Table Of ContentARTICLE
OPEN
Received29Nov2013|Accepted10Sep2014|Published31Oct2014|Updated26Feb2015 DOI:10.1038/ncomms6214
miR-24 limits aortic vascular inflammation and
murine abdominal aneurysm development
Lars Maegdefessel1,2,*, Joshua M. Spin1,3,*, Uwe Raaz1, Suzanne M. Eken2, Ryuji Toh1, Junya Azuma4,
Matti Adam1, Futoshi Nakagami1, Helen M. Heymann1, Ekaterina Chernogubova2, Hong Jin2, Joy Roy5,
Rebecka Hultgren5, Kenneth Caidahl5, Sonja Schrepfer6, Anders Hamsten2, Per Eriksson2,
Michael V. McConnell1, Ronald L. Dalman7 & Philip S. Tsao1,3
Identification and treatment of abdominal aortic aneurysm (AAA) remain among the most
prominent challenges in vascular medicine. MicroRNAs (miRNAs) are crucial regulators of
cardiovascular pathology and represent intriguing targets to limit AAA expansion. Here we
show, by using two established murine models of AAA disease along with human aortic
tissueandplasmaanalysis,thatmiR-24isakeyregulatorofvascularinflammationandAAA
pathology.Invivoandinvitrostudiesrevealchitinase3-like1(Chi3l1)tobeamajortargetand
effectorunderthecontrolofmiR-24,regulatingcytokinesynthesisinmacrophagesaswellas
their survival, promoting aortic smooth muscle cell migration and cytokine production, and
stimulatingadhesionmoleculeexpressioninvascularendothelialcells.Wefurthershowthat
modulationofmiR-24altersAAAprogressioninanimalmodels,andthatmiR-24andCHI3L1
represent novel plasma biomarkers of AAA disease progression in humans.
1DivisionofCardiovascularMedicine,StanfordUniversity,FalkCVRB,300PasteurDrive,Stanford,California94305,USA.2CenterforMolecularMedicine
L8:03,DepartmentofMedicine,KarolinskaInstituteandUniversityHospital,Stockholm17176,Sweden.3VAPaloAltoHealthCareSystem,3801Miranda
Avenue,PaloAlto,California94304,USA.4CenterofMedicalInnovationandTranslationalResearch,DepartmentofClinicalGeneTherapy,OsakaUniversity,
2-2Yamada-oka,Osaka565-0871,Japan.5CenterforMolecularMedicineL8:03,DepartmentofMolecularMedicineandSurgery,KarolinskaInstituteand
UniversityHospital,Stockholm17176,Sweden.6TransplantandStemCellImmunologyLaboratory,UniversityHeartCenterHamburg,Martinistra(cid:2)e52,
Hamburg20246,Germany.7DivisionofVascularSurgery,StanfordUniversity,300PasteurDrive,Stanford,California94305,USA.*Theseauthors
contributedequallytothiswork.CorrespondenceandrequestsformaterialsshouldbeaddressedtoP.S.T.(email:[email protected]).
NATURECOMMUNICATIONS|5:5214|DOI:10.1038/ncomms6214|www.nature.com/naturecommunications 1
&2014MacmillanPublishersLimited.Allrightsreserved.
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/ncomms6214
A
bdominal aortic aneurysm (AAA) is a common, often miRNA or miRNA cluster (Fig. 1b; and Supplementary Figs 1D
asymptomatic, potentially lethal disease. No pharmaco- and 2A). Of these genes, 63 were predicted targets of miR-24
logical approach has successfully decreased expansion or alone (Supplementary Fig. 1D). Each cluster member was
preventedruptureofAAAinhumans1.microRNAs(miRNAsor individually downregulated with AAA. We analysed the
miRs) are key post-transcriptional gene regulators in health and 30-untranslated regions (UTRs) of all significant upregulated
disease, typically altering the translational output of target AAA genes for miRNA-target seed-hexamer enrichment
messenger RNAs (mRNAs) by promoting degradation or using DIANA-mirExTra. Of all the downregulated individual
preventing translation2. miRNA mimics and antagonists are miRNAs, miR-24 had the most significant negative correlation
capable of modulating entire functional networks, suggesting with upregulated genes (Fig. 1c)11.
significant therapeutic potential3. The miR-23-27-24 gene cluster occupies two genomic loci in
Tissue inflammation and remodelling are central elements in mice and humans. One is intronic (mouse-chr13; human-chr9:
vascular pathogenesis and AAA expansion. Many inflammatory miR-23b, miR-27b and miR-24-1) and the second is intergenic
cellsubtypesarefoundinhumanAAAtissue,macrophagesbeing (mouse-chr8;human-chr19:miR-23a,miR-27aandmiR-24-2)12.
the most common4. In animal AAA models, macrophage Mature miR-24 sequences are indistinguishable by quantitative
accumulation in the aortic wall is one of the most consistent reverse transcription PCR (qRT–PCR). Pri-miR-23b, -27b
features from initiation to advanced aneurysm formation1. and -24-1 may be transcribed independently from the cluster
Further, numerous macrophage-secreted cytokines and gene in mice, although pre-miR-23b may be co-transcribed
chemokines play important roles in human AAA5–7. For the with pre-miR-27b and pre-miR-24-1 (ref. 13). We measured
current study, we utilized miRNA and gene expression miR-23b-24-27b cluster expression in infrarenal aortic tissue
microarrays to identify novel contributors to AAA development. during the AAA time course. miR-24 remained significantly
We find that aortic aneurysm progression is associated with downregulated at three time points (days 7, 14 and 28;
downregulation of the miR-23b-24-27b cluster in murine AAA Fig. 1d), while miR-23b and miR-27b were downregulated
models, with miR-24 displaying the most significant inverse only at day 7, supporting independent release of individual
regulation of its predicted targets in array profiling studies. miRNAs from the cluster-transcript. Further, qRT–PCR from
Human AAA also display miR-24 downregulation, correlating days 3 and 7 showed that pri-miR-24-1 (not pri-miR-24-2) was
inversely with aneurysm size. Among the most consistent and substantially decreased in aneurysmal tissue (versus sham;
highly regulated miR-24 targets in murine AAA is a mediator/ Fig. 1e).
markerofinflammation:‘chitinase3-like1’(Chi3l1).Weexplore In situ hybridization (ISH) showed diminished miR-24
miR-24 regulatory mechanisms, and show that miR-24 regulates expression throughout the aneurysmal aortic wall of PPE mice
inflammation and other critical aneurysm-related processes in a (versus sham and untreated controls; Fig. 1f).
CHI3L1-dependent fashion in M1-subtype macrophages, aortic
smooth muscle cells (SMCs) and vascular endothelial cells.
miR-24 target-genes in AAA models. We examined the
Further, we demonstrate that in vivo miR-24 modulation affects
expression of the eight most significantly upregulated miR-24
murine AAA progression, suggesting that miR-24 downregula-
target mRNAs (from microarray) at baseline and three different
tion contributes to aneurysm growth. In contrast, miR-24
time points during PPE-induced AAA development. Chi3l1,
overexpression mitigates AAA, suggesting therapeutic potential.
which belongs to the chitinase-like protein family and is a
Additional studies suggest that miR-24 and CHI3L1 are novel
potentialchronicinflammatorydiseasebiomarker14,wastheonly
plasma biomarkers of human AAA disease progression.
topmiR-24targetgenesubstantiallyalteredatalltimepoints,and
showing a complimentary negatively correlated trend versus
miR-24 (Fig. 1g,h). We also measured the expression of seven
Results
previously validated miR-24 target genes15,16 (Supplementary
miR-23b-24-27b cluster in murine AAA. We profiled miRNA
Fig. 2B,C). All were upregulated exclusively at day 7, leaving
expression in the porcine-pancreatic-elastase (PPE) infusion
Chi3l1asthemostcompellingmiR-24targetduringmurineAAA
model in 10-week-old male C57BL/6J mice. The incidence,
development.
growthrateandsizeofaneurysmalexpansionweremeasuredby
We confirmed the above results in another AAA model,
ultrasound (US) at 3, 7, 14, 21 and 28 days after PPE infusion
systemically infusing angiotensin II (ANGII) into 10-week-old
compared with sham (saline-infused) mice (Fig. 1a; Supplemen-
male ApoE(cid:2)/(cid:2) mice over 28 days. Compared with saline-
tary Table 1 and Supplementary Fig. 1A,B). PPE-induced AAA
infused controls, the suprarenal abdominal aortic diameter
size differed from sham by day 7. Therefore, we harvested day 7
(AAD) significantly increased with ANGII by day 7 (Fig. 2a
infrarenal aortic tissue for gene and miRNA microarrays.
and Supplementary Table 2). As expected for this model, the
When comparing PPE-treated AAA with sham, 41 miRNAs
mortality rate due to aortic rupture and dissection was
were upregulated with aneurysm and 37 were downregulated
significantly higher in ANGII mice (28%) versus saline controls
(41.5-fold; Po0.05, moderated t-testing with Benjamini-Hoch-
(0%). Again, miR-24 was the only member of the miR-23b-24-
bergFDRcorrection)(SupplementaryFig.1CandFig.1b).These
27b cluster to be significantly downregulated at all three time
includedmiRNAspreviouslylinkedtovasculo-pathology,suchas
points (days 7, 14 and 28) during aneurysm development
miR-21 (increased with aneurysm) and members of the miR-29
(Fig. 2b). Chi3l1 expression was again negatively correlated
family (decreased)8–10.
(increased) with miR-24 expression (Fig. 2c). As expected and
Gene expression analysis identified numerous up- (2,775) and
previously reported by others17, ANGII treatment raised blood
downregulated(2,296) genesatfalsediscovery rate(FDR; o1%)
pressure values significantly. No blood pressure alteration was
in PPE-treated aortic tissue (versus sham). We cross-correlated
detectable with PPE-induced AAA induction (Supplementary
miRNA and mRNA expression changes with aneurysm develop-
Table 3).
ment, identifying which differentially regulated miRNAs
showed the most negative correlation with predicted target-gene
expression (Targetscan.org), implying biological relevance. miR-24 and its target Chi3l1 regulate inflammation. ISH for
The miR-23b-24-27b cluster had the largest number of miR-24 and immunohistochemistry (IHC) using anti-F4/80
negatively correlated targets (213) of any differentially regulated (a macrophage inflammatory marker) revealed that miR-24
2 NATURECOMMUNICATIONS|5:5214|DOI:10.1038/ncomms6214|www.nature.com/naturecommunications
&2014MacmillanPublishersLimited.Allrightsreserved.
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/ncomms6214
Sham PPE
mmu-miR-145
mmu-miR-193b
mmu-miR-143
%) 200 mmmmuu--mmiiRR--445816 40
D versus baseline ( 111864000 PSPhaEm * * * * mmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmmuuuuuuuuuuuuuuuuuu------------------mmmmmmmmmmmmmmmlmmetiiiiiiiiiiiiiiiiiRRRRRRRRRRRRRRRRR-7-----------------d21332233223132311-9407470749000364sc0a8-ba8cc1cb50t1a-----as2sss-rstttt-aaaatsartrrrarr No. of miRs231000 miR-27mbiR-23b miR-24
AA 120 mmmmmmuuu---mmmiiiRRR---213600b0e-star
mmu-miR-10a
mmu-miR-23a 0
100 mmu-miR-203
mmu-miR-30d
Baseline Day 3 Day 7 Day 14 Day 21Day 28 mmmmuu--mletiR-7-e27a 0 1 2 3 4 5 6
mmu-miR-26a
mmmmuu--mmiiRR--210945 –In (P-value)
mmu-miR-151-5p
mmu-let-7c
m 0 Pri-miR-24-1 Pri-miR-24-2 Control Sham PPE
ha –0.5 m 0
s a
nge versus –1––.215 * * e versus sh ––01–..155
Fold cha ––23–..355 mmmiiiRRR---222374bb * * * Fold chang –2––.235 * *
Baseline Day 7 Day 14 Day 28 Day 3 Day 7
us sham 678 MBVPacradvlr2m1cl1k1s1l1 * * * * us sham 456 CMSLithmmai3cdp2I2114 * * * * *
ers 5 ers *
nge v 34 nge v 23 * *
a a
h 2 h
d c 1 d c 1
ol ol
F 0 F 0
Baseline Day 7 Day 14 Day 28 Baseline Day 7 Day 14 Day 28
Figure1|miRNAsinmouseAAA.(a)Abdominalaorticdiameter(AAD;in%versusbaseline)expansioninporcine-pancreatic-elastase(PPE)-induced
AAAcomparedwithsham-operatedmice.(b)SignificantlydownregulatedaorticmiRNAs(miR-23b-24-27bfamilyhighlighted),7daysafterPPEinduction,
comparedwithsham.(c)DIANA-mirExTrahistogramcorrespondingto(b),rankingdownregulatedmiRNAsby (cid:2)ln(Pvalue):theprobabilitythat
theirtargethexamersarefoundmoreoftenin30UTRsofdifferentiallyupregulatedmRNAsthaninunchangedgenesbyWilcoxonRankSumTest
(miR-23b-24-27bfamilyhighlighted).(d)miR-24istheonlymiR-23b-24-27bfamilymembersignificantlydownregulatedinaortictissueatallthree
differenttimepointsduringPPE-inducedAAAexpansion.(e)Aorticpri-miR-24expressionat3and7daysafterPPEinductionofAAAcompared
withsham.(f)ISHformiR-24(purplechromagen)inuntreated(control)aorta,shamandPPEat14daysafterAAAinduction(scalebar,400mm).
(g,h)Expressionofthemostsignificantupregulated(day7)miR-24targetgenesatalltestedtimepointsduringPPE-inducedAAAexpansion(versus
sham).n¼5–8foreachgroupandtimepoint.Dataaremean±s.e.m.*Po0.05versusshamanalysedwithanalysisofvariance(ANOVA;one-way
repeatedmeasuresANOVAforFig.1a)andBonferroni’sposttest.
co-localized with activated macrophages in aneurysmal aortic macrophagemiR-24withIL-6stimulationwereduetoreductions
mouse tissue (post-PPE day 7; Fig. 2d). miR-24 expression was in pri-miR-24-1 (Fig. 2f). Further, IL-6 treatment increased
also visualized in the aneurysm intimal–medial region. Double expression of Chi3l1 (Fig. 2g).
immunofluorescenceofthevascularSMC-markera-actin(SMA) Macrophage miR-24 expression was modulated through
and F4/80 with Chi3l1 indicated co-localization (orange in transfection with either an antagomiR (anti-24) to inhibit or a
merged images) of Chi3l1 with both SMCs and macrophages pre-miR (pre-24) to overexpress miR-24 (versus scrambled-miR
(Supplementary Fig. 2D). control; scr-miR). In both macrophage lines, anti-24 augmented
We explored the regulatory role of miR-24 on inflammation theIL-6-inducedChi3l1increase,whereaspre-24counteredIL-6,
and CHI3L1 expression in HEK293 and aneurysm-related cell drivingChi3l1expressionbelowscr-miR-treatedbaseline,further
types in vitro. First, via HEK293 transfection, direct suppression confirming miR-24 regulation (Fig. 2g and Supplementary
of CHI3L1 transcription through 30UTR binding of miR-24 was Fig. 3A). miR-24 downregulation was pro-inflammatory in
confirmed by luciferase assay (Supplementary Fig. 2E). Next, macrophages, augmenting expression of mediators Tnf-a and
peritoneal macrophages obtained from ANGII–AAA mice and Ccl2/Mcp-1 (Fig. 2h). This process involved Chi3l1, as simulta-
untreated mice were stimulated with recombinant interleukin neous 475% short interfering RNA (siRNA) knockdown
(IL)-6 to induce inflammation. Parallel experiments utilized the (siChi3l1) reduced anti-24-induced increases in inflammatory
murine macrophage cell line, RAW 264.7. IL-6 treatment gene expression (Fig. 2h). These results suggest that IL-6
decreased miR-24 expression compared with control cells at (abundant in developing AAA) decreases miR-24-1 expression
two time points (Fig. 2e). As observed in vivo, decreases in in macrophages, leading to a rise in Chi3l1. This combination
NATURECOMMUNICATIONS|5:5214|DOI:10.1038/ncomms6214|www.nature.com/naturecommunications 3
&2014MacmillanPublishersLimited.Allrightsreserved.
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/ncomms6214
AAD versus baseline (%) 111112224068020000000 ASNalGinIeI con*trol * * Fold change versus sham–––102––...021555 mmmiiiRRR---222347bb * * * * * Chi3l1 fold change versus sham 2301....455231550 * * *
Baseline Day 7 Day 14 Day 28 Baseline Day 7 Day 14 Day 28 Baseline Day 7 Day 14 Day 28
AdventitiaIntima/media miR-24 fold change versus untreated –––210––...502155 * * IILL--66 ffoorr 1224hh* * Fold change versus untreated––––––––01111000–........2801642864 Pri-m*iR-24-1 Pri-miR-24-2
Peritoneal macrophages RAW 264.7
Chi3l1 fold change versus untreated –––34567321012 21*42 hh* * * # # # # Fold change versus control 01234.....01234555555 IILL--66 ++# asinCtih-2i34I1 + anti-24 # * miR-24 fold change versus untreated ––––2103––––....32155505 *
IL-6 IL-6 + scr IL-6 + anti-24 IL-6 + pre-24 Tnfa Ccl2
Figure2|miR-24expressionanddownstreameffectsinangiotensinII-inducedAAAsandinvitro.(a)Abdominalaorticdiameter(AAD;in%versus
baseline)expansioninangiotensinII(ANGII)-inducedAAAcomparedwithsaline-infusedcontrolmice.(b)miR-23b-24-27bsupra-renalaortictissue
expressioninANGIIcomparedwithsham(salinecontrol).(c)AorticChi3l1expressioninANGIIcomparedwithsham.(d)miR-24(purplechromagen)is
co-localizedwithChi3l1protein(brown)inPPE-inducedAAA,7daysafterAAAinduction(‘L’indicatestheluminalside).High-magnificationinsetshows
co-stainedmacrophage.(e)miR-24expressioninperitonealmacrophagesandRAW264.7cells,stimulatedwithinterleukin-6(IL-6)foreither12or24h
(versusuntreated).(f)pri-miR-24expressioninIL-6-stimulatedRAW264.7cells(24h).(g)Chi3l1expressioninIL-6-stimulatedandmiR-24-modulated
RAW264.7cells(at12and24h).(h)Cytokinegenefold-changeinIL-6-stimulatedandanti-miR-24±siChi3l1-transfectedRAW264.7s(24h).(i)miR-24
expressioninIL-6-stimulatedhumanaorticSMCs(24h).n¼5–9foreachgroupandtimepoint.Dataaremean±s.e.m.*Po0.05versussham(saline
controls).#Po0.05versusuntreated/controlandothertreatmentgroupsanalysedwithanalysisofvariance(ANOVA;
one-wayrepeatedmeasuresANOVA)andBonferroni’sposttestorStudent’st-test(two-tailed;Fig.2i).
augments macrophage activation, increasing inflammatory dose-dependently increases JNK and ERK phosphorylation
cytokines. in human aortic SMCs (Supplementary Fig. 4A,B).
These same cellular responses were also observed in cultured Appropriately, similar effects on JNK and ERK phosphorylation
primary human aortic SMC. IL-6 stimulation decreased miR-24 were also observed after miR-24 modulation (Supplementary
(Fig. 2i) and increased CHI3L1 expression (Fig. 3a). As in Fig. 4C,D). Further, treatment with CHI3L1 dose-dependently
macrophages, miR-24 modulation in SMCs altered CHI3L1 increased aortic SMC migration in vitro (Supplementary
expression (Fig. 3a). SMC transfection with anti-24 induced Fig. 4E).
(and pre-24 inhibited) inflammatory gene expression (for We next examined the effects of miR-24 and Chi3l1 on
example, CCL2 and IL-8; Supplementary Fig. 3B,C). Further, macrophage survival. Overexpression of miR-24 in peritoneal
recombinant CHI3L1 treatment of SMCs led to dose-dependent macrophagesandRAW264.7increasedapoptosis(AnnexinVþ
increases in inflammatory gene expression (Fig. 3b). CHI3L1 and caspase 3/7 assays) beyond that seen with IL-6 stimulation
treatment increased CCL2 expression, a response augmented by alone, while anti-24 abrogated the pro-apoptotic effects of IL-6
IL-6 (Supplementary Fig. 3D). Again, successful siCHI3L1- (Fig. 3d,e). These effects on macrophage survival were also
mediated knockdown in SMC largely eliminated pro-inflamma- detectable in peritoneal macrophages derived from mice without
tory effects of anti-24 (Fig. 3c). Successful miRNA modulator ANGII-inducedAAA(Fig.3f).Further,treatmentofRAW264.7
transfection (480%) was confirmed by fluorescent microscopy cells with recombinant Chi3l1 dose-dependently attenuated
and fluorescence-activated cell sorting (FACS) for labelled tag apoptosis (Fig. 3g). miR-24 modulation inversely altered both
(Supplementary Fig. 3E). Chi3l1 expression and Chi3l1 protein levels in peritoneal
CHI3L1 can induce bronchial SMC migration through macrophages and RAW 264.7 cells. Further, anti-24 increased
JNK and ERK phosphorylation18. We found that CHI3L1 (while pre-24 decreased) phospho-Akt levels, partly explaining
4 NATURECOMMUNICATIONS|5:5214|DOI:10.1038/ncomms6214|www.nature.com/naturecommunications
&2014MacmillanPublishersLimited.Allrightsreserved.
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/ncomms6214
8
#
CHI3L1 fold change versus untreated/scr-miR ––462024 * * * Fold change versus untreated 102...2105535 CCILHC8IL32*L1 30* ng ml–1CHI3L*1 300* ng ml–1 Fold change versus control 102...552105 C#CL2 #IL8 Anti-2T4#LR4Anti-24 +I#L s1iCBhi3l1
Pre-24 Anti-24 IL-6 for 24h IL-6 + pre24
% Annexin V+ macrophages 113443225050505050 Control IL*-6 IL-*6 + IL-#6 + IL-^6 + % Caspase 3/7 + cells 113322550505000000000 Control IL*-6 IL-*6 + IL-#6 + IL-^6 + % Annexin V+ macrophages 33221105050505 Control IL*-6 IL-*6 + IL-#6 + IL-6* +
scr-miR pre-24 anti-24 scr-miR pre-24 anti-24 scr-miRpre-24 anti-24
120 IL-6 + control IL-6 + Rela IL-6 + Nfkb1
d
e siRNA siRNA siRNA
+ cells18000 * untreat –0.05
spase 3/7 4600 # ge versus –1––.215
a n
C a
% 20 ch –2.5
d
ol –3
0 Control Chi3l1 Chi3l1 24 f –3.5 #
30 ng ml–1 300 ng ml–1 miR-
Figure3|RegulationandmodulationofmiR-24invitro.(a)CHI3L1expressioninmiR-24-modulatedandIL-6-stimulatedhumanaorticSMCs.
(b)CytokineexpressioninCHI3L1-treatedhumanaorticSMC.Dataaremean±s.e.m.(c)CytokineexpressioninIL-6-stimulated,miR-24-modulatedand
siChi3l1-transfectedhASMC.(d)ApoptosisinIL-6-stimulatedandmiR-24-modulatedperitonealmousemacrophagesfrommicewithANGII-inducedAAA.
(e)ApoptosisinIL-6-stimulatedandmiR-24-modulatedRAW264.7cells.(f)ApoptosisinIL-6-stimulatedandmiR-24-modulatedperitonealmouse
macrophagesfrommicewithoutANGII-inducedAAA.(g)PercentapoptosisinChi3l1-treatedRAW264.7cells.(h)InhibitionofNF-kBviasilencingofits
components(RelAorNfkb1)preventsmiR-24downregulationinIL-6-stimulatedperitonealmacrophages.n¼3–4foreachtreatmentandcelltype;
allexperimentswererepeatedthreetimes.Dataaremean±s.e.m.*Po0.05versuscontrol,untreatedoruntreated/scr-miR.#Po0.05versus
untreated/controlandothertreatmentgroups.^Po0.05versussham,scr-miRandanti-24,analysedwithanalysisofvarianceandBonferroni’sposttest.
miR-24-based macrophage apoptosis regulation (Supplementary We investigated nuclear factor-kB (NF-kB) as a regulator of
Fig. 5A,B). miR-24inIL-6-stimulatedRAWcells.TheIL-6-induceddecrease
The above studies involved primarily M1-subtype pro- in miR-24 was essentially eliminated in macrophages by prior
inflammatorymacrophages.Weexaminedtheanti-inflammatory siRNA-mediated knockdown (475%) of either RelA (p65) or
M2-subtype by treating RAW cells and peritoneal macrophages Nfkb1 (p50), key components of NF-kB (Fig. 3h).
with low (5ngml(cid:2)1) and high (30ngml(cid:2)1) dose IL-4. The Next, we examined inflammation in human aortic endothelial
M2-marker macrophage mannose receptor 1 (Mrc1) markedly cells(AoECs)inresponsetoCHI3L1treatment,withandwithout
increased with both doses (Supplementary Fig. 5C). Neither IL-6co-treatment.CHI3L1dose-dependentlyaugmentedtheeffects
Chi3l1 normiR-24 expression wassignificantly altered withIL-4 of IL-6 treatment on CCL2 expression and increased expression of
treatment, although there was a trend towards downregulation several adhesion molecules (VCAM1, ICAM1 and SELP;
of Chi3l1 and upregulation of miR-24 in RAW 264.7 cells SupplementaryFig.6B–E).Theseresultssuggestthatelevatedlevels
(Supplementary Fig. 5D,E). Further experiments on macrophage ofCHI3L1augmentinflammatorystimuli,increasingmonocyteand
polarization, utilizing recombinant IL-4 and IL-6 stimulation of white-bloodcell bindingvia increases inadhesionmolecules.
murine peritoneal macrophages, revealed that miR-24 modula- Furin, a proprotein convertase, has been shown to be a
tionpredominantlyaffectsM1prototypicalmacrophagemarkers, direct target of miR-24 in cardiac fibroblasts19. Because, furin
suchasIl12andNos1(SupplementaryFig.5F,G),butnotthoseof has previously been shown to indirectly regulate matrix
the M2 subtype, as no substantial change was observed in the metalloproteinases-2 and -9, and to control latent transforming
expression of Il10 and Arg1 (Supplementary Figs 5H and 6A). growth factor beta(TGF-b) activationprocessing (key players in
NATURECOMMUNICATIONS|5:5214|DOI:10.1038/ncomms6214|www.nature.com/naturecommunications 5
&2014MacmillanPublishersLimited.Allrightsreserved.
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/ncomms6214
AAA pathobiology)20,21, we evaluated whether miR-24 slight alteration of gene transcription at 14 days (Supplementary
modulation in vitro would alter furin in human aortic SMCs. Fig. 8B). This may well relate to the minor AAD increase that
Interestingly, pre-24 significantly suppressed furin expression, occurs in this area after ANGII infusion.
whereas anti-24 treatment had no significant effect
(Supplementary Fig. 6F).
miR-24modulationeffectsongeneexpressioninmurineAAA.
Finally, we investigated differential mechanisms of transcrip-
WecollectedinfrarenalaortictissuefrommiRNA-modulatedand
tion-dependentprocessingofthethreedifferentmiR-23b-24-27b
sham-controlled mice 7 days after PPE infusion, and hybridized
cluster members by performing actinomycin D transcript
isolated RNA to whole-genome microarrays. Ontologic pathway
degradation experiments22,23 in IL-6-stimulated RAW 264.7
enrichment of significant genes was performed as previously
cells. The results indicate that all three miRNAs have about the described24. In brief, numerous genes differentiated scr-miR-
same slow basal degradation/processing rate (Supplementary
treated PPE-induced AAA from scr-miR-treated sham-control
Fig. 6G). Interestingly, IL-6 markedly increases miR-24
aorta. In contrast, anti-24-modulated PPE-infused gene
degradation/processing, an effect that appears to be
expression was essentially indistinguishable from scr-miR-
transcription-dependent (Supplementary Fig. 6H). Further, IL-6
treated PPE-infused mice. Chi3l1 remained upregulated with
has a minor effect on miR-23b levels at 24h (Supplementary
anti-24 treatment. Gene expression in pre-24-modulated aorta
Fig. 7A). It also causes a transient minor increase in miR-27b
was similar overall to sham controls, including undetectable
expression (Supplementary Fig. 7B).
Chi3l1 expression (Supplementary Table 7 and Supplementary
Note 1).
Pre-miR-24 inhibits AAA development in mouse models.
miR-24 expression and Chi3l1 in human AAA. Human infra-
We investigated whether modulation of miR-24 affects murine
renal aortic tissue was obtained from patients (n¼22) under-
PPE–AAA development, expansion and rupture, utilizing lenti-
viral vector (7.6(cid:3)107IFU per ml) transfection of pre-miR-24 going elective open surgery for significantly enlarged abdominal
aortae (AAD: 52–115mm). We compared this group of AAA
(pre-24), anti-miR-24 (anti-24) or scr-miR. Successful miR-24
patients (aged 68±13 years) with infrarenal aortic tissue from a
inhibition and overexpression in vivo were confirmed by
group of control organ donors without AAA (n¼14, mean age
qRT–PCR (Supplementary Fig. 7C). Pre-24 significantly
34±16 years) at explant (n¼10 heart; n¼4 kidney; Fig. 6c,d).
decreasedChi3l1expressionatalltimepoints(days7,14and28)
AllAAApatientswereonsimilarmedicationsattimeofsurgery,
compared with scr-miR in aneurysmal tissue, while anti-24
and were male, Caucasian, non-diabetic and smokers.
transductioninPPEmiceledtoincreasedChi3l1atallthreetime
As in our animal models, miR-24 was significantly down-
points versus the other two treatments (Fig. 4a). Modulation of
regulated ((cid:2)1.9±0.09-fold) in human AAA tissue (versus
miR-24 expression did not affect blood pressure in transduced
control). miR-27b was also downregulated in AAA (Fig. 6c).
mice (Supplementary Table 6).
TherewerenodifferencesinmiR-24levelsbetweenpatientswith
Overexpressing miR-24 substantially attenuated increases in
small (52–67mm; n¼12) and large AAA (69–115mm, n¼10),
AAD, while further inhibition with anti-24 augmented AAD
although there was a trend towards lower miR-24 with larger
expansion (Fig. 4b and Supplementary Table 4). Two anti-24
AAA. Tissue expression of CHI3L1 positively correlated with
micediedofAAArupture(atdays11and24),uncommonforthe
disease severity (Fig. 6d).
PPEinfusionmodel.miR-24modulationhadminimalimpacton
Chi3l1 in the suprarenal (non-aneurysmal) abdominal aorta,
suggestinguptakeofmiRNAmodulatorsonlyatthesiteofinjury miR-24 and CHI3L1 are novel AAA biomarkers. We isolated
(Supplementary Fig. 7D). plasma RNA from 105 individuals at the time of surgical AAA
IHC staining for Chi3l1 confirmed decreased protein levels repair,andcomparedthemwithagroupof52age-,medication-
throughout the vessel wall in pre-24-transfected mice compared andrisk-factor-matchedcontrolswithnormalrenal/liverfunction
with scr-miR and sham (Fig. 4c–e). Aortic Chi3l1 protein levels (SupplementaryTable8),andtoaseparate22patientgroupwith
rose in anti-24 mice (Fig. 4d). Macrophage infiltration was isolated peripheral vascular occlusive disease (PVOD). All indi-
significantly decreased in pre-24-treated mice (Fig. 5a,b,e and viduals had no documented current or previous other cardio-
Supplementary Fig. 7E). SMA was minimally altered in anti-24 vascular event (for example, stroke and myocardial infarction).
mice (versus scr-miR; Fig. 5c,d; whole aortas are displayed We detected decreased plasma miR-24 expression in patients
in Supplementary Fig. 7F). Confocal microscopy of double- with small (45–67mm; n¼54) and large AAA (69–150mm;
immunofluorescence-stained aortas with anti-F4/80 and -Chi3l1 n¼51;Fig.6e)comparedwithbothcontrolsandPVODpatients.
confirmed altered levels of both with miR-24 modulation and As in aortic tissue, miR-24 plasma levels were indistinguishable
co-localization within PPE-induced AAAs (Fig. 5e). between patients with small or large AAAs. In contrast, there
Pre-24 treatment also attenuated AAA in the ANGII model, were significant differences in CHI3L1 plasma levels between
althoughtheresultswerelesspronouncedthaninthePPEmodel. patients with small and large AAA, and between AAA patients
SignificantchangesinAADcouldbedetectedby14days(Fig.6a andcontrols(Fig.6f).CHI3L1levelsinsubjectswithsmallAAA
and Supplementary Table 5). Chi3l1 was again significantly werecomparabletothosewithPVOD,butlevelsinpatientswith
downregulated in pre-24-treated versus the other two groups largeAAAweresignificantlyhigherthaninbothoftheothertwo
(Fig. 6b). Death from aortic rupture occurred significantly more groups.
often in anti-24-treated mice (58%), compared with scr-miR- We also investigated changes in circulating miR-24 plasma
(36%) and pre-24-transfected (12%) through day 28. miR-24 expression and Chi3l1 protein levels in our two murine AAA
expression in anti-/pre-24-transduced mice was less altered than models, and discovered that plasma miR-24 was significantly
in the PPE model (Supplementary Fig. 8A). We have described repressed in mice with aneurysms (Supplementary Fig. 8C).
this phenomenon previously8,9 and attribute it to improved A substantial additional decrease was observed in mice with
miRNAmodulatoruptakeatthePPEinjurysite,whilethemore dissected/ruptured AAAs from the ANGII model. Chi3l1 levels
intact aortic wall found in the ANGII model may decrease were consistently elevated with AAA expansion in both models
anti-/pre-miRuptake.Notably,whenanalysingChi3l1expression and even further with subsequent rupture in the ANGII model
within the infrarenal aorta after ANGII induction, we detected (Supplementary Fig. 8D).
6 NATURECOMMUNICATIONS|5:5214|DOI:10.1038/ncomms6214|www.nature.com/naturecommunications
&2014MacmillanPublishersLimited.Allrightsreserved.
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/ncomms6214
8 # # SSchra-mmiR %) 220 PPE + anti-24 # #
Chi3I1 foldchange versus sham 2765431 * > * >PArneti--2244* #> AAD versus baseline ( 111126428000000 PPPPEE ++ spcrer--m24iR ## # #
0 100
Day 7 Day 14 Day 28 Baseline Day 3 Day 7 Day 14 Day 21 Day 28
Sham
Scr-miR PF120 # Anti-24
H
er 100
p
ells 80 * Sham
e c 60 #
Anti-24 sitiv 40
o
p
1- 20
3I
hi 0
C
Sham Scr-miR Anti-24 Pre-24
Scr-miR
Pre-24
Pre-24
Figure4|miR-24modulationinvivo.(a)Chi3l1aorticexpressionatdifferenttimepointsinscr-miRandanti-/pre-24-transducedmiceinshamor
PPE-inducedAAAatvarioustimepoints.(b)Abdominalaorticdiameter(AAD;in%versusbaseline)timecourseinscr-miRandanti-/pre-24PPE-induced
AAA.(c)IHCforaorticChi3l1(brownchromagen)inanti-/pre-24-treatedmicecomparedwithscr-miR,14daysafterPPEinductionofAAA.(d)Chi3l1-
positivecellcounts(n¼4high-powerfields(HPFs)onthreedifferentsectionsofthreedifferentaortaspergroup)inmiR-24-modulatedmice(versusscr-
miRcontrol),14daysafterPPE–AAAinduction.(e)RepresentativeIHCimages(antibodyagainstmurineChi3l1)indifferent-sizedaneurysmsofmiR-24-
modulatedmice(pre-/anti-24)comparedwithshamandscr-miR(scalebar,50mm),28daysafterPPE–AAAinduction.Dataaremean±s.e.m.*Po0.05
versussham.#Po0.05versusscr-miRandsham.^Po0.05versussham,scr-miRandanti-24;analysedwithanalysisofvariance(ANOVA;one-way
repeatedmeasuresANOVAforFig.4bandBonferroni’sposttest.
Discussion SMCs via mitogen-activated protein kinase (MAPK) and NF-kB
miRNAs offer translational opportunities for innovative ther- pathways, triggering inflammation and SMC migration18. These
apeutic and biomarker applications. Signature miRNA (dys)re- data suggest a vascular disease role for CHI3L1.
gulation patterns exist for several cardiovascular disorders, In vivo (mouse), in vitro (cell culture) and ex vivo (human
including cardiac hypertrophy25, myocardial infarction26, tissue and plasma), we identified miR-24 as a key regulator of
atherosclerosis27 and peripheral artery disease28. Further, AAA initiation and propagation, which acts in part by targeting
murine gain- and loss-of-function studies have demonstrated CHI3L1 (Supplementary Fig. 9). Analysis suggested Chi3l1 as an
the crucial importance of specific miRNAs in orchestrating intriguing miR-24 target. miR-24-Chi3l1 interactions controlled
pathophysiologic processes. inflammatory activity within the dilated aortic wall, effects
The highly conserved miR-23b-24-27b cluster is involved in abrogated by pre-miR-24 transfection. miR-24 overexpression
post-infarctcardiacangiogenesis15,cardiomyocytesurvival29and blockedChi3l1inductioninvivo,limitingAAAexpansion,while
cancer30,31. We now report that miR-24 is a key regulator of anti-miR-24 led tohigher Chi3l1expression and development of
aortic inflammation in AAA, with pri-miR-24-1 being the larger, rupture-prone aneurysms.
relevant transcript (miR-24-2 is predominant in tumour Microarray studies examining miR-24-modulated aortic
pathologies32–34). tissue confirmed that pre-miR-24 transfection led to AAA-
CHI3L1 (a 18-glycosyl hydrolase family member)14 is a associated-pathway reductions, including immune response and
predicted target of miR-24 involved in acute and chronic cytokine activity. Anti-miR-24 transfection primarily augmented
inflammation35,36. Differentiated macrophages secrete CHI3L1 the degree of inflammatory and apoptosis-related responses
in early-stage atherosclerotic lesions37,38, while CHI3L1 ratherthanactivating/repressingalternativepathways,suggesting
analogues induce vascular smooth muscle cell (VSMC) that the observed miR-24 downregulation with aneurysm is
proliferation and migration39. Elevated CHI3L1 serum levels pathologic rather than homeostatic. This stands in contrast to
arefoundinlungdisease40andhavepredictivevalueindetecting miR-29b, for which further in vivo repression beyond that
elevated future risk for thromboembolic stroke in healthy seen with AAA development led to fibrosis and decreased
women41. CHI3L1 increased IL-8 production in bronchial aneurysm size9.
NATURECOMMUNICATIONS|5:5214|DOI:10.1038/ncomms6214|www.nature.com/naturecommunications 7
&2014MacmillanPublishersLimited.Allrightsreserved.
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/ncomms6214
F
Sham Scr-miR HP 80 #
er 70
p
s 60
ve cell 5400 *
siti 30
o
p
Anti-24 Pre-24 c- 20
1-b/ 10
D1 0
C Sham Scr-miR Anti-24 Pre-24
Sham Scr-miR
Sham Scr-miR Anti-24 Pre-24
F4/80
Anti-24 Pre-24
Chi3I1
F100
HP 90
er 80
p 70
ells 60 Merge
c 50
ve 40
siti 30
po 20
A- 10
M
S 0
Sham Scr-miR Anti-24 Pre-24
Figure5|EffectsofmiR-24modulationinvivo.(a)IHCforCD11b/cinanti-/pre-24-treatedmicecomparedwithscr-miRandsham,14days
afterPPEinductionofAAA(brownchromagen;scalebar,400mm).(b)CD11b/c-positivecellcounts(n¼4high-powerfieldsonthreedifferentsections
ofthreedifferentaortaspergroup)inmiR-24-modulatedmice,14daysafterPPE–AAAinduction(versusscr-miRandsham).(c)IHCforSMCa-actin
(SMA)inanti-/pre-24-treatedmicecomparedwithscr-miRandsham,14daysafterPPEinductionofAAA(brownchromagen;scalebar,400mm).
(d)SMA-positivecells(n¼4high-powerfieldsonthreedifferentsectionsofthreedifferentaortaspergroup)inmiR-24-modulatedmice,14days
afterPPE–AAAinduction(versusscr-miRandsham).(e)Confocalmicroscopyillustratingco-localizationanddecreasedlevelsofF4/80andChi3l1in
pre-24-transfectedmicewithPPE–AAA(at14days)comparedwithsham(scalebar,50mm),scr-miR-andanti-24-transfectedmice(‘L’indicatesthe
luminalside;scalebars,400mm).n¼4–6miceforeachgroup.Dataaremean±s.e.m.#Po0.05versusscr-miRandsham.*Po0.05versusshamand
anti-24.
We explored potential mechanisms behind the pathology. fromPPE-inducedAAA46.WeshowthatbothCHI3L1treatment
InflammatorystimulidownregulatedmiR-24inmacrophagesand and miR-24 inhibition activate JNK/ERK in SMC in vitro, while
vascular SMCs at least partly via NF-kB. While NF-kB is widely pre-miR-24 decreases phospho-JNK/ERK, suggesting additional
established as an activator of transcription, it may also act mechanistic links betweenmiR-24/CHI3L1 regulation andAAA.
as a transcriptional repressor42–44. miR-24 directly modulated CHI3L1 appears to be a crucial regulator of transmural
CHI3L1 expression levels and, through CHI3L1, controlled vascular inflammation in AAA and its regulation by miR-24
cytokine synthesis, altered cell survival (probably through suggests potential therapeutic approaches. However, as miRNAs
p-Akt) in macrophage cell lines, promoted cytokine production may promote disease in one tissue while being protective
andmigrationinaorticSMCs,andstimulatedadhesionmolecule elsewhere, safe miRNA modulator application will ultimately
expression in AoECs. require methods that minimize off-target effects. We utilized
As mentioned above, CHI3L1 treatment activates MAPK human immunodeficiency virus type 1-derived lentivirus to
pathwaysinbronchialSMCs18.MAPKsignallingappearscritical modulate miR-24 during murine AAA development. These
in AAA, as selective JNK inhibition in rodent models prevents lentiviruses lack the U3 promoter, leading to self-inactivation47.
aneurysmdevelopment45,whileERK1((cid:2)/(cid:2))miceareprotected For vascular diseases such as AAA, the use of local delivery
8 NATURECOMMUNICATIONS|5:5214|DOI:10.1038/ncomms6214|www.nature.com/naturecommunications
&2014MacmillanPublishersLimited.Allrightsreserved.
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/ncomms6214
%) 220 AANNGGIIII ascnrt-i-m2i4R # m Sham scr-miR Anti-24 Pre-24 0 miR-23b miR-24 miR-27b
AAD versus baseline ( 111112864200000000 BaselAinNeGII Dpraey-2 74 Day^^ 14 Day# 28 Chi3I1 fold change versus sha 6012345 D*ay #7# Da*y #14# Da*y #28# Fold change versus control ––––1230–––....5552315 CSLamorngatelrlo AAlsAAAA * * * *
ols 0 300
Fold change versus controls 12340.....45301255555 CSLamorngatelrlo AAlsAAAA CHI*3L1 # miR-24 fold change versus contr –––012–––...523155 Controls Small AA^A Large AA^A PVOD –1)Plasma CHI3L1 (ng ml 221155050000000Controls PVOD*Small AAA*Large AA#A
Figure6|miR-24modulationinANGII-inducedAAAandlevelsinhumanAAA.(a)Abdominalaorticdiameter(AAD;in%versusbaseline)inscr-miR
andanti-/pre-24ANGII-inducedAAA(n¼4–6miceforeachtimepointandgroup).(b)Chi3l1aorticexpressioninscr-miR-andanti-/pre-24-transfected
micecomparedwithshamintheANGII–AAAmodelatvarioustimepoints.(c)miR-23b-24-27bexpressioninhumanaortictissuesamplesfrom
patientswithsmallAAA(n¼12)andlargeAAA(n¼10),comparedwithtissuefromcontrolpatientswithoutAAA(n¼14).(d)CHI3L1issignificantly
upregulatedinhumantissuesampleswithlargeAAAcomparedwithsmallAAAandnon-aneurysmalaortictissue.(e)miR-24issignificantly
downregulatedinplasmasamplesfromhumanpatientswithAAA(n¼43withsmallAAA;n¼ 39withlargeAAA)comparedwithcontrolplasma
(n¼44),andpatientswithperipheralvascularocclusivedisease(PVOD)butnoAAA(n¼22).(f)CHI3L1plasmalevelsaresignificantlyincreasedin
patientswithlargeAAAcomparedwithpatientswithsmallAAA,PVODandun-diseasedcontrols.Dataaremean±s.e.m.*Po0.05versussham/controls.
#Po0.05versusscr-miR/controls/smallAAA.^Po0.05versuspre-/anti-24orversuscontrols/PVOD;analysedwithanalysisofvariance(ANOVA;
one-wayrepeatedmeasuresANOVAforFig.6a)andBonferroni’sposttest.
devices such as miRNA-modulator-eluting stents/balloons could circulating miRNAs biomarkers in the cited study, suggesting
resolve off-target issues, increasing therapeutic feasibility. No that it might also detect patients at increased risk of future
otherdirectantagonistictargetingagentforCHI3L1existsatthis myocardial infarction. However, a combination of both CHI3L1
time, but future availability of such reagents will enable deeper and miR-24 could potentially be utilized in patients for AAA
investigationastotherole, functionand therapeutic potentialof detection and rupture risk stratification.
targeting CHI3L1 in cardiovascular disease.
To date, biomarkers have failed to improve diagnostic and Methods
prognostic precision in AAA. Recent data show that CHI3L1 is PPEinfusionmodel. ToinducemurineAAA,thePPEinfusionmodelwasper-
elevatedinpatientswithcoronaryarterydisease,andthatdisease formedin10-week-oldmaleC57BL/6Jmice53.Inbrief,afterplacingtemporary
progression corresponds with augmented CHI3L1 levels48. We ligaturesaroundtheproximalanddistalaorta,anaortotomywascreatedatthe
bifurcationandaninsertioncatheterwasusedtoinfusetheaortafor5minat
found that AAA size also correlates with higher CHI3L1 levels. 100mmHgwithsalineorsaline-containingtypeIPPE(1.5Uml(cid:2)1;Sigma-
CirculatingmiRNAsalsoofferpromiseasbiomarkersinthatthey Aldrich).Afterremovingtheinfusioncatheter,theaortotomywasrepairedwithout
are stable in human blood, detectable with high sensitivity/ constrictionofthelumen.Twoaorticsegmentswereharvestedat7,14or28days
specificity and measurable via miRNA microarrays and postsurgery:theinducedAAA(areabetweentheleftrenalarteryandthe
qRT–PCR arrays49,50. Cardiovascular studies have identified bifurcation)andthesuprarenalabdominalaorta(areaproximaltotherenal
arteries,uptothediaphragm)weresnap-frozeninliquidnitrogenandthen
miRNA dysregulation in various specimens, although typically storedat (cid:2)80(cid:2)Cpendingfurtherprocessing.
underpowered and/or without matched controls43–51. In our
study, plasma and tissue levels of miR-24 were significantly ANGIIinfusionmodel. Osmoticpumps(model2004,Alzet)containingeither
decreased in AAA patients, but unlike CHI3L1 these were not ANGII(1mgkg(cid:2)1min(cid:2)1,Sigma-Aldrich)orsalinewereimplantedin10-week-
clear disease-severity indicators. Larger patient cohorts are oldApoE(cid:2)/(cid:2) malemice(C57BL/6Jbackground)54.Aneurysmal(proximaltothe
needed to validate miR-24 or CHI3L1 as diagnostic biomarkers renalarteries)andcontrolsegments(distaltotherenalarteries)oftheaortawere
harvestedafter14or28days,snap-frozeninliquidnitrogenandthenstoredat
for AAA. More intriguing, miR-24 could perhaps be used
(cid:2)80(cid:2)Cpendingfurtherprocessing.
prospectively to detect patients at high risk for rapid AAA
growth/rupture. Grouped miRNAs might show increased
AorticdiametermeasurementsbyUSimaging.Atbaseline,and3,7,14,21and
predictive power over single transcripts, as recently reported for
28daysafteraneurysminduction,B-modeUSimagingwasperformedtoassessthe
myocardial infarction52. Notably, miR-24 was one of the AAD.Micewereanaesthetizedusing2%isoflurane(VetOne)andwerelaidsupine
NATURECOMMUNICATIONS|5:5214|DOI:10.1038/ncomms6214|www.nature.com/naturecommunications 9
&2014MacmillanPublishersLimited.Allrightsreserved.
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/ncomms6214
onaheated37(cid:2)Cplate.Two-dimensionalB-modeimagingwasperformedusinga andthedifferentiallyregulatedmRNAgeneswereprobedforenrichmentofthese
real-timemicrovisualizationscanhead(RMV704)withacentralfrequencyof seedregionsusingDIANA-mirExTra.Returnedvaluesshowtheprobabilitythat
40MHz,framerateof30Hz,afocallengthof6mmanda20(cid:3)20mmfieldofview hexamersarefoundmoreofteninthedifferentiallyregulatedlistthaninthenon-
(VisualSonics).Transverseimagescanswereperformedandcineloopsof300 regulatedlist,asgivenbyWilcoxonRankSumTest11.Microarraydatawere
frameswereacquiredthroughouttheinfra-andsuprarenalregionofthemouse submittedtotheNationalCenterforBiotechnologyInformation’sGeneExpression
aorta.Theacquiredimageswerestoreddigitallyonabuilt-inharddriveforoffline Omnibus(GSE51229).
analysistodeterminemaximalAAD.Allaorticdiametersweremeasuredin
anterior–posteriordirectionduringthediastolicphase.USimageanalysiswas Histologicalandimmunohistochemicalanalysis. Histologicalstainingafter
performedusingtheaccompanyingVevo770software(VisualSonics).Measure-
harvestingwasperformedinthesameregionofabdominalaortathatwasimaged
mentswereaccomplishedusingrandomselectionofeachdatasetandoperator
inordertoobtainmorphometricdatatocorrelatewithUSmeasurementsandgene
blindingtopreventrecallbias.Allmeasurementswerecollectedbyoneobserverto expressionresultsfromqRT–PCRusingastandardizedprotocol57.Aortictissue
limitbias,whileresultswereanalysedbyasecondindependentobserverblindedto wasdividedintofour(spaced0.5mmapart)7-mm-thickserialsectionsfromthe
thetreatmentgroup.
leftrenalarterytothebifurcationandstainedwithhaematoxylinandeosin(Sigma-
Aldrich),andwithrabbitantibodiesagainstChi3l1,SMA,F4/80andCD11b/c(all
Preparationofaortictissue. Micewerekilledwithaninhalationoverdoseof fromAbcam,dilution1:200)usingtheVectastainABCkit(VectorLaboratories)
isoflurane(VetOne).Immediatelyafterward,theabdominalaortawastransected forimmunohistochemicalanalysis.Fornegativecontrol,mouseirrelevantIgG1
andflushedviatheleftventriclewithice-coldPBS.Theaortawasthendissected (Abcam)wasutilized.Chi3l1-,SMA-andCD11b/c-positivecellsweremeasuredby
fromfatandconnectivetissuefromtheleftrenalarterytothebifurcationundera countingthecellsinfourhigh-powerfieldsonthreedifferentsectionsofthree
microscope(Leica).Specimensweresnap-frozenindividuallyinliquidnitrogen differentaortaspertreatmentgroup.Countingwasperformedbyablinded
andstoredat (cid:2)80(cid:2)Cbeforefurtherprocessing. investigator,7daysafterPPEinfusiontoinduceAAA.Allhistologicalanalyses
wereobtainedatroomtemperatureusingaZeissAxioplan2(CarlZeiss
MicroImaging)withZeissAchroplanandZeissPlan-Neofluarlenses,aNikon
RNAquantification. TotalRNAwasisolatedusingaTRIzol-based(Invitrogen) DigitalSight(DS)Ri1cameraandtheNIS-ElementsF3.00software(Nikon).
RNAisolationprotocol.RNAwasquantifiedbyNanoDrop(AgilentTechnologies),
andRNAandmiRNAqualitywereverifiedusinganAgilent2100Bioanalyzer
(AgilentTechnologies).Samplesrequired260/280ratios41.8,andsampleRNA Insituhybridization.ISHformiR-24wasperformedbyusingthemiRCURYLNA
integritynumbersZ9forinclusion.RNAwasreversetranscribedusingtheTaq- microRNAISHOptimizationKit(Exiqon),and50-DIG-and30-DIG-labelled
ManmicroRNAReverseTranscriptionkit(AppliedBiosystems)accordingtothe probesformmu-miR-24accordingtothemanufacturer’sprotocol.Thesequenceof
manufacturer’sinstructions.MiRNAandTaqManassaykits(AppliedBiosystems) theLNAmiR-24controlprobewas:50-DIG/CTGTTCCTGCTGAACTGAGCCA/
formiR-23b(50-AUCACAUUGCCAGGGAUUACC-30),miR-24(50-UGGCUCA DIG-30.
GUUCAGCAGGAACAG-30),miR-27b(50-UUCACAGUGGCUAAGUUCUGC-30),
sno202(endogenouscontrolfornormalizationinmice)andRNU44(controlfor CombinedISH/immunohistochemicalstaining.ISHwasperformedasdescribed
humansamples)wereused.FormRNA,theiScriptcDNAsynthesiskit(Bio-Rad)
aboveutilizingthemiRCURYLNAmicroRNAISHOptimizationKit(Exiqon)and
wasusedtosynthesizefirst-strandcDNAaccordingtothemanufacturer’sprotocol. 50-DIG-and30-DIG-labelledprobesformmu-miR-24.AfterfinishingtheISH
TaqManqRT–PCRassayswereperformedusingmouse-andhuman-specific procedure,thesampleslideswereincubatedwithpepsininHCl(1.3mgml(cid:2)1with
primers(AppliedBiosystems).RelativeexpressionofmiR-24-1andmiR-24-2
anadjustedpHbetween1.3and1.5)for8minat37(cid:2)C.AfterwashinginPBS
clusterswereobtainedbyTaqManforpri-miR-24-1(50-CUCCGGUGCCUACU
(twicefor5min),theimmunohistochemicalstaining(asdescribedabove)was
GAGCUGAUAUCAGUUCUCAUUUUACACACUGGCUCAGUUCAGCAG
initiatedwithovernightincubationofthefirstantibodyagainstF4/80(dilution
GAACAGGAG-30)andpri-miR-24-2(50-GCCUCUCUCCGGGCUCCGCCUCC
1:1000;Abcam)andcontinuedthenextdayaccordingtothemanufacturer’s
CGUGCCUACUGAGCUGAAACAGUUGAUUCCAGUGCACUGGCUCAGUU
instructions.
CAGCAGGAACAGGAGUCCAGCCCCCUAGGAGCUGGCA-30;bothfrom
AppliedBiosystems).Allnon-miRNAprobeswerenormalizedto18Sasamulti-
plexedinternalcontrol.AmplificationtookplaceoneitheraPRISM7900HTora Lenti-antiandlenti-pre-miRinjection. ThemiR-24-1pre-miRandmiR-ZIP-
QuantStudio12KFlex(AppliedBiosystems).Allfoldchangeswerecalculatedby anti-24(SystemBiosciences)wereclonedintoahumanimmunodeficiencyvirus
themethodofDDC,andareexpressedasmean±s.e.m.comparedwitheither lentiviralvectorcontainingacopGFPreporterwiththemiRNAprecursorunder
t
sham-operatedmice,saline-infusedmice,saline-treatedcells(invitro)orhuman constitutiveCMVpromotercontrol.Thepackagedlentiviralconstructswere
controlpatients(asindicated).Theamountofsamplesperexperimentisindicated providedasfrozenVSV-G-pseudotypedparticles,withtheirtitre(IFUperml)
inthecorrespondingfigurelegendand/ortheresults. beingdefinedwiththeUltraRapidLentiviralTiterKit(SystemBiosciences).The
pre-miR-24(PMIRH24)sequencewas:50-AATTCGCCCTTGATGGGATTTGCT
TCCTGTCACAAATCACATTGCCAGGGATTTCCAACCGACCCTGAGCTCT
Genemicroarrayhybridization. Un-pooledaorticRNA(500ng)isolatedas
GCCACCGAGGATGCTGCCCGGGGACGGGGTGGCAGAGAGGCCCCGAAG
describedwaslabelledusingCyanine-5-CTPandhybridizedtotheSurePrint
CCTGTGCCTGGCCTGAGGAGCAGGGCTTAGCTGCTTGTGAGCAGGGTC
G3MouseWholeGenomeGE8(cid:3)60KMicroarrayG4852Aplatformwithan
CACACCAAGTCGTGTTCACAGTGGCTAAGTTCCGCCCCCCAGGCCCT
equimolarconcentrationofCyanine-3-CTP-labelleduniversalmousereference
CACCTCCTCTGGCCTTGCCGCCTGTCCCCTGCTGCCGCCTGTCTGCCTG
(Stratagene).Thesesameaorticsamples(100ngtotalRNA)werealsolabelledwith
CCATCCTGCTGCCTGGCCTCCCTGGGCTCTGCCTCCCGTGCCTACTGA
Cyanine-3-CTPandhybridizedtotheAgilentMousemiRNAMicroarray,8(cid:3)15K
GCTGAAACACAGTTGGTTTGTGTACACTGGCTCAGTTCAGCAGGAACA
G4471A-021828platform.Standardprotocolswerefollowed,withonemouseaorta
GGGGTCAAGCCCCCTTGGAGCCTGCAGCCCCTGCCTTCCCTGGGTGGG
perarray.Imageswerequantifiedandfeature-extractedusingAgilentFeature
CTGATGCTTGGAGCAGAGATGAGGACTCAGAATCAGACCTGTGTCTGG
ExtractionSoftware(versionA.10.7.3.1).Allarrayswereofthesameprintrunand
AGGAGGGATGTGGTGGGTGGGGTTGGCTGGGCCCAAATGTGTGCTGC
werehybridizedonthesameday.
AGGCCCTGATCCCCAACTCTGCAACTGGGGACCCCTGCATGGCCACA
GCTCAGGCTGGGCTGTGGTGCCAGCATAGATAGCGGCCGC-30.Theanti-
Microarrayqualitycontrolanddataanalysis. Asmallnumberofarrayswere miR-24(MZIP-24)sequencewas:50-GATCCGTGGCTCAATTCAGCAGGCA
excludedfromfurtheranalysisforpoorhybridizationcharacteristicsperfeature CCGCTTCCTGTCAGCTGTTCCTGCTGAACTGAGCCATTTTTGAATT-30.
extractorqualitycontrolmetrics.Remainingarraydatawereexaminedusing Anti-andpre-miRswereinjectedintraperitoneallyin500mlPBSwith7.6(cid:3)107
Genespring12.6.1(AgilentTechnologies).Hierarchicalanalysisclusteringand IFUpermouseofloadedlentivirus.miR-24-1modulatorswereinjectedoneday
principalcomponentsanalysiswasusedtoconfirmandidentifyappropriate afterAAAinductionandcomparedtoascr-miRcontrol(50-GTGTAACACGTC
treatmentsubgroupsandeliminateoutliers.Finalanalysisgroupsincludedtwo TATACGCCCA-30).
differentsetsconsistingof7-dayPPE-treatedversussham-saline-treatedaortae
(fivearrayseach)and7-dayPPE-treated-miR-24-modulatedaortaeversuscontrols Doubleimmunofluorescencestudies. PrimaryantibodiesforChi3l1and
(sham-operatedsaline-treated(fourarrays),scr-miR-PPE-treated(fivearrays),pre-
CD11b/corSMAwereappliedafterwashingwith10%PBSusingconventional
miR-24-PPE-treated(threearrays)andanti-miR-24-PPE-treated(sixarrays)).For
IHCdilutions(seeabove).Secondaryantibodieswerereplacedwithantibodies
geneexpressiondata,two-class,unpairedsignificanceanalysisofmicroarrays
labelledwithAlexaFluor(Invitrogen;dilution1:250)dyewithamaximum
(SAMv.4.0)wasperformedineverycombinationwithFDRo1%(ref.55).
excitationat488nm(green),andforredwithAlexaFluor568(Invitrogen).Images
miRNAarraydatawereanalysedinGenespring,usingmoderatedt-testingwith
wereobtainedandanalysedbyconfocalmicroscopy(LeicaSP5,Argonlaser).
Benjamini–HochbergFDRcorrection(Po0.05).Genelistswereprobedfor
overabundant(twogenespercategoryminimum,EASEcutoff0.05)pathways
(KyotoEncyclopediaofGenesandGenomes)andGeneOntologyBiological Invitrostudies. HumanaorticSMC(hASMCs)andhumanAoECswerepro-
ProcessgroupsusingDAVIDBioinformaticsResources6.7againstamurine pagatedingrowthmedia(SmGM-2(forhASMC)andEBM-2(forAoEC);Lonza)
background56. with5%fetalbovineserum(FBS)perstandardprotocols(Lonza;passageno.4–5).
Predictedtarget30UTRseedregionhexamerswereidentifiedforall hASMCwereincubatedinbasalmedium(SmBM)for48hbeforetreatment/
differentiallyregulatedmiRNAs(Po0.05PPEversussaline,WilcoxonRankSum), transfection,andotherlineswereserum-starvedovernightbeforetreatment/
10 NATURECOMMUNICATIONS|5:5214|DOI:10.1038/ncomms6214|www.nature.com/naturecommunications
&2014MacmillanPublishersLimited.Allrightsreserved.
Description:Page 1 Philip S. Tsao1,3. Identification and treatment of abdominal aortic aneurysm (AAA) remain among the most accumulation in the aortic wall is one of the most consistent features . miR-24 downregulation was pro-inflammatory in .. elsewhere, safe miRNA modulator application will ultimately.