR produLcts The putativ ehybrid from Yawata moor
and a BigDye Terminator Vl.1 Cycle Sequencing showed interrnediat emQrphological features be-
Kit (Appli eBidosystems Inc.) .For ITS sequenc- tween Schoenoplectus gemmijZi rand S. hotarui,
ing, one of the amplification primers ,ITSL and or between S. trianguiatus and S, hotartt (iTable
ITS4, or one of the internal sequencing primers 2). The intermediat emorphological characters
ITS2C (Yan oet al. 2004) and ITS3C (Yan oet al. mainly in the shape of the culms (Fi g1.) ,The
2004) were used, The products were resolved by culms of S. gemmtfer and S. trianguiatus are
capitlary electrophoresis using an ABI PRISM acutely three angled, but the culm ofS. hotaru ii's
310 automated DNA sequencer. Sequences were cylindrical. The culms of the putatiy ehybrid
assembled and edited using Sequencing Analys{s from Yawata moor are three angled (Fi g1.) .Al-
versi on 3.0 (Perk iElnmer lnc .) ,The data matrices though the S. gemmijZi rand S, triangulatus are
of the TTS sequences of the species of Schoeno- closely related, S. gemmijZi rdifTer sfrom S. trian-
plectu swere aligned using Clusta lW (Thompson gulatus in hav ing two stigmas, ljnea rleafblades,
et al. I994) and then adjusted manually as neces- and gemmae (Sat eot at. 2004) .Sehoenoplectus
sary. hotarui has three stigmas, no gemmae, and bl-
adeless leaves (Tabl 2e). The putativ heybrid from
Yawata moor has two or three stigmas, gemmae
are present or absent, and the leave sare bladeless
NNIII-IE-leEcltreoncitcronic Library Service
TThhee JJaapapnaesneSeosclee tySociety ffoorPrl anPtlSyastnetma tSlcysstematics
l44 Acttt Phytotax. Geobut. Vot. 60
TARLE 2. Morphological cornparison ofputative hybrids andparentalspeciesoi'Schoenoplectus
S. gemm4ferhybrid S. hotarui S j'uncoidesS. xtrcu)ezoldeusS, triangulaius
Culm shapc acutely3-angled 3-anglcd cyLindrieal cylindrical- 3-S-angled acutety3-angled
scvcral or
angied1-3
Culm diarneter2-S mmlinear 1-1. 5mm 1-2 minbladeless mmbladeless 1-3 mmbladeless 3-le mm
Lcafblade or bladeless bladeless
bladeless
Spikelet form ovoid or oyoid er ovoid, apex ovoid oroblong-oyoid,ovoid oroblong-avoid,oblong-evoid.
oblong-ovoid, oblong-oNoid, rouncicd apex acute
apex subacute apex subacute apex acute apex subacute
StigmaGemma 2prcsent 2or3presentor3absent 2absent 3absent 3absent
or

absent absent
A B
C D
FIG. 1. Transverse tseetions ot'culms. A: Schoenctptectu sgemmijler. B: S. trtangutatusCTShotarui, D: hybrid. E: S.Xirapezol-
deus. Bar = O.5 mm.
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
March 201O YANo & AT ,-Hybrid Species m Schoenqptectus 14S
S.'Lit.t
eepm
FIG. 2, InfieTescenc eorputatiye hybri dfrom Ya"･ata mour. Arrows indica tgeemmae. Bar ;- 5 mm.
(Tabl 2e). Linear leaf blades and gemmae are di- of these hybrids alld their putativ eparenta lspe-
agnostic charactcrs ofS. gemmijbr of sectionAc- cies overl ap.
taeogeton of Schoenoptectus T.he putativ heybrid
had gemma, and was thought to be closely related Chromosomeobservations
to S. gemmder (Fi g2.). The results suggest that The chromosome numbers determined in this
the hybrid ,with it sintermediat feeature si,s a pu- study are shown in Table 1. The putative hybrid
tative hybrid between S. gemmij1? rand S. hotarui, from Yawata moor had a ehromosome number of
Seme individual sof the putative hybrid in 2n = 60 (Fi g3.A), Chromosome numbers were
Yawata moor, howcver, had three stigmas, no observed to be 2n = 76 fbr Schoenoptectu sgem-
gemmae, and were very similar to Schoenoplec- mijZir (Fi g3,B), 2n == 44 fbr S. hotarui (Fi g3.C),
tus xtrapezoideus (Tab le2) ,Schoenopleetus and 2n =- 42 fbrS. tTiangulatus (Fi g3.D), all from
xtrapeioideors is considered to be a natural hy- Yawata moor, which confirm previous reports
brid between S. hotarui and S. triangulatus, or (Yan o& Hoshino 2005), Somatic chromosomes
between Scirpus iuncoid eRsoxb. van ohwianus orthese species were small, and ranged gradually
T. Koyama and S. triangulatus, based on mer- from O.5 to 1,3 yrn in length,
phelogica ldata (Koyam a1958, Hayasaka 2002). Koyama (195 8su)ggested that Schoenoptec-
Schoenopiectus xtrapezoideus also shows inter- tus xtrapezoideus is a hybrid between Scirpus
mediacy in the shape of culm between the puta- y'uncoides var. ohwianus and S. trianguifatus,
tive parental species (Fig .1) .The evidence indi- while Hayasaka (2002 r)eported that S. xtrmpe-
cates that discriminati ntghe two putative hybrids zoideus is considered to be a natural hybrid be-
is difficu lbte,cause the morphologica] characters tween S. hotarui and S. triangulatus .Yano &
NNIII-IE-leEcltreoncitcronic Library Service
TThhee JJaapapnaesneSeosclee tySociety ffoorPrl anPtlant SSyystsetmaetmicastics
146 ActaPhytotax.Gcobot. Vol.60

'-.'S.,.if,fi.ss. ,, ,kil･s-tlrv-i･
v ttVt tttt
enc, . t t
' titt tti･il
t
".l.
ii,;ys
,xi
tttt,v tl ...ggi.; .
"
..wlpew"
V ,/i
- ･o p "" tk3.xf ' es/
a
tt Vt.,..t t . t. :t" t... , ,.,.tt, ttt t,.t. ' 1.t , ,.-. ."bP t,l.t.t.
A B
'''//"/itt/}ili'lb-etqw.t.w,m,p･ 1
vr-esv
4gaj..,.,i,.t",･f,g"-'k'
ne.. .
"v' t ttu. lpg t
' " e ' . . " ･. E, ' ! - t-'". t/V;p" -t･tt"" eFlcX'gen,t", t.ienetttt
esc /rt.,i;::,kk 'ft ' }: /･ , 'nktftet･t,t{tttt'e.
t.. v
t
.,
pF.
lkre;gl-:lgtei;'
;tD .
C ' 'ess}ies･ "･,(vs1･･i's1 I.Lt. i".1,$.,k.,,..,.t3GW't lt. ti tit-S V･,'t w2$.SassS .eiek ,,g '{n'vsfi't'1"
FIG. 3. Photomicrographs of somatic metaphase ehremosomes efputative hybri dand parental species of Schoenopteetus. A:
hybrid (2n - 60). B: S genmTijle (r2n ; 76). C: S hotanii (2n= 44). D: S, ii'iangulatus {2n = 42).
Hoshino (2005) 2n 43 fbrS. Comparisonofnrf7S
reported ='- xtrql)e- sequences
zoideus, 2n t 42 and 44 fbr S. hotarui ,2n = 42 for The complete ITS (ITSI-5.8S-I TSse2- )
S, triangulatus, and 2n ; 74 for S. J'uncoides, quences oftwo putativ ehybrids and their putative
Thcy also suggested that S. xtropexoicleus arose parenta lspecies were 621 bp jn length .Aligned
from natural hybridizati oonr introgression be- sequences of the l3 species of section Actaeoge-
tween S. hota}"u i(2n = 44) and S, triangulatus (2n ton in Sehoenoplectus, includin gtwo putativc hy-
= 42), because S. xtrclpezoideus has a chromo- brids were 625 bp. The numbers ofpolymorphic
some number intermediat beetwcen the both pu- characters were 46 nuclcotide substitutions and
tative parent s(i. e2n. ,= 43 = 22 + 21) ,In the pres- four indels in the ITS rcgion (Tab l3)e ,Specific
ent study, the putativ chybrid from Yawata moor diagnostic sites in the ITS sequence were fbund
showed 2n = 60 and might have originated from ameng 13 species of section Actaeogeto n(Table
hybridizati obnetween plant swith 2n = 76 and 2n 3) ,The ITS sequences of S. gemmijbr (2n = 76)
= 44 (i, e2.n, = 60 = 38 - 22) .Thus, the putative and S. hotarui (2n = 44) were ditifer eantt seven
hybrid in Yawata moor is thought to be a natural nucleotide sites. The putative hybrid frorn Yawata
hybrid between S. gemmij1?r and S. hotarui ,and (2 n= 60) showcd additive nucleotidc sites, G!A or
not S. Xtrapezoidetts, T/C, ofboth S. gemme12ir (2 n= 76) and S. hotarui
(2n = 44) at all of the nucleotide substitution sites
NII-Electronic Library Service
TThhee　 JJaapapnaesneese　 SSooocieityety 　ffoorr　 PPllanatnt　 SSyystsetmaetmioastics
March　201  YANo ＆ AL．− Hybrid　Species　in　Schoenoplectus 147
TABLE　3．　Variable　sites　of　nrtTS 　sequellces　in　Schoenqptect　uscsction 　Actaeogeton．　Number 　after　eaeh 　taxon　is　chromosome
　 numbcr （2n）．　Asterisk童ndicates 山romosomc 　number 　fセom 　previou訂 eports 　by　lwasaki＆ Ueki（1979）and．　Yan  ＆ Hoshi −
　 no （2005）．
　Taxo　n（2n）　 　 Accensosi．　on　　　　　2　　　　　　8　　　　　　9　　　　　　1　0　　　　11　　　　　27L　T　S12−85　．8　S3−2］　丁　S325（　L　oc5us1　si　te52；　b　p）72　　74　　96　　87　　95　　10 
S．　komarovii（38＊） AB206261TCTCTCAGGCTCGCCCC ’
5、hondoensis （38っ AB206258TCTCTCAAGCTCGCC1 C
∫．hotarwi（42＊） 　 AB180720CTCTTCAAGCTCGCCTC
S、hotarui（44＊）　　　 AB206259 　T　　C　　T　　C　　T　　C　　A　　A　　G　　C　　T　　C　　G　　C　　C　　T　　C
∫．mucronatus （38＊） へB206263TCTCTCAAGCCCGCCTC
5．triangutatus （42〕 AB206265TCTCCCAAGTCCGCCTCCCCC
　 AABAB5AB25AB235AB2385AB2△3QA．RnソOAB8AB8ABTBTTTCCCCTTTTCCCCcc CCCCAAAAAAAAGGGGT　「 cc CCCCGGGGCCCCCCCCTTTT
　 5O5152 −
S．Xtrape 三ご，idetls〔43＊）   α 　TT 
つ」   α  
hybrid（60） 523853TCTCTCAAGCCITCAtGCCTCCCCCCT
S．gemmifer（76） 522032806242062−820627206422TTTTTCTCCCCTCTTTTCTCCCCTCTTTTCCCCCATAAAGAAAAAAAGGGCCCCCCTTCTCCCCCCCCCCTAAAGGGCCCTTCCCCCCTTTTTTT
5661b
・9．伽 ”isetu．s’（7 ＊） ゾ．
＆脚 〃c魴 （72＊） 002
S．ノunc ‘，ides（74＊） ∫
5」lineoiatu（s74＊） 【U 0 τ
144　157　　177　185　200　211　385　389　394　395　417　423　442　443　459　477　484CCCCCCCC
∫．komaro レ〃（38＊） 　 AABABA2BA20BA106BA286BA2200BA26206BA755106BA22582BA25502BA26592BA86C32BA845CBA859BCA85BC5BCCCCCCCCCCCCCC．CCC CCCCCCCCCCCTCCCCCCCCCCCCCTGCGGGAGCGCGCGCGCCCCCCCCCCCCCCC　CCCCCCTGTGTGGGGCGCGCGCGC　CCCTCTCTCCCCCCCCCCCGCGCGCGCGGCGCGCGCGCCCCCC
s、hondve’nsis （38＊）　 CCCCCCCCC 　 　
∫．hetarui（42＊） 　 　 　
∫．hotarui （44＊） 　 　 　
1・9．．9mi吻”crngounlaattus’us （3（482＊））　　 6．3333 　　 　　
．

　 O12   　 　 ．
＆ Xtrqpezoi ゴα’1∫（43＊） CC αTT CC∬ CC
α π
hybrid（60） 523853CCCCCCGCCCAIGCC 〆TCGCCCTCCCC
・
5」ge〃imPtes （76） 5220320．2804220520826724　262C07CCACCCCCTTCCCCCCCTCCCCCTCCCCCCCCGCGGGGCGCCCCCTCCCCCTCCCCAC CCCCCCT． CCCCCGTGGGGCACCAAC
6 　 へ CCCCC
s．　n’iZtlti．s’etus （70幸） 0／666、　 GGGA
s．waUichii （72＊） 66 　 ．
S．ノuneoides 〔74り ．　 CC
S．iineelatus（74＊） 6一｝
493　494　499　516　523　537　546　559　560　578　584　588　592　5t）3　599　620
＆ komarovii（38っ AB2 （］6261 − CTTC − CGCGC − TTC −
∫．hondoen ．sis （38っ　　〆、B206258 　 −　　C　　T　　T　　C　　−　　C　　G　　C　　G 　　T　　−　　T　　T　　C　　−
S．hotartt（i42＊）　　　　ABI80720　　−　　C　　T　　T　　C　　−　　C　　G 　　C　　G 　　T　　−　　T　　T　　C　　−
S．hotar”i（44＊）　　　 AB206259 　 −　　C 　　T　　T　 C 　　−　　C 　 G 　　C　 G 　　T　　−　　T　 T　 C　　−
SS，．nteruica厂ngσuna！rautsus （（3482＊））　　　AABB220066226653　　 −−　　　　CC　　　　TT　　　　TT　　　　CC　　　　−−　　　　CC 　　　　GG 　　　　CC 　　　　AG 　　　　CC　　　　−−　　　　TT　　　　T’r　　　　CC 　　　　−−
　 　 　 　 AB523849 　　−　　C　　T 　　T 　　C　　−　　C 　　G 　　C 　　G　　C　　−　　T　　T　　C　　−
　 　 　 　 AB523850 − CTTC − CGCGC − T．TC −
S．xtrapeze ゴdetts（43＊）　AB523851　 −　　C　　T　　T　　C　　−　　C　　G 　　C　　G 　C／T　 −　　］　 T　　C　　−
　 　 　 　 AB523852 − 　CTTC 　− CGCG αT − 　TTC 　一
hybrid 〔60） AB523853　 −　　C　　T　　T　 CIT　　　　C　　G　　C　　G　CIT　 −　　T　　T　　C　　一
∫．ge〃t〃躍ノと7’（76） AABABSAB2A2B3A20B82Bム∪422822572142　06260r　2−一O　6　CCC　　TTT　TT　ATTT　TA　TTTC　CC　C　−一　　CCC　CC　TGGG　TT　GCCC　TT　CGGG　GG　GCCC　TT　C　　一一　　TTT　C　TTTTT　AA　TCCC　CC　A　一一
∫．　mu ！〃setus 〔70＊）  6666 一 　一 　一 　一
5  waUichii （72＊） OOO A τ C A A
S．ノuncoides （74＊） 一 CC 一 一 −
S．lineotatu（s74＊） 一 　一 　一 　一
一
NNI工I工-EElleoetcrotniroonic　 LLiibrbarryary 　Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
148 Acta Phytotax. Geobet. Vol.60

except fbr one at sequence position 200 (Tabl 3e). at six sites. However, sequence positio n200 did
An ITS sequence with the additive state ofthe pa- not show an additive state, which was expected
rental sequences fbr hybrids species al so has been from the combinations of the putativ eparental
reported in Paeonia L. (Paeoniac e(aSea)n get al. species, These observations suggest that S, hota-
1995) and xCrE7Jidiastrixeris Kitam. (Asterace-rui (2n = 44) has nuc]eotide polymorphisms at
ae) (Sai teot al. 2006). They reported that this this site. Tb clarify the origin of these hybrids
phenomenon in the nrlTS sequences in hybrids without a doubt, additional ITS sequences of
might refiect their origin from diffbren ptarenta] rnore individual os'f S. hotarui (2n = 44) need to
species. Our sequence results also suggested that be determincd.
the putativ ehybrid from Yawata (2n =' 60) arose In Schoenoplectus G,reef& Tries t(199 9su)g-
by natural hybridization between S. gemnetfe r(2n gested natural interspeei fihcybridizati onbc-
= 76) and S. hotant i(2n - 44). tween S, tabernaemontani and S. triquete4 based
The ITS sequences ofSchoenoplectus hotarui on RAPD analysis, Fay et aL (2003 a)tso suggcst-
(2 n== 44) and S. hondoensis (Ohwi )Sojak (2n ･--･ ed natural interspeci fhiycbridizati obnetween S.
38) were almost the same. The combination ofthe tabernaemontani and S, triqueter using AFLP
ITS sequences ofS. hotarui (2n = 44) and S. hon- analysis. In our study, molecular and cytological
doensi (s2n = 38) can explain all six additive sites combination data provided clear evidence fbr nat-
of the putative hybrid perfectl yS.choenoplectus ural hybridizati oinn SchoenqJlectus. The ITS
hondoensis ,however, is mainly distribut ed{n sequence data proved usefu1 for demonstrating
marshes in the high mountains of nerthern Hon- the origin of hybrids in Cyperaceae.
shu (Hayasak a2002), while S. geinmijZ? "is main- Our cytological and molecular data show the
ly distribut eidn wetlands and low mountains of putativ ehybrid from Yawata moor to be a natural
western Japan (Kitamu reta al. 2009). It is thought hybrid between Schoenoplectu sgemmijZrr and S,
that S. hondoensis and S. g .emm(fer do not grow hotarui ,and not S. xtrupezoideus, Schoenoplec-
sympatrically. Thus, the putative hybrid in Yawa- tus gemmijbr is a new species recently described
ta moor is believe dto be a natural hybrid between from Kumamoto Prefecture by Sato et aL (20e4).
S. S.hotanti, betweenS. NaturalhybridsbetweenS. S.hota-
gemmijZir and and not gemmijlar and
gemmijbr and S. honcloensis. rui are thought to be derivc dfrom a new parental
Schoenqplectu sxtrmpezoideus (2n = 43) alse combination. Morphologica lfeatures between
showed additions, GfA or TfC, at the six sites (Ta- the hybrids from YAwata moor and S. xtTapezoi-
ble 3) ,indicatin git shybridit yT.hese additive deus overlap. Further morphological analysis is
sites can be explained by the combination of S. needed before dcscribing these plant sas a new
hotarui (2n = 44) and S. triangulatus (2n = 42), natural hybrid between S. gemmij2ir and S. hota-
200, in
with one exception at sequence position as rui.
the new putativ ehybrid firo mYawata. Although
S. hondoensis has nearly the same ITS sequence The authors thank Dr. E. Hayasaka, Dr. H. Tsubota ,Dr.
as S, hotarui t,he invelvemen tofS. honcloensi isn K. 1<{tamur aM,r. T. Saito ,and Mr. T. NogLLchi for their
the origin of S. xtrapezoideus may be unlikely, grcaL help in collecting or offering plant materials.
since S. hondoen,s' hiass a chromosome number of
References
2n = 38 (Yan o& Hoshino 2005). !n this study,
IxtT"Scr pezdoiadetusa also (s2upn p=or t4s3) rntihgeht p hoasvsei bariislein tt ybhya t hyS-. A l s ,esa raned zI, ,p&l aJn. tF p, hVy"l'egecnndee t2Li0c0 3i.n fReirbconscocm .uM!ol .I TPSh ys[eqougenecn-et,
bridizati obnetween S. hotarui (2n = 44) and S. EvoL 29: 417･434.
trianguiatzts C2n ='- 42). Fay, M. F, ,R. S. Cowan & D. A. Simpson. 2003. Hybrid-
The ITS sequences data of putativ ehybrid ization betwccn Schoenoplectu stabernaeJnontani
fxtrroapmez oidYeta{swata ((22nn == = =4 36) 0sh)o weadnd aSnc hadodietnivoepl estcaitues G re eaTnCsd lBe .Ss ..WD a.t tr&isq ouLen.t ieTar r2 i4(c/ Cs4y t3p31.-9e -9r49a4 .Tc2h.eca seups)cec ioefs rainnd oitnhc Bamrpilit-ish
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
March 2010 YANO & A1..--Hybrid Species in S[,hoenoplectus l49
fie dpolymorphic DNA (RAPD) fbr hybrid detection Acro(),st (isCypeTace uasineg) nrDNA ITS and ETS
in Scirpus from the rivcr Schelde (Belgium )Mo,], sequcnce data .Plan tSyst ,Evol. 243: 175-187,
Ecol ,8: 379-386, Saito, Y., M. Mo]ler, G. Kokubugata, T. Katsuyamu, W.
Hayasaka, E. 2002. Taxonemie Revisio nof the Genus Marubashi & T. Iwashina. 20e6. Molecular ev idcnces
Schoenopleetu s(Cyperace awieih), Special Refor- for repeatcd hybridizati oevncnts as the origin of the
ence to Nutle tMicrotnorpholog yD.octora lthesis ,[Ib- genus xCrepidiastrixeris (Asterace ausei)ng RAPDs
hoku Univ., Sendai. and ITS data .Bot J .Linn. Soc. 151 :333-343.
Hayasaka, E. 20e5. A ne",' combination in Japanese Sttng ,T., D. J. Crawford & T, F. Stuessy. 1995, Documen-
Schoenopteetu (sCyperace Ja. eJ)ap. .Bot, 80: 308, tation ofrcticulate evolution in peenie s(1'aeon iusq-)
IIayasaka, E. & H, Ohashi. 2000. New combinations in ing internal transcribed spacer sequenecs of nuclear
Japanese Schoenoj)iect u(bC'yperace aJ. eJ)a.p. Bot. ribesoma] DNA: Iniplication sfor biogeography and
75: 223-225. concerted evolution. Proc. Natl. Acad. Scl ,USA 92:
Hendrichs ,M., F. Oberwinkler .D. Bcgerow & R. Bauer. 6813T6817.
2004a. Carex subgenus Carex (Cyperace aa pehy)lo- Satq C., T. Maeda & A. Uchino. 2004. A new species of
geneti capproach using ITS sequences, Plant Syst, Schoenql)lectus sect. Actaeogeion (Cyperacea eJ)..
Evol, 246: 89-107. Jap, Bot. 79: 23-28.
Hendrichs,M.,S,MichalskiD,.Begerow, F,Oberwinkler Smith,S,G. 1969.NaLuralhybridizationinthe Scirpus

& F.H.Hellwig.20e4b.Phylogenetic in lacustris in UnitedStatesi.n:
relationships complex north central
Carex, subgenus Vignea (Cyperacea eba)s,ed on ITS Guncke], J. E, (ed. C)u,rrent Topics in Plant Science,
sequences, PLanL Syst .Evel. 246: 109-125. pp. I75-200, Academic Press, New York.
Horikawa, Y,, H. Suzuki, H, Ybkogawa & T, Matsumura. Starr ,J, R., R, J, Bayer & B, A, Ford. I999. Thc phylogc-
1959 .Moorland vegetatien in tbc Yawata Highland, netic positio onfCarex section Ph.vllostac haynds ITS
in the northwestern part of Hireshima Prefectur eS.. implicati oInbr phylogeny and subgeneric circum-
W. Japan. in: Hiroshima Pret'ectura Bloard ofEduca- scription in CZxrex (Cyperacea eA)me,r, J. Bot, 86:
tion (ed. )S,cientif iRcesearches of the Sandankyo 563-577.
Gorge and Yawata Highland ,pp. 121-152 .Hiroshi- Thompson, J. D., D. G. Higgins & T. J. Gibson. 1994,
ma. (i nJapanese) ClustalW :improving the sensitivity of progrcssive
Hsiao, C., N J, Chatterto nK,, H. Asay & K, B. Jensen. multiple scqueocc alignment through sequence
1994. Phylogenetic relationships ef 10 grass specics: weighting, position-spec igfaipc penalti easnd weight
an assessrnent ofphylogenetic uti]ity of the internal matrix choice. Nucl. Acids Res. 22: 4673-4680.
transcribed spacer region in nuclear ribosomal DNA White, T, J. ,T, Bruns, S. Lee & J .Taylor .]990 .Amplifi-
in Monocots. Genome 37: 112-120. cation and direc tsequenciiig of fungal ribosomal
T"iasaki ,K. & K. Ueki. 1979, Chromosomc numbers of RNA genes for phylogenetjc bsv.: Tnnis, M. A,, D. H.
three bulrushe s(Scii' ptaux,a)s, J, Wecd Sci ,Tkichnol. Gelfand, J. J. Sninsky & T, J. Whitc (eds. P)C,R P:o-
24: 240-242, (inJapan weitshe English abstract) tocols ,a Guide to Mcthods and Application sp,p.
Kitamura, K., J. YOshimura, K. Tainaka & S. Ybkojima. 315-･32 2.Academic Press, New York.
2009. Potenti ailmpact soffiooding events and strearn Yano, O. & T. Hoshino, 2005, Molecular phylog¢ny and
modification on an endan.oered endeinic p]ant, chremosornal evolution of japanese Schoenoptectus
Schoenoplectu sgenemijla r(Cyperacc aEeco)l. .Res. (Cypcrace abaes)e,d on ITS and ETS lf sequences,
24: 533-546. A c t a P hvtotax .Geobot. S6: 183-195.
J
Koyama, T. 1958. Taxonomic study of the genus Scirpus Yano, O, & T, Hoshino. 2006. Phylogenetic relationships
Linne. J. Irac ,Sci. Univ. Tbkyo, Sect .3, Bot. 7: 271- and chromesomal evolution of Japanes eFimbristyIis
366, (Cyperace usaineg) nrDNA ITS and ETS lfsequence
Otzen, D. 1962. Chro[nesorne studies in the genus Scir- data .Acta Phytotax. Gcobot, 57: 205-2!7.
pus L. section Schoenopl'eNceteursl .Benth. et Hook. il lthe Yano, O., T. Katsuyama, H. Tsubota & T. Hoshino .2004.
Netherlands, Acta Bot 11 :37-46. Molecular phylogeny ofJapanese Eteocharis (Cyper-
Realson ,E. II .& E. A. I'ria 2r0.00. Infrageneric classifi- aceae) based on ITS sequence data, and chromosomal
cution ofEleocharis (Cyperace reaviesj)tcd: evidence evelution. J .PI .Res. 117: 409-419.
from the internal transcribed spaccr <ITS r)egion o'P YashiTe, K. 2004. Schoenep]ectus >liuncohotai"uiYashiro
nuclear ribesomal DNA. Syst .BoL 25: 323-336. <Cyperace aa ene)w, hybrid from Chiba Prefecture,
Roalson ,E. H. & E. A. Friar 2.004, Phylogenetic relation- Centra lJapan .J .Jap .BoL 79: 96-]OO.
ships and biegeegraphic patterns in Carex section
Reeeived October S, 2009; accepted februaT. v5, 2010
NNIII-IE-leEcltreoncitcronic Library Service