Table Of ContentJetal.BMCMusculoskeletalDisorders2012,13:53
http://www.biomedcentral.com/1471-2474/13/53
RESEARCH ARTICLE Open Access
Local biochemical and morphological differences
in human Achilles tendinopathy: a case control
study
Pingel J1*, Fredberg U2, Qvortrup K3, Larsen JO4, Schjerling P1, Heinemeier K1, Kjaer M1 and Langberg H5
Abstract
Background: The incidence of Achilles tendinopathy is high and underlying etiology as well as biochemical and
morphological pathology associated with the disease is largely unknown. The aim of the present study was to
describe biochemical and morphological differences in chronic Achilles tendinopathy. The expressions of growth
factors, inflammatory mediators and tendon morphology were determined in both chronically diseased and
healthy tendon parts.
Methods: Thirty Achilles tendinopathy patients were randomized to an expression-study (n = 16) or a structural-
study (n = 14). Biopsies from two areas in the Achilles tendon were taken and structural parameters: fibril density,
fibril size, volume fraction of cells and the nucleus/cytoplasm ratio of cells were determined. Further gene
expressions of various genes were analyzed.
Results: Significantlysmallercollagenfibrilsandahighervolumefractionofcellswereobservedinthe
tendinopathicregionofthetendon.Markersforcollagenanditssynthesiscollagen1,collagen3,fibronectin,
tenascin-c,transforminggrowthfactor-bfibromodulin,andmarkersofcollagenbreakdownmatrixmetalloproteinase-
2,matrixmetalloproteinase-9andmetallopeptidaseinhibitor-2weresignificantlyincreasedinthetendinopathic
region.Noalteredexpressionsofmarkersforfibrillogenesis,inflammationorwoundhealingwereobserved.
Conclusion: The present study indicates that an increased expression of factors stimulating the turnover of
connective tissue is present in the diseased part of tendinopathic tendons, associated with an increased number of
cells in the injured area as well as an increased number of smaller and thinner fibrils in the diseased tendon
region. As no fibrillogenesis, inflammation or wound healing could be detected, the present data supports the
notion that tendinopathy is an ongoing degenerative process.
Trial registration: Current Controlled Trials ISRCTN20896880
Keywords: Collagen, Gene expression, Patients, Growth factors, Tissue turnover
Background adaptation to loading can ultimately leadto increases in
Tendons connect muscle to bone and enable transmis- CSAandcollagencontent inchronicallyloaded tendons
sionofforcesfromcontractingmuscletobone,resulting [5].Despitethisphysiologicalabilitytoadapt,tendinopa-
in joint movement. They possess the ability to adapt to tic tendons represents a large and constantly growing
changes in loading [1] and studies have shown that col- clinical problem affecting both recreational and profes-
lagensynthesisisincreasedasaresultofbothacuteexer- sional athletes as well as people involved in repetitive
cise [2,3] and prolonged physical training [4]. The labour [6,7]. Years of research have unfortunately not
provided much insight into the pathogenesis of chronic
tendinopathy [8]. Indeed, the etiology of tendinopathy
*Correspondence:[email protected]
1InstituteofSportsMedicine,DepartmentofOrthopedicSurgeryM. hasbeenrelated to repeated micro strainbelow the fail-
BispebjergHospitalandCenterforHealthyAging,FacultyofHealthSciences, ure threshold as an initiating stimulus for degenerative
UniversityofCopenhagen,Copenhagen,Denmark processes[9,10].Other authors,however,haveproposed
Fulllistofauthorinformationisavailableattheendofthearticle
©2012Jetal;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreativeCommons
AttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,andreproductionin
anymedium,providedtheoriginalworkisproperlycited.
Jetal.BMCMusculoskeletalDisorders2012,13:53 Page2of13
http://www.biomedcentral.com/1471-2474/13/53
that mechano-biological under-stimulation results in a factor (bFGF) are decreased causing a reduced healing
degenerative cascade, through the production of a pat- capacityintheinjuredareaoftheAchillestendons.
ternofcatabolicgeneexpressionthatleadsultimatelyto
extracellular matrix degeneration [11]. Tendinopathy is Methods
characterized by activity-related pain, focal tendon ten- Design
derness, and decreased local movement in the affected Thirty patients with chronic Achilles tendon pain were
area[12,13].Thegeneralopinionisthatnoinflammatory includedinthisstudyapprovedbythelocalEthicalCom-
cellsarepresentinthetendinopathictissue[14]andthat mitteeoftheCapitalRegionCopenhagen(H-1-2009-114)
tendinopathyistheresultofa degenerativeprocesswith and in compliance with the Helsinki Declaration. Addi-
collagen disorganization, collagen fibre separation, tionally the study was registered at Current Controlled
increasedcellularity,neovascularizationandfocal necro- Trials (ISRCTN20896880). Due to limitations in the
sis[15]. amount of tissue gained from the tendon biopsies
Previousstudieshaveshownanalteredconcentrationof patients were randomly assigned to either a Structural
certain matrix metalloproteinases MMPs, AdAMt’s and study (n = 14) or a Biochemical study (n = 16) by the
TIMP’sinnormalanddegeneratehumanAchillestendon envelope method. Allsubjectswererecreationalathletes
[16].Additionallyseveralcytokines[9,10]canbefoundin or workers with a long-term history of chronic Achilles
tendonsandfibroblastsaftercyclicmechanicalstretching tendonpain(>1/2year)(Table4)andconventionalcon-
in healthy tendon tissue. However, the published data servative treatments (eccentric rehabilitation, NSAIDs
arises from the comparison of tendinopathic tissue with andcorticosteroidinjections)hadbeentriedinallindivi-
either control tissue from different anatomical tendons duals with no effect. Intake of NSAID or corticosteroid
[17]orwithtissuesfromidenticalanatomicaltendonsbut injectionwasnotallowed6monthspriortoinclusionin
from different subjects [18]. Since considerable micro- the present study. All subjects were recruited from the
scopic structure differences have been demonstrated in Rheumatology Department, Silkeborg Hospital, Den-
anatomicallydifferenttendons[19],thislimitstheconclu- mark, and the biopsies from the Achilles tendons were
sions that may be drawn from these studies. Taking the takenaspartofastandardprocedureinordertoexamine
aforementionedlimitationsintoaccount,currentdatacon- for deposits ofcholesterol, uric acid, and amyloid in the
cerninglocalbiochemicaldifferenceswithintendinopathic injuredAchillestendons.
tendons,seemtoindicatethatanalteredexpressionofcol-
lagen [20], proteoglycans [21] and matrix metalloprotei- Biopsy procedure
nases[16,22]existsintendinopathic tendons.Inaddition The subjects were locally anesthetized, in the peritendi-
thelevelofcytokines[23]VEGFandfibronectin[24]has nous space from both the medial and lateral side of the
been shown to be significantly different in the tendino- tendon with injections of 2 × 10 ml 1% Lidocain, using
pathicarea.Howeveranalysesoflocalbiochemicaldiffer- ultrasound guidance. Biopsies were taken with a semi-
encestogetherwithmorphologicaldifferencesarelacking. automatic biopsy needle (14 GA, 9 cm; Angiotech) also
The aim of the present study was to elucidate if any usingultrasound(US)guidance. Aninitialtendonbiopsy
local structural differences are present in tendinopathic was taken inthe maximally sickarea evaluatedusing US
areas of human Achilles tendons compared to healthy (definedastheareawithmaximalincreasedtendonthick-
areas in the same tendon. Furthermore, we wanted to ness,neovascularisation,hypoeccogenicity).Thisareawas
investigate which proteoglycans, growth factors and usually3-5cmabovetheattachment of the Achillesten-
cytokines that were involved in the local structural dif- don to the calcanaeus bone. A second biopsy was taken
ferences observed. fromthesametendon4cmproximaltothefirstbiopsyin
Wehypothesizethatseveralmarkerssuchascollagen3 a region of the tendon tissue that was deemed normal
wouldbelocallyupregulatedindicatingformationofscar usingUS.
tissue withinthe tendon[25] and higher concentrations BiopsysamplesintendedforanalysisusingTransmission
ofMMP-2 andMMP-9indicating an enhanced degrada- ElectronMicroscopywereimmersedin2%glutaraldehyde
tion of collagen structures in the tendinopathic area (t- in 0.05 M sodium buffer (pH 7.2), and the samples for
area)whencomparedwiththehealthyarea(h-area)ofthe gene expression were snap-frozen and stored at -80°C
sametendon.Furthermoreitishypothesizedthatcertain untilanalysis.
proteoglycans would have altered expression in the two
tendon regions, e.g. an increased expression of decorin Transmission electron microscopy of tendon biopsies
which might cause the collagen turnovertobe increased Fourteen tendon biopsy pairs were cut into small pieces
also in chronic tendinopathic tendons. Additionally we and were immersion-fixed in 2% glutaraldehyde for
hypothesize that growth factors like fibroblast growth 24 hours. Following three rinses in 0.15 M sodium
Jetal.BMCMusculoskeletalDisorders2012,13:53 Page3of13
http://www.biomedcentral.com/1471-2474/13/53
phosphate buffer(pH 7.2) the specimens werepost-fixed ofthetendontissue.Theestimatedparameterswere:the
in 1% OsO in 0.12 M sodium cacodylic buffer for volume fraction of cells within the tendon, the volume
4
2hours.Thespecimensweredehydratedinagradedseries fraction of the nucleus within the cell, and the volume
ofethanol(70%,96%and100%),transferredtopropylene fraction of cytoplasm within the cell. A single experi-
oxide and embedded in Epon (VWR Bie&Berntsen) in encedinvestigatorperformedallstereologicalanalysesin
three steps according to standard procedures. For each a blinded fashion. The investigator was blinded for all
biopsy one ultra thinsectionwas cutapproximately per- subject characteristics, and whether the sample was
pendiculartothelengthaxisof thetendon witha Reich- obtainedfromthetendinopathicorthehealthyregionof
ert-JungultracutEmicrotome.Thesectionwascollected thetendon.
on a one-hole copper grid with a Formvar supporting
membrane and stained with uranyl acetate and lead RNA extraction and real time-PCR analysis
citrate. The sections were examined using a Phillips CM Total RNAisolation: Total RNA wasextracted fromfro-
100 transmission electron microscope operated at an zen tendon samples from 16 subjects (sample weight:
acceleratingvoltageof80kV.Digitalimageswereobtained mean23.2±6.4mg)byusing1mlofTRIReagent(Mole-
withaMegaViewIIcameraandananalysissoftwarepack- cularResearchCentre,Cincinnati,OH)5steelbeads(2.3
age. From each ultra thin section the intercellular tissue mm) and 4 silica beads (1.0 mm Silicon Carbide Beads
was examined by taking a simple, random sample of ten (454grams)BioSpecProductsInc.).Glycogenwasadded
digitizedTEMimagesoftheintercellulartissue.Thecellu- (120 μg per ml of TriReagent) to the tendon samples to
lar component of the tendon was examined in eleven improveRNAprecipitation.
biopsypairsbytaking6times6imagesinthreerandomly ExtractedRNAwasprecipitatedfromtheaqueousphase
positioned regions of the section. The 6 times 6 images with isopropanol and was washed with ethanol [75%],
were spliced into one image using multiple image align- driedandsuspendedin10μlofnuclease-free water.The
ment(MIA)tools, so foreachexamined biopsyatotalof RNA concentration was determined using a RiboGreen
threeMIAimageswereobtained. RNAQuantitationkit200-2000Assays,MolecularProbes
USA.RNAqualitywasdeterminedonthebasisofaRNA
Stereology 6000nanoChipassaykit,AgilentTechnologies,Germany.
TheStereologicalanalysesoftheimageswerecarriedout TheRNAsampleswerestoredfrozenat-20°Cuntilsubse-
on a computer monitor onto which the digitized EM quentuseinreal-timeRT-PCRprocedures.
image was merged with a graphic representation of the cDNA synthesis: 100 ng RNA was reverse transcribed
stereological test systems for just 12 of the 14 biopsy foreachtendonsampleinatotalvolumeof20μlbyusing
pairs (2 biopsies was unfortunately not useable for theQiagenOmniscriptRTKitat37°Cfor1hourfollowed
stereologyanalyses)(C.A.S.T.-gridsoftware,TheInterna- by70°C for15minutes.Theresulting cDNA wasdiluted
tional Stereology Center at Olympus). The intercellular twentytimesindilutionbuffer(10mMTrisEDTAbuffer:
tissuewasanalyzedatafinalmagnificationof210.000in Sigma Germany) + Salmon Testes DNA (1 ng/μl; Sigma
the ten ordinary TEMimages. Thevolume fraction (Vv) Germany),andsampleswerestoredat-20°Cuntilusedin
ofcollagenfibrilsperintercellulartissuevolumewasesti- thePCRreactionsforspecificmRNAanalysis.
matedwiththe pointcounting technique asthe number PolymeraseChainReaction:TheReal-timePCR-method
ofpointshittingcollagenfibresdividedbythenumberof using Glyceraldehyde 3-phosphate dehydrogenase
pointshittingtheintercellular tissue (includingcollagen (GAPDH)and60SacidicribosomalproteinP0(RPLP0)as
fibrils) using a point grid of 36 points. The number of reference genestostudyspecific mRNA’sofinterestwas
collagenfibrilspercrosssectionalareaofintercellulartis- applied.TheprimerswerepurchasedfromMWGBiotech.
sue (NA) was counted in 16 uniformly positioned, ForeachtargetcDNAthePCRreactionswerecarriedout
unbiased counting frames, each with an area of 0.0426 underidenticalconditionsbyusing5μldilutedcDNAina
mm2 (42.6μm2), and the individual diameters (d) ofthe total volume of 25 μlQuantiTect SYBR Green PCR Mix
sampledcollagenfibrilsweremeasuredasthelargestdia- (Qiagen)and100nMofeachprimer(Table2).Theampli-
meterperpendiculartothelongestaxis(i.e.thelengthof fication was monitored in real-time using a MX3005P
theminoraxisoftheellipse) usingthe“measure-length” real-time PCR machine (Stratagene, CA). The threshold
featureoftheCAST-gridsystem.Theunbiasedcounting cycle (C) values were related to a standard curve made
t
frameensuresthatallprofiles,regardlessofshape,sizeor withclonedPCRproductstodeterminetherelativediffer-
orientation, have an equal probability of being sampled ence between the unknown samples, accounting for the
within area probe. The MIA images were analyzed at a PCR efficiency. The specificity of the PCR reaction was
finalmagnificationof115,000.The pointcountingtech- confirmed by melting curve analysis after amplification.
nique,usingapointgridwithapproximately1000points, Thereal-timePCRconditionswereasfollows:todenatu-
estimatedthevolumefractionsofthecellularcomponent ratetheDNAstrandsthereactionmixwasheated above
Jetal.BMCMusculoskeletalDisorders2012,13:53 Page4of13
http://www.biomedcentral.com/1471-2474/13/53
the melting temperature of DNA (95°C) for 10 minutes, ofthefibrils,asignificantlyhighernumberoffibrilswitha
followedby50cycleseachof15secondsat95°C,followed diameterinthelowerrange(10-40nm)wasfoundinthe
bytheannealingstepwhereoptimalprimerhybridization tendinopathicareacomparedtothehealthyarea(diameter
conditionswereobtainedbyloweringthetemperatureto 10-20nm:Tendinopathicarea:32±7fibrils/μm2;Healthy
58°C for 30 seconds, and the extension step, where the area 13 ± 4 fibrils/μm2; diameter: 20-30 nm: Tendino-
reaction mix was heated to 63°C for 90 seconds. Two pathic area: 68 ± 10 fibrils/μm2; Healthy area: 26 ±
housekeeping genes GAPDH and RPLP0 were used as 4 fibrils/μm2; diameter 30-40 nm: Tendinopathic area:
reference genes. The RPLP0gene hadbeenchosenasan 74± 10 fibrils/μm2; Healthy area: 42 ± 5 fibrils/μm2; see
internal control, assuming RPLP0 to be constitutively Figure1).Inadditionasignificantlyhighervolumefraction
expressed. To validate this assumption GAPDH mRNA ofcellswasobservedinthetendinopathicareaoftheten-
wasmeasuredasanotherunrelated“constitutive”andnor- don (Figure 2). The volume fraction of the cytoplasm
malized with RPLP0, showing no difference between withinthecellwasfoundto beidenticalinthetwoareas
the healthy and the tendinopathic region of the tendon (Figure 2) implying an increased number of cells in the
(Figure3). tendinopathicarea.
Statistical analysis Gene expression analysis
ThePCRdatawerelogtransformedandaPairedStudents The gene expression of 24 genes was analyzed in the
t-test was performed to compare the results from the biopsies of 16 tendinopathy patients (Table 2). As men-
healthyareaofthetendonwiththetendinopathicareaof tioned in the methods section, GAPDH mRNA served
thetendon,withexceptionoftheresultsfromIL-6,IL-1b, as a normalization factor for the genes of interest, and
ki67andHGF-1.Thesegenetargetscouldnotbedetected RPLP0 mRNA was used to validate the stability of the
in all samples. In these cases Chi2 tests were performed. expression of GAPDH mRNA. Specific gene targets
AllPCRdataarepresentedasthegeomean±backtrans- were selected covering the areas of: Extracellular matrix
formed SEM. The collagen fibril data were divided into (ECM) components, degradation components, Growth
area and diameter fractions, and a paired Students t-test factors, inflammatory markers and fibrillogenesis.
was performed to compare each fraction between the Extracellularmatrixcomponents:Theexpressionofsev-
healthy and the tendinopathic area of the tendon. Like- eral structural components (collagen 1 and collagen 3)
wise,thevolumefractionofcellsandthevolumefraction togetherwithmRNAoffibronectin,tenascin-candfibro-
of the nucleus within the cell were compared using a modulinwasfoundtobesignificantlyupregulatedinthe
PairedStudentt-testcomparingthetwoareasoftheten- t-area(Figure3).Versicanwasfoundtobeunchangedand
don.AP-value<0.05wasconsideredtobesignificantand decorintendedtobedecreasedinthet-areacomparedto
alldatadespiteofthesubjectcharacteristicsareshownas thatoftheh-areaoftheAchillestendon(Figure3).
Mean±SEM. Degradationfactors:ExpressionofMMP-2,MMP-9and
TIMP-2 was significantly increased in the t-areas com-
Results paredtothat oftheh-areaswithnodifferenceinexpres-
Structural composition of the tendon sionofTIMP-1(Figure3).
The density, volume fraction and mean area of the col- Growthfactors: A significant up-regulation ofTGF-b1
lagenfibrilsweremeasuredinbiopsiesfrom14oftheten- expressionwasobservedinthet-areacomparedtothatof
dinopathy patients (Table 1). The density of collagen the h-area, whereas bFGF and cmet expression in the
fibrils wasfound to be significantly higher andthe mean sameareawassignificantlydecreased.Nodifferenceswere
areaofthecollagenfibrilswassignificantlysmallerinten- observedintheexpressionofCTGF,VEGF-A1andIGF-1
dinopathic tendon region compared to that of healthy (Figure4).TheexpressionofHGF-1couldnotbedetected
controlregion,additionallyatrendtowardssignificantdif- in all samples but no significant differences were found
ference was found in volume fraction (Table 1). When betweenthetworegionsofthetendon(Table3).
analysingtheindividualbinsin the diameterdistribution Inflammatory markers: Data on IL-6, IL-1b and ki67
could not be detected in all samples and no differences
wereobservedwhenthetworegionswerecompared(chi
Table 1Tendonfibril characteristics
squared test). Ki67 showed a significant decrease in
SickTendon HealthyTendon
expression in the tendinopathic areas. No expression
Tissue Tissue
Mean SD Mean SD P-value could be detected of COX-2 and TNF-a in any of the
samples(resultsnotshown).COX-1,IL-1RandCCL2was
Density 155,73 48,80 111,09 46,72 0,04
detectedinallsamples,buttherewasnosignificantdiffer-
VolumeFraction 0,56 0,08 0,61 0,08 0,06
encebetweenthet-areaandtheh-areaofthetendon(Fig-
MeanArea 2963,54 1693,29 5239,15 2298,83 0,02
ure 4). Fibrillogenesis: There were no differences in
Jetal.BMCMusculoskeletalDisorders2012,13:53 Page5of13
http://www.biomedcentral.com/1471-2474/13/53
Figure1Fibrildiameterdistribution.Fibrildiameterofthetendinopathicandthehealthyareaofthesametendondividedintofractions.
ErrorbarsrepresentSEM(P<0.05).
expression of scleraxis, tenomodulin and Lysyloxidase significantly larger fibril area and a lower collagen fibril
(LOX)betweenthetwoareas(Figure5) density was observed in patellar tendinopathy [27]. This
discrepancy might partly be explained by the fact of the
Discussion patella tendon functions more like a ligament (ligament
The major finding of the present study is that tendino- patella) with the primary role of ensuring a fixed dis-
pathy causes focal biochemical and morphological differ- tance between the patella apex and the insertion of the
ences in the human Achilles tendon. The data obtained tendon on to the tibia bone, in contrast to the Achilles
using TEM indicate that the structural composition of tendon which functions more like a spring, providing a
the t-area has a significantly increase in the number of means of shock absorption via the connective tissue,
smaller collagen fibrils compared to the h-area of the during periods of muscle contraction and loading [28].
same tendon. This supports our hypothesis that loca- SincethefunctionofthepatellarandtheAchillestendon
lized structural differences are present in tendinopathic differ,itislikelythatthestructureofthetendonse.g.the
Achilles tendons, potentially as a result of an increased cross-linkingandlength offibrilsetc. of thetwotendons
turnover of the tissue in an attempt to heal potentially reflects this difference. A further explanation might be
injured tissue. This fits with previous findings where a thatthehealthytissuewastakenfromthesametendonin
site-specific loss of larger collagen fibrils and an increase thepresent study, whileKongsgaardet al.[27] used con-
of fibrils with a small diameter was observed in Achilles trol tissue taken from another tendon of healthy control
tendons after tendon rupture [26]. However the present subjects. The present design has as all study designs
findings differ somewhat from the results observed in advantages and limitations. The advantage is that this
another study from our laboratory [27], in which a design enables to investigate local differences in the
Jetal.BMCMusculoskeletalDisorders2012,13:53 Page6of13
http://www.biomedcentral.com/1471-2474/13/53
Figure2Volumefractionofcellsandcytoplasmwithinthecells.ErrorbarsrepresentSEM.(P<0.05).
tendon,thelimitationisthatnocontroltissueisavailable tenomodulin was analysed. Both gene targets have pre-
fromtendonsthatneverhadanysymptoms.Changesthat viouslybeenassociatedwithtendonformationanddevel-
occurinthewholetendoncanthereforebeoverlooked.A opment[30,31].Theabsentdifferenceoftheexpressionof
previousstudyhasshownthathistologicalchangesinthe scleraxisandtenomodulinsuggeststhatnofibrillogenesis
tendon were not only present at the site of rupture but tookplaceinthet-areaatthisverylatestageinthedisease
alsointhemacroscopicalnormalpartofthetendon,indi- (Figure5).FurthermoreasimilarexpressionofLysyloxi-
catingthatlocalalterationsofthetissuemightnotneces- dase (LOX) in both regions of the tendon indicates that
sarilybelocal[29].Whethertendinopathyshowsthesame thetissuedoesnotcompensateforthelocalizedstructural
pattern is unclear and needs further investigation. How- changesbyinitiatingcross-linkstomaintainthemechani-
everwebelievethatthepresentlocaldifferencesbetween cal properties of the tendon. Previously findings showed
thet-areaandtheh-areaarestrongenoughtojustify the that training increases the expression of LOX in healthy
conclusions of the present study. To investigate if the tendon tissue in rats [32]. The present data suggest that
increasednumberofsmallcollagenfibrilscouldbedueto thisadaptationdoesnottakeplaceint-areaofthetendon.
genesis of collagen fibrils or degradation of previously Several abnormalities of the tendon structure have been
much larger fibrils, the gene expression of scleraxis and investigatedwithhistopathologicalanalysisincludingfibre
Jetal.BMCMusculoskeletalDisorders2012,13:53 Page7of13
http://www.biomedcentral.com/1471-2474/13/53
Table 2PCRprimers
mRNA SensePrimer AntisensePrimer
Collagen1 GGCAACAGCCGCTTCACCTAC GCGGGAGGACTTGGTGGTTTT
Collagen3 CACGGAAACACTGGTGGACAGATT ATGCCAGCTGCACATCAAGGAC
Fibronectin TTTGCTCCTGCACATGCTTT TAGTGCCTTCGGGACTGGGTTC
TenascinC CAACCATCACTGCCAAGTTCACAA GGGGGTCGCCAGGTAAGGAG
Fibromodulin CAGTCAACACCAACCTGGAGAACC TGCAGAAGCTGCTGATGGAGAA
Versican AGTCAGTGGAAGGCACGGCAATCT CCGTTAAGGCACGGGTTCATTT
Decorin GGTGGGCTGGCAGAGCATAAGT TGTCCAGGTGGGCAGAAGTCA
MMP-2 CCGCCTTTAACTGGAGCAAAAACA TTGGGGAAGCCAGGATCCATTT
MMP-9 AGCGAGGTGGACCGGATGTT AGAAGCGGTCCTGGCAGAAATAG
TIMP-1 CGGGGCTTCACCAAGACCTACA TGGTCCGTCCACAAGCAATGA
TIMP-2 CTCGCTGGACGTTGGAGGAAAG GTGTCCCAGGGCACGATGAAGT
CTGF TGCGAAGCTGACCTGGAAGAGA GCCGTCGGTACATACTCCACAGAA
bFGF TGACGGGGTCCGGGAGAAGA ATAGCCAGGTAACGGTTAGCACACAC
HGF TGAAATATGTGCTGGGGCTGAAA ACAAACAAGTGGGCCACCATAATCC
cMet AACCCGAATACTGCCCAGACCC TGATATCCGGGACACCAGTTCAG
VEGFA-1 ATGACGAGGGCCTGGAGTGTGT CTCCTATGTGCTGGCCTTGGTG
IGF-1 GACATGCCCAAGACCCAGAAGGA CGGTGGCATGTCACTCTTCACTC
TGFb-1 GAGGTCACCCGCGTGCTAATG CACGGGTTCAGGTACCGCTTCT
Cox-1 GGTTTGGCATGAAACCCTACACCT CCTCCAACTCTGCTGCCATCT
IL-1R GGAAGGGATGACTACGTTGGGGA CCAGCCAGCTGAAGCCTGATGTT
IL-1b TCCAGGGACAGGATATGGAGCA AGGCCCAAGGCCACAGGTATTT
KI67 CGGAAGAGCTGAACAGCAACGA GCGTCTGGAGCGCAGGGATA
CCL GCCCTTCTGTGCCTGCTGCT GCAGGTGACTGGGGCATTGATT
IL-6 GAGGCACTGGCAGAAAACAACC CCTCAAACTCCAAAAGACCAGTGATG
TNF-a TTCCCCAGGGACCTCTCTCTAATC GAGGGTTTGCTACAACATGGGCTAC
RPLP0 GGAAACTCTGCATTCTCGCTTCCT CCAGGACTCGTTTGTACCCGTTG
GAPDH CCTCCTGCACCACCAACTGCTT GAGGGGCCATCCACAGTCTTCT
structure,fibrearrangement,nuclearroundingandcellu- thetendon.Ithaspreviouslybeenshownthatnormalten-
larity [15]. In the present study a significant increased don tissue express matrix metalloproteinases and that a
volumefractionofcellswasobservedinthetendinopathic homeostaticturnoverisnecessaryfortendonregeneration
area of the tendon using TEM. This is in line with pre- and maintenance [16]. A increased collagen turnover is
viousanimalstudiesofSoslowskyandcolleagues[33-35], usuallyassociatedwithadaptationtoexercise[2]orheal-
where rats ran with a velocity of 17 m/minute, 5 days/ ingofthetendon[38].Itisstillpuzzlingwhytheincreased
week,1hour/day,eitheruphillordownhillforaperiodof collagen turnover inthe tendons of chronic patients like
between2-16weeks.Insuchexperiments,adecreasedcol- thepresenthasnotresultedinadecreaseinsymptomsor
lagen fibre organization and increased numbers of cell a healing of the tissue (symptoms range: 0.5-10 years
nuclei were observed [36,37]. The present TEM analysis Table4).Howeverthesedataareconfirmedinotherstu-
didunfortunatelynotallowfordistinguishingbetweenthe diesalsoshowingincreasedcollagenturnoverintendino-
celltypesthatwerecounted,andthusitwasnotpossible pathic tendons [22,24] and in tendon ruptures [39].
toexcludethatothercelltypesthanjustfibroblastsmight Alterations in proteoglycans have previously been asso-
have migrated into the t-area of the tendon. The signifi- ciated with tendon pathology [40,41]. Proteoglycans and
cantly higher mRNA expression of both collagen I and glycoproteinsareessentialforthemaintenanceofhomeos-
collagenIIIinthet-areashowsahighercollagensynthesis tasisoftheECMofthetendonandachievethisbyregulat-
of the tendon. At the same time indicates the higher ingthecollagenfibrilassembly[42].Theupregulationof
expression of MMP-2 and MMP-9 in the t-area an tenascin-C,andfibronectinisconsistentwithearlierfind-
increased collagen matrix degradation. Together these ings [24,43]. The observed unchanged levels of versican
findingsdisplayahighercollagenturnoverinthet-areaof contrasts earlier findings, where a significant down
Jetal.BMCMusculoskeletalDisorders2012,13:53 Page8of13
http://www.biomedcentral.com/1471-2474/13/53
Figure 3 Collagen turnover. Gene expressions of collagens, non-collagenous matrix components, matrix metalloproteinases and
metallopeptidaseinhibitors,shownasarelativeratiobetweenthetendinopathicandthehealthyregionofthetendon.Thehealthyregion
equals1.ErrorbarsrepresentSEM.(P<0.05).
regulationofversicanwasobservedinbothtendinopathic patientshadaverylonghistoryoftendonpain(range:0.5-
andruptured tendontissue [40]. This discrepancy might 10 years). Thus the current biochemical situation in the
lie in the medical history of the patients. The present tissueofthesepatientsmayhavechangedovertime.The
Jetal.BMCMusculoskeletalDisorders2012,13:53 Page9of13
http://www.biomedcentral.com/1471-2474/13/53
Figure4 Tendon healing.GeneexpressionsofGrowthfactorsanddifferentinflammatory markers,shown asa relativeratio betweenthe
tendinopathicandthehealthyregionofthetendon.Thehealthyregionequals1.ErrorbarsrepresentSEM.(P<0.05).
observedtendencytoadecreaseofdecorinexpressionin depressed decorin is part of the healing response of the
thet-areaofthetendonwascontrarytoourhypothesis.It tendons and thus beneficial for the patients is unclear.
hasbeenpreviouslyshownthatadown-regulationofdec- Additionally the increased expressionof fibromodulinin
orinusinganti-sensedecorininjectionsimprovedligament thet-areamaypartlyexplaintheobservationofmanythin
healing in rabbits [44]. Whether the present finding of a collagen fibrils since fibromodulin participates in the
Jetal.BMCMusculoskeletalDisorders2012,13:53 Page10of13
http://www.biomedcentral.com/1471-2474/13/53
Table 3Inflammatorymarkers after one hour of exercise in the form of running, in
Healthy Tendinopathy Chitest healthyyoungmen[57].However,theissueastowhether
local injections of IL-6 in tendinopathy patients may be
(detected/notdetected) (detected/notdetected)
beneficial to the healing process of a damaged tendon is
IL-6 9/7 10/6 0.7
stillunknown.Thepainthattendinopathypatientsexperi-
IL-1b 4/12 6/10 0.4
ence has previously among other been related to Sub-
ki67 10/6 8/8 0.5
stance-P,aneuro-peptidewithvariousbiologicalfunctions
HGF-1 10/6 7/9 0.3
includingpaintransmission[58,59].Sincenodifferencein
total 16 16 Substance P expression were observed between the two
areas, the present data might indicate that other factors
matrixassemblyleadingtoadelayedfibrilformationand thansubstancePcanberesponsibleforthepainintendi-
formationofthinnerfibrils[45,46].Treatmentwithinjec- nopathic tendons. It is however also possible that the
tions of growth factors for tendon injuries has received expression of Substance-P is increased in the whole ten-
much attentioninrecentyears. Growthfactorsare poly- donandthereforeoverlookedduetothepreviouslymen-
peptidemoleculesthataredecisiveregulationofcellmeta- tionedlimitationsofthepresentdesign.Althoughtherole
bolism and cell proliferation and are associated with of inflammation in tendinopathy is one that is often dis-
tendonhealing[47-51].Studiesusinglocaladministration cussed, it has long been known that tendinopathy is pri-
ofbFGF[52,53],HGF[54,55]andIGF[56]haveallshown marily a degenerative condition, in which inflammatory
beneficialeffectsinthehealingprocessoftendoninjuries, cells in or around the lesion are absent. All markers of
but not all injurieswere tendinopathiesthough. Exogen- inflammationthatweremeasuredshowednoupregulated
ous injections of bFGF in human patellar tendons have expression in the t-area of the tendon (Table 3). This
been shown to increase wound healing both in vitro and underlinesthatlong-termtendinopathyisnotprimarilyan
invivoinpatellartendonmodelsaftersurgery[52,53],and inflammatoryprocess,butratheranongoingdegenerative
likewise, collagen type III and cell proliferation was process.Althoughinflammationisabsentintendinopathy
increasedafterexogenousbFGFinjectionsinpatellarten- atthislatestage,itdoesnotruleoutthataninflammation
dons after surgery in vivo [53]. Recently, our group insult was present at the initiation of the tendinopathic
showedthatthecytokineIL-6couldactasagrowthfactor process [60,61]. In fact, various inflammatory mediators
intendontissue[57].Moreover,localinjectionsofrhIL-6 like TNF-alpha, IL-6, IL-15, IL-18 have been shown to
havebeenshowntoincreasecollagensynthesisinhumans play a role especially in wound healing after injury [62]
Figure5Fibrillogenesis.Geneexpressionsofmarkersforfibrillogenesis,shownasarelativeratiobetweenthetendinopathicandthehealthy
regionofthetendon.Thehealthyregionequals1.ErrorbarsrepresentSEM(P<0.05).
Description:Local biochemical and morphological differences in human Achilles tendinopathy: a case control study BMC Musculoskeletal Disorders201213:53 a large and constantly growing clinical problem affecting both recreational different anatomical tendons [17] or with tissues from identical anatomical