Table Of ContentONCOLOGY LETTERS 5: 829-834, 2013
microRNA-125b inhibits cell migration and invasion by
targeting matrix metallopeptidase 13 in bladder cancer
1 2 3 1
DEYAO WU , JINGJING DING , LINMAO WANG , HUIXING PAN ,
1 1 1
ZHENGDONG ZHOU , JIAN ZHOU and PING QU
1
Department of Urology, The Fourth Affiliated Hospital of Nantong Medical College, Yancheng City No. 1 People's Hospital,
2
Yancheng 224001; School of Basic Medical Science, Nanjing Medical University, Manjing 210029;
3
Department of Thoracic Surgery, The Fourth Affiliated Hospital of Nantong Medical College,
Yancheng City No. 1 People's Hospital, Yancheng 224001, P.R. China
Received October 12, 2012; Accepted January 4, 2013
DOI: 10.3892/ol.2013.1123
Abstract. The expression of microRNA-125b (miR-125b) bladder cancer represents the second most common cause
has been investigated in many human cancers. It has been of mortality among individuals with genitourinary tumors.
demonstrated to be downregulated in certain types of cancer, It was estimated that there would be 70,530 new cases and
such as bladder cancer, thyroid anaplastic carcinomas, squa- 14,680 deaths due to bladder cancer in 2010 (1-3). Bladder
mous cell carcinoma of the tongue, hepatocellular carcinoma, cancer is comprised of tumors that exhibit a wide spectrum of
ovarian and breast cancer. In the present study, we examined clinical behavior. Approximately 90% of patients with bladder
the effects of miR-125b on bladder cancer cell migration and cancer have transitional cell carcinoma (TCC), whereas 5%
invasion. Following transfection of miR-125b, the expression exhibit squamous cell carcinomas and 1-2% have adenocarci-
of miR-125b was analyzed in T24 and EJ bladder cancer nomas (3,4). Currently, there are many therapeutic modalities
cells. Additionally, cell migration, cell invasion and luciferase available for use depending on the extent of the disease. The
assays, as well as western blot analysis were conducted in treatment methods include surgery, intravesical chemotherapy,
the bladder cancer cells. In this study, we demonstrated that radiation therapy and systemic chemotherapy (5). The majority
miR-125b inhibited cell migration and invasion in T24 and (50-80%) of patients with superficial TCC who solely undergo
EJ cells. We also provided the first evidence that miR-125b transurethral resection of bladder (TURB) suffer from recur-
may directly target matrix metalloproteinase 13 (MMP13) in rence. In 16-25% of these cases, superficial tumors recur with a
bladder cancer. Our study provided evidence that miR-125b higher grade, mostly within the first year following TURB (6).
suppresses cell migration and invasion by targeting MMP13 Therefore, for an improved prognosis, new therapeutic targets
in bladder cancer cell lines. These results suggested that and approaches should be sought in order to suppress cancer
miR-125b could be used for the development of new molecular recurrence.
markers and therapeutic approaches to inhibit bladder cancer microRNA (miRNA) belongs to a class of endogenously
metastasis. expressed, non-coding small RNA and contains ~22 nucleo-
tides (7). miRNAs are transcribed as hairpin pri-miRNAs and
Introduction processed into pre-miRNAs by Drosha, an RNAse III endo-
nuclease complexed with DGCR8. Pre-miRNAs are exported
Bladder cancer is one of the most common malignan- into the cystoplasm by Exportin 5 prior to cleavage by Dicer
cies worldwide. In the western world it is the seventh most into mature miRNAs (8). Mature miRNAs are important in
common malignancy among males, following lung, prostate, cell growth, proliferation, differentiation and cell death (9-11).
colon, stomach, liver and esophageal cancer. In addition, It has also been proposed that miRNAs regulate the expres-
sion of ~1/3 of human genes (12,13). miRNAs regulate gene
expression at the post-transcriptional level through imperfect
base pairing with the 3'-untranslated regions (3'-UTR) of
target mRNAs (7). A growing body of evidence indicates
Correspondence to: Professor Ping Qu, Department of Urology,
that miRNAs are aberrantly expressed in numerous human
The Fourth Affiliated Hospital of Nantong Medical College,
cancers, and they may function as oncogenes and tumor
Yancheng City No. 1 People's Hospital, 15 Yuehe Road,
Yancheng 224001, P.R. China suppressors. Upregulated miRNAs in cancer may function
E-mail: [email protected] as oncogenes by negatively regulating tumor suppressors. By
contrast, downregulated miRNAs may normally function as
Key words: bladder cancer, MMP13, miR-125b tumor suppressor genes and inhibit cancer by regulating onco-
genes (14). It has been suggested that miRNA may be a target
for cancer therapy.
830 WU et al: miR-125b INHIBITS MIGRATION AND INVASION IN BLADDER CANCER
The expression of miRNA-125b (miR-125b) has been Table I. Sequence of the miR-125b mimic and scrambled
investigated in numerous human cancers. It has been demon- control.
strated to be downregulated in certain types of cancer, such as
bladder cancer, thyroid anaplastic carcinomas, squamous cell Sequence (5'-3')
carcinoma of the tongue, hepatocellular carcinoma, ovarian
hsa-miR-125b UCCCUGAGACCCUAACUUGUGA
and breast cancer, functioning as a tumor suppressor (15,16).
However, miR-125b was found to be upregulated in pancreatic Scrambled control UUCUCCGAACGUGUCACGUTT
cancer, oligodendroglial tumors, prostate cancer, myelodys-
miRNA-125b, microRNA-125b.
plastic syndromes and acute myeloid leukemia (17,18). In this
study, we demonstrated that miR-125b was capable of inhib-
iting bladder cancer cell migration and invasion by targeting
matrix metalloproteinase 13 (MMP13). These results enhance
our understanding of the mechanisms of metastases, thus by DNA sequencing. Cell transfection and co-transfection
aiding the identification of new targets that may be used for were performed using Lipofectamine 2000 (Invitrogen Life
the development of novel molecular markers and therapeutic Technologies) according to the manufacturer's instructions.
approaches to inhibit bladder cancer metastasis.
Cell migration and invasion assay. Cell motility was measured
Material and methods using an 8-µm-pore polycarbonate membrane Boyden chamber
insert in a Transwell apparatus (Costar; Cambridge, MA, USA).
Cells and culture conditions. The human bladder cancer cell The transfected cells (miR-125b mimics and NC) growing
lines T24 and EJ were obtained from the Shanghai Institute of in the log phase were treated with trypsin/EDTA solution,
Cell Biology, Chinese Academy of Sciences. The cells were washed once with serum-containing RPMI-1640 medium,
cultured in Roswell Park Memorial Institute (RPMI)-1640 centrifuged and re-suspended as single-cell solutions. A total
medium supplemented with 10% heat-inactivated fetal bovine of 1x105 cells in 0.2 ml serum-free RPMI-1640 medium were
serum, 100 U/ml penicillin and 100 mg/l streptomycin, at seeded on a Transwell apparatus. RPMI-1640 containing 20%
37˚C in a humidified atmosphere containing 5% CO . Cells FBS (600 µl) was added to the lower chamber. An invasion
2
were subcultured every 2 days using trypsin/ethylenedinitri- assay was conducted following the same procedure, with
lotetraacetic acid (EDTA) solution (saline containing 0.05% the exception that the filters of the Transwell chambers were
trypsin, 0.01 M sodium phosphate and 0.53 µM EDTA; coated with 30 µg Matrigel (BD Biosciences; San Jose, CA,
pH 7.4). The study was approved by the faculty/institutional USA). Following incubation of the cells for 12-24 h at 37˚C in
research committee of Yancheng City No. 1 People's Hospital, a 5% CO incubator, cells on the top surface of the insert were
2
Yancheng, China. removed by wiping with a cotton swab. Cells that migrated to
the bottom surface of the insert were fixed in 100% methanol
Quantitative reverse transcription-polymerase chain for 2 min, stained in 0.5% crystal violet for 2 min, rinsed in
reaction (RT-PCR) for miR-125b after transfection with PBS and then subjected to microscopic inspection (x200).
miR-125b mimics. Total RNA was extracted from cells using Values for invasion and migration were obtained by counting
TRIzol reagent (Invitrogen Life Technologies; Carlsbad, CA, five fields per membrane and represented the average of three
USA). Real-time qRT-PCR for miR-125b was performed independent experiments.
with SYBR-Green miRNA assay (Genepharma; Shanghai,
China) according to the manufacturer's instructions. The Luciferase assay. Firefly luciferase reporter plasmids
primer sequences for miR-125b were as follows: Forward: containing 3'UTR of the MMP13 gene were obtained from
ACTGATAAATCCCTGAGACCCTAAC and reverse: SwitchGear Genomics (Menlo Park, CA, USA). The muta-
TATGGTTGTTCTGCTCTCTGTCAC. Briefly, a total of tions were generated with the predicted target site of MMP13
500 ng RNA was used for the initial reverse transcription 3'UTR using the QuickChange XL sitedirected mutagenesis
reaction with the gene specific stem-loop RT primer avail- kit (Stratagene, La Jolla, CA, USA). Cells were plated in a
able in the kit. Real-time PCR was performed in an AB7300 12-well plate at ~90% confluence and transfected with 0.5 µg
thermal cycler (Applied Biosystems; Foster City, CA, USA) reporter plasmid, 50 nmol miR-125b mimics or miR-Ctrl using
using the miR-125b primer set and the double-stranded DNA Lipofectamine 2000. Each sample was also co-transfected
binding dye SYBR-Green. GAPDH was used as the internal with 0.05 µg pRL-CMV plasmid expressing Renilla luciferase
control. The primers for GAPDH were as follows: Forward: as an internal control for transfection efficiency. Twenty-four
GAAATCCCATCACCATCTTCCAGG and reverse: hours after transfection, cells were harvested with passive
GAGCCCCAGCCTTCTCCATG. Every sample was repli- lysis buffer, according to the manufacturer's instructions.
cated three times with no RT or template control included. Firefly luciferase activity and Renilla luciferase activity were
Data were analyzed by comparing the Ct values. measured with a luminometer (Tecan; Theale, UK). Firefly
luciferase activity was normalized to Renilla luciferase
Transfection of miR-125b mimics, NC and luciferase reporter activity for each transfected well. Each assay was replicated
plasmid. Mature miR-125b mimics and scrambled control three times.
(NC) were designed and synthesized by Genepharma. The
sequence of miR-125b mimics and scrambled control are Western blot analysis. Primary antibodies used in this study,
listed in Table I. The insertion fragment was confirmed including MMP13 and β-actin, were purchased from Bioworld
ONCOLOGY LETTERS 5: 829-834, 2013 831
Figure 1. Expression of miR-125b in T24 and EJ cells. The basal expression of miR-125b in T24 and EJ cells was barely detectable. The expression of miR-
125b increased for 144 h following transfection of miR-125b. miR-125b, microRNA-125b.
membrane. Following blocking with 5% degreased milk in
Tris-buffered saline and Tween-20 (TBST; containing 0.1%
Tween-20), the membranes were incubated overnight with the
appropriate primary antibody. Subsequently, the membranes
were washed and incubated with the corresponding horse-
radish peroxidase conjugated secondary antibody at 1:1000
dilution in TBST. The blot was developed with enhanced
chemiluminescence (ECL) solution (Pierce; Rockford, IL,
USA) and photographed by the FluorChem imaging system
(Alpha Innotech; San Leandro, CA, USA). The intensity of
each spot was read and analyzed with the AlphaEaseFC soft-
ware. β-actin was used as the loading control.
Statistical analysis. Data were presented as mean ± standard
deviation, and compared using the Student's t-test in Stata 10.0
(StataCorp.; College Station, Texas, USA). A two-tailed P<0.05
was considered to indicate a statistically significant difference.
Results
Expression of miR-125b following transfection of miR-125b
in T24 and EJ cells. We assessed the endogenous levels of
miR-125b in T24 and EJ cells, as well as the expression
following transfection of miR-125b every 24 h, as demon-
strated in Fig. 1. The basal expression of miR-125b was barely
detectable, and therefore not shown in Fig. 1. After transfec-
tion of miR-125b, the expression level was dramatically
increased, then gradually decreased between 24 h and 144 h
after transfection.
Figure 2. miR-125b inhibition of cell migration and invasion. Representative
miR-125b suppresses cell migration and invasion in T24
photos and statistical plots of migration and invasion assays in bladder cancer
T24 and EJ cells. Following 12 h incubation, the number of T24 and EJ cells and EJ cells. To measure the effect of miR-125b on tumor
that transversed the Transwell membrane decreased after the transfection of cell migration and invasion, the Transwell apparatus assay
miR-125b, compared with the controls (Student's t-test, P<0.05). Following
was performed (Fig. 2). In the migration assay, we found that
24 h of incubation, the number of T24 and EJ cells that transversed the
miR-125b groups exhibited a 47.61±8.25% decrease in cell
Transwell membrane pre-coated with Matrigel also decreased after the trans-
fection of miR-125b, compared with the controls (Student's t-test, P<0.05). migration in T24 cells and a 54.17±6.73% decrease in that of
miR-125b, microRNA-125b; NC, scrambled control. EJ cells, compared with the controls. In the invasion assay,
we found that miR-133a groups demonstrated a 48.45±7.22%
decrease in cell migration in T24 cells and a 51.17±6.34%
Technology (Louis Park, MN, USA). Total protein of cells decrease in that of EJ cells, compared with the controls. These
was prepared using radioimmunoprecipitation assay (RIPA) results indicated that miR-125b reduced the migration and
lysis buffer. Protein concentration in the resulting lysate invasion in bladder cancer T24 and EJ cells.
was determined using the bicinchoninic acid protein assay.
Equal amounts of protein were loaded onto a sodium dodecyl MMP13 is downregulated following the overexpression
sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) of miR-125b in T24 and EJ cells. We performed western
gel and transferred to a polyvinylidene fluoride (PVDF) blot analysis to investigate whether MMP13 expression was
832 WU et al: miR-125b INHIBITS MIGRATION AND INVASION IN BLADDER CANCER
performed to evaluate whether MMP13 is a true target of
miR-125b. As demonstrated in Fig. 4, overexpression of
miR-125b suppressed MMP13 3'UTR-luciferase activity by
41% in T24 cells and by 43% in EJ cells, compared with the
controls (P<0.05). Mutation of four nucleotides within the
seed-matching sequence of the predicted miR-125b binding
site abolished the inhibitory effect of miR-125b on luciferase
activity. Therefore, MMP13 may be a direct target of miR-
125b in vitro.
Discussion
In humans, miR-125 has two mature isoforms, miR-125a
and miR-125b, encoded by three distinct genes: miR-125a,
miR-125b-1 and miR-125b-2. miR-125b-1 and miR-125b-2
Figure 3. MMP13 expression significantly decreased in T24 and EJ cells
following transfection of miR-125b, compared with the controls (P<0.05). map to 11q24.1 and 21q21.1, and their precursors are processed
MMP13, matrix metalloproteinase 13; miR-125b, microRNA-125b; NC, to form the same mature miRNA, miR125b (19). miR-125b
scrambled control.
is a well-characterized miRNA. Although dysregulation of
miR-125b has been demonstrated to occur in multiple human
cancer types, its role in disease is not completely under-
stood (20), as in certain cell types it is observed to have an
oncogenic role, while in others it exhibits a tumor suppres-
sive role. For example, miR-125b expression is upregulated
in prostate cancer, and it stimulates androgen-independent
growth of prostate cells (21). By contrast, miR-125b is down-
regulated in breast cancer, osteosarcoma and bladder cancer,
and it suppresses tumor growth in vitro and in vivo (22-24).
In a previous study, it was demonstrated that miR-125b was
downregulated in the keratinocytes of psoriasis, which is an
inflammatory skin disease characterized by non-malignant
hyperproliferation of keratinocytes, and the miR-125b inhib-
ited cell proliferation in human primary keratinocytes (25).
The seemingly paradoxical findings indicate that the biological
function of miR-125b is complex and highly cell-type depen-
dent, which may result from the varied expression contexts of
miR-125b target genes in each tumor.
Identification of miR-125b target genes is critical for
understanding the role of miR-125b in tumorigenesis, and
is important for defining novel therapeutic targets. To date,
ERBB2/ERBB3, Bak1, CYP24, NR2A, TNF-a Bmf, Smo
and p53 have been identified as targets of miR-125b (26). In
Figure 4. MMP13 is a direct target of miR-125b. Luciferase activity sig- bladder cancer, miR-125b was able to inhibit the proliferation
nificantly decreased following co-transfection with miR-125b and reporter
and suppress the bladder cancer cells, to form colonies in
plasmid in T24 and EJ cells. Overexpression of miR-125b suppressed MMP13
vitro and to develop tumors in vivo by targeting E2F3 (23).
3'UTR-luciferase activity by 41% in T24 cells and 43% in EJ cells compared
with the controls (P<0.05). Three independent experiments were performed In the present study, we demonstrated that miR-125b trans-
and data are presented as mean ± standard deviation. MMP13, matrix metal- fection resulted in decreased cell migration and invasion
loproteinase 13; miR-Ctrl, miRNA-control; miR-125, microRNA-125b.
in bladder cancer T24 and EJ cells by targeting MMP13. It
is concordant with the recent finding in human cutaneous
squamous cell carcinoma (27). Our finding suggested that
decreased following the transfection of miR-125b mimics miR-125b may be used for the development of new molecular
in bladder cancer cell lines T24 and EJ. As demonstrated in markers and therapeutic approaches to inhibit bladder cancer
Fig. 3, MMP13 was significantly downregulated in bladder metastasis.
cancer T24 and EJ cell lines following the overexpression of MMPs are a family of structurally related zinc-dependent
miR-125b (P<0.05). These results indicated that miR-125b endopeptidases, which, as a group, are capable of degrading
reduced the protein level of MMP13 in bladder cancer cells. essentially all extracellular matrix (ECM) components.
There are 24 soluble and membrane-anchored members
MMP13 is a direct target gene of miR-125b in bladder of the MMP family in humans that demonstrate extensive
cancer. According to a computational prediction, there is sequence homology and overlap, but distinct substrate speci-
an evolutionarily conserved putative binding site of miR- ficities (28).MMPs are found in both normal and pathological
125b in MMP13 3'UTR. Luciferase reporter assays were tissue in which matrix remodeling is involved, including
ONCOLOGY LETTERS 5: 829-834, 2013 833
embryonic development, wound healing, arthritis and angio- Reference
genesis, as well as tumor invasion and metastasis (29,30).
Therefore, elevated levels of MMPs have been detected in the 1. Jemal A, Bray F, Center MM, Ferlay J, Ward E and Forman D:
Global cancer statistics. CA Cancer J Clin 61: 69-90.
serum and urine of patients with numerous different types of
2. Edwards BK, Ward E, Kohler BA, Eheman C, Zauber AG,
cancer, including cancer of the bladder, breast, lung, colon, Anderson RN, Jemal A, Schymura MJ, Lansdorp-Vogelaar I,
head and neck, as well as melanoma (31). Proteolytic activity Seeff LC, van Ballegooijen M, et al: Annual report to the nation
on the status of cancer, 1975-2006, featuring colorectal cancer
of the MMPs is regulated at several levels, most notably via
trends and impact of interventions (risk factors, screening, and
gene transcription, activation via proteolysis of a propeptide, treatment) to reduce future rates. Cancer 116: 544-573.
cell compartmentalization and inhibition by the endog- 3. Kirkali Z, Chan T, Manoharan M, Algaba F, Busch C, Cheng L,
Kiemeney L, Kriegmair M, Montironi R, Murphy WM,
enous tissue inhibitors of metalloproteinases (TIMPs) (32).
Sesterhenn IA, et al: Bladder cancer: epidemiology, staging and
Although they have pro-invasive properties, the functions grading, and diagnosis. Urology 66: 4-34, 2005.
of MMPs have been demonstrated to be significantly more 4. Heney NM:Natural history of superficial bladder cancer.
widespread than simply facilitating migration and invasion. Prognostic features and long-term disease course. Urol Clin
North Am 19: 429-433, 1992.
They are also involved in processes such as tumor initia-
5. Noguchi S, Mori T, Hoshino Y, Maruo K, Yamada N, Kitade Y,
tion and progression, activation of chemokines and growth Naoe T and Akao Y: MicroRNA-143 functions as a tumor
factors, angiogenesis and apoptosis induction. Therefore, it is suppressor in human bladder cancer T24 cells. Cancer Lett 307:
211-220, 2011.
not surprising that numerous MMPs have been identified in
6. Mazdak H and Zia H: Vitamin E reduces superficial bladder
cancer tissue (33). cancer recurrence: a randomized controlled trial. Int J Prev
MMP13 was first identified in breast carcinoma (34). Med 3: 110-115, 2012.
7. Osaki M, Takeshita F, Sugimoto Y, Kosaka N, Yamamoto Y,
Compared with the other MMPs, MMP13 has wide substrate
Yoshioka Y, Kobayashi E, Yamada T, Kawai A, Inoue T, Ito H,
specificity and a limited expression pattern (35). Physiological et al: MicroRNA-143 regulates human osteosarcoma metastasis
expression of MMP13 is observed to be limited to tissues by regulating matrix metalloprotease-13 expression. Mol Ther
19: 1123-1130, 2011.
undergoing rapid connective tissue remodeling, such as during
8. Stefani G and Slack FJ: Small non-coding RNAs in animal
fetal bone development, post-natal bone remodeling and development. Nat Rev Mol Cell Biol 9: 219-230, 2008.
gingival wound repair (36). However, MMP13 is expressed in 9. Ambros V: The functions of animal microRNAs. Nature 431:
350-355, 2004.
various diseases involving degradation of collagenous ECM
10. He L and Hannon GJ: MicroRNAs: small RNAs with a big role
and in malignant tumors, such as squamous cell carcinomas
in gene regulation. Nat Rev Genet 5: 522-531, 2004.
of both the head and neck, and the vulva, cutaneous basal- 11. Schickel R, Boyerinas B, Park SM and Peter ME: MicroRNAs:
cell carcinomas, chondrosarcomas and melanomas. In bladder key players in the immune system, differentiation, tumorigenesis
and cell death. Oncogene 27: 5959-5974, 2008.
cancer, it was demonstrated that MMP13 was expressed in
12. Lu J, Getz G, Miska EA, Alvarez-Saavedra E, Lamb J,
tumor cells, particularly at the invading edges. In a previous Peck D, Sweet-Cordero A, Ebert BL, Mak RH, Ferrando AA,
study, it was demonstrated that there was no MMP13 expres- Downing JR, et al: MicroRNA expression profiles classify
human cancers. Nature 435: 834-838, 2005.
sion in normal urothelium (37). This suggested that MMP13
13. Lim LP, Lau NC, Garrett-Engele P, Grimson A, Schelter JM,
may serve as a marker for transformation and invasion Castle J, Bartel DP, Linsley PS and Johnson JM: Microarray
in TCC, otherwise, it may be a target for cancer therapy in analysis shows that some microRNAs downregulate large
numbers of target mRNAs. Nature 433: 769-773, 2005.
order to inhibit metastasis from TCC. Our results suggested
14. Calin GA and Croce CM: MicroRNA signatures in human
that miR-125b suppressed bladder cancer cell migration and cancers. Nat Rev Cancer 6: 857-866, 2006.
invasion through downregulation of MMP13. This could be 15. Tang F, Zhang R, He Y, Zou M, Guo L and Xi T: MicroRNA-125b
induces metastasis by targeting STARD13 in MCF-7 and
investigated as a predictive value for early detection of tumor
MDA-MB-231 breast cancer cells. PLoS One 7: e35435, 2012.
recurrence and target therapy drugs to prevent bladder cancer
16. Zhang H, Luo XQ, Feng DD, Zhang XJ, Wu J, Zheng YS,
from becoming invasive. Chen X, Xu L and Chen YQ: Upregulation of microRNA-125b
In summary, to our knowledge, this is the first study to contributes to leukemogenesis and increases drug resistance in
pediatric acute promyelocytic leukemia. Mol Cancer 10: 108,
demonstrate that miR-125b regulates MMP13, and contributes
2011.
to cell migration and invasion in bladder cancer. These find- 17. Xia HF, He TZ, Liu CM, Cui Y, Song PP, Jin XH, and Ma X:
ings have therapeutic implications and may be exploited for MiR-125b expression affects the proliferation and apoptosis of
human glioma cells by targeting Bmf. Cell Physiol Biochem 23:
further treatment of bladder cancer. miRNA-based therapy is
347-358, 2009.
expected to be more efficient than the traditional single target 18. Bousquet M, Quelen C, Rosati R, Mansat-De Mas V, La Starza R,
therapy, as miRNAs regulate multiple target genes simultane- Bastard C, Lippert E, Talmant P, Lafage-Pochitaloff M,
Leroux D, Gervais C, et al: Myeloid cell differentiation arrest
ously. Thus, the likelihood of tumor cells developing resistance
by miR-125b-1 in myelodysplastic syndrome and acute myeloid
by accumulating mutations is smaller. Future studies are leukemia with the t(2;11) (p21;q23) translocation. J Exp Med 205:
required to address whether the potential of miR-125b may be 2499-2506, 2008.
19. Akhavantabasi S, Sapmaz A, Tuna S and Erson-Bensan AE:
fully realized in cancer treatment. If so, this may be beneficial
miR-125b targets ARID3B in breast cancer cells. Cell Struct
for the treatment of bladder cancer. Funct 37: 27-38, 2012.
20. Shi XB, Xue L, Ma AH, Tepper CG, Kung HJ and White RW:
miR-125b promotes growth of prostate cancer xenograft tumor
Acknowledgements
through targeting pro-apoptotic genes. Prostate 71: 538-549,
2011.
This study was supported by the Program of Key Medical 21. Shi XB, Xue L, Yang J, Ma AH, Zhao J, Xu M, Tepper CG,
Evans CP, Kung HJ and deVere White RW: An androgen-
Departments of Jiangsu Province (the Department of General
regulated miRNA suppresses Bak1 expression and induces
Surgery and the Department of Urology of Jiangsu Province androgen-independent growth of prostate cancer cells. Proc Natl
Hospital). Acad Sci USA 104: 19983-19988, 2007.
834 WU et al: miR-125b INHIBITS MIGRATION AND INVASION IN BLADDER CANCER
22. Henson BJ, Bhattacharjee S, O'Dee DM, Feingold E and 31. Moses MA, Wiederschain D, Loughlin KR, Zurakowski D,
Gollin SM: Decreased expression of miR-125b and miR-100 in Lamb CC and Freeman MR: Increased incidence of matrix
oral cancer cells contributes to malignancy. Genes Chromosomes metalloproteinases in urine of cancer patients. Cancer Res 58:
Cancer 48: 569-582, 2009. 1395-1399, 1998.
23. Huang L, Luo J, Cai Q, Pan Q, Zeng H, Guo Z, Dong W, Huang J 32. Egeblad M and Werb Z: New functions for the matrix metal-
and Lin T: MicroRNA-125b suppresses the development of bladder loproteinases in cancer progression. Nat Rev Cancer 2: 161-174,
cancer by targeting E2F3. Int J Cancer 128: 1758-1769, 2010. 2002.
24. Liu LH, Li H, Li JP, Zhong H, Zhang HC, Chen J and Xiao T: 33. Lafleur MA, Drew AF, de Sousa EL, Blick T, Bills M, Walker EC,
miR-125b suppresses the proliferation and migration of osteo- Williams ED, Waltham M and Thompson EW: Upregulation of
sarcoma cells through down-regulation of STAT3. Biochem matrix metalloproteinases (MMPs) in breast cancer xenografts:
Biophys Res Commun 416: 31-38, 2011. a major induction of stromal MMP-13. Int J Cancer 114: 544-554,
25. Xu N, Brodin P, Wei T, Meisgen F, Eidsmo L, Nagy N, Kemeny L, 2005.
Ståhle M, Sonkoly E and Pivarcsi A: MiR-125b, a microRNA 34. Freije JM, Diez-Itza I, Balbin M, Sanchez LM, Blasco R,
downregulated in psoriasis, modulates keratinocyte proliferation Tolivia J and López-Otin C: Molecular cloning and expression of
by targeting FGFR2. J Invest Dermatol 131: 1521-1529, 2011. collagenase-3, a novel human matrix metalloproteinase produced
26. Zhang Y, Yan LX, Wu QN, Du ZM, Chen J, Liao DZ, Huang by breast carcinomas. J Biol Chem 269: 16766-16773, 1994.
MY, Hou JH, Wu QL, Zeng MS, Huang WL, et al: miR-125b is 35. Saarialho-Kere U, Kerkelä E, Jeskanen L, Hasan T, Pierce R,
methylated and functions as a tumor suppressor by regulating the Starcher B, Raudasoja R, Ranki A, Oikarinen A and Vaalamo M:
ETS1 proto-oncogene in human invasive breast cancer. Cancer Accumulation of matrilysin (MMP-7) and macrophage metal-
Res 71: 3552-3562, 2011. loelastase (MMP-12) in actinic damage. J Invest Dermatol 113:
27. Xu N, Zhang L, Meisgen F, Harada M, Heilborn J, Homey B, 664-672, 1999.
Grander D, Stahle M, Sonkoly E and Pivarcsi A: MicroRNA-125b 36. Ravanti L, Heino J, López-Otin C and Kähäri VM: Induction of
down-regulates matrix metallopeptidase 13 and inhibits collagenase-3 (MMP-13) expression in human skin fibroblasts by
cutaneous squamous cell carcinoma cell proliferation, migration, three-dimensional collagen is mediated by p38 mitogen-activated
and invasion. J Biol Chem 287: 29899-29908, 2012. protein kinase. J Biol Chem 274: 2446-2455, 1999.
28. Lafleur MA, Handsley MM and Edwards DR: Metalloproteinases 37. Boström PJ, Ravanti L, Reunanen N, Aaltonen V, Söderström KO,
and their inhibitors in angiogenesis. Expert Rev Mol Med 5: 1-39, Kähäri VM and Laato M: Expression of collagenase-3 (matrix
2003. metalloproteinase-13) in transitional-cell carcinoma of the
29. Liotta LA and Stetler-Stevenson WG: Metalloproteinases and urinary bladder. Int J Cancer 88: 417-423, 2000.
cancer invasion. Semin Cancer Biol 1: 99-106, 1990.
30. Liotta LA, Steeg PS and Stetler-Stevenson WG: Cancer
metastasis and angiogenesis: an imbalance of positive and
negative regulation. Cell 64: 327-336, 1991.