Table Of ContentThis Accepted Manuscript has not been copyedited and formatted. The final version may differ from
this version. A link to any extended data will be provided when the final version is posted online.
Research Articles: Neurobiology of Disease
Lack of Parkin anticipates the phenotype and affects mitochondrial
morphology and mtDNA levels in a mouse model of Parkinson's Disease
Milena Pinto1, Nadee Nissanka2 and Carlos T. Moraes1,2
1Department of Neurology, University of Miami, Miller School of Medicine Miami, 1420 NW 9th Ave., TSL
Building, Rm. 231, FL 33136 USA.
2Neuroscience Program, University of Miami, Miller School of Medicine Miami, 1420 NW 9th Ave., TSL Building,
Rm. 231, FL 33136 USA.
DOI: 10.1523/JNEUROSCI.1384-17.2017
Received: 19 May 2017
Revised: 24 August 2017
Accepted: 3 October 2017
Published: 8 December 2017
Author contributions: M.P., N.N., and C.T.M. designed research; M.P. and N.N. performed research; M.P.,
N.N., and C.T.M. analyzed data; M.P., N.N., and C.T.M. wrote the paper.
Conflict of Interest: The authors declare no competing financial interests.
This work was supported in part by the National Institutes of Health Grants 1R01AG036871, 1R01NS079965,
and 5R01EY010804 (CTM), and Parkinson's Disease Foundation Fellowships PDF-FBS-1316 (MP). We
acknowledge support from the NEI center grant P30-EY014801 from the National Institutes of Health (NIH).
Correspondence should be addressed to either: Milena Pinto, 1420 NW 9th Avenue, TSL Building Rm. 231,
Miami, FL 33136; Tel: 305-243-4232; Email: [email protected] or to Carlos T. Moraes, 1420 NW 9th
Avenue, TSL Building Rm. 229, Miami, FL 33136; Tel: 305-243-5858; Email: [email protected]
Cite as: J. Neurosci ; 10.1523/JNEUROSCI.1384-17.2017
Alerts: Sign up at www.jneurosci.org/cgi/alerts to receive customized email alerts when the fully formatted
version of this article is published.
Accepted manuscripts are peer-reviewed but have not been through the copyediting, formatting, or proofreading
process.
Copyright © 2017 the authors
1 Lack of Parkin anticipates the phenotype and affects mitochondrial morphology
2 and mtDNA levels in a mouse model of Parkinson’s Disease
3
4 Milena Pinto1#, Nadee Nissanka2, Carlos T. Moraes1,2#
5
6 1Department of Neurology, University of Miami, Miller School of Medicine Miami, 1420 NW 9th
7 Ave., TSL Building, Rm. 231, FL 33136 USA.
8 2Neuroscience Program, University of Miami, Miller School of Medicine Miami, 1420 NW 9th Ave.,
9 TSL Building, Rm. 231, FL 33136 USA.
10
11 # Correspondence should be addressed to either:
12 Milena Pinto, 1420 NW 9th Avenue, TSL Building Rm. 231, Miami, FL 33136; Tel: 305-243-4232;
13 Email: [email protected] or to Carlos T. Moraes, 1420 NW 9th Avenue, TSL Building Rm.
14 229, Miami, FL 33136; Tel: 305-243-5858; Email: [email protected]
15
16 Number of pages: 34
17 Number of figures: 6 (+11 Extended data figures)
18 Number of words for Abstract: 180
19 Number of words for Introduction: 637
20 Number of words for Discussion: 1294 (1500max)
21 Conflict of Interest: The authors declare no competing financial interests
22
23 Acknowledgements
24 This work was supported in part by the National Institutes of Health Grants 1R01AG036871,
25 1R01NS079965, and 5R01EY010804 (CTM), and Parkinson’s Disease Foundation Fellowships
26 PDF-FBS-1316 (MP). We acknowledge support from the NEI center grant P30-EY014801 from the
27 National Institutes of Health (NIH).
28
1
29 Abstract:
30 PARK2 is the most common gene mutated in monogenic recessive familial cases of Parkinson’s
31 disease (PD). Pathogenic mutations cause a loss of function of the encoded protein Parkin.
32 ParkinKO mice, however, poorly represent human PD symptoms as they only exhibit mild motor
33 phenotypes, minor dopamine metabolism abnormalities, and no signs of dopaminergic
34 neurodegeneration. Parkin has been shown to participate in mitochondrial turnover, by targeting
35 damaged mitochondria, with low membrane potential, to mitophagy. We studied the role of Parkin
36 on mitochondrial quality control in vivo by knocking out Parkin in the PD-mito-PstI mouse
37 (males), where the mitochondrial DNA (mtDNA) undergoes double-strand breaks only in
38 dopaminergic neurons. The lack of Parkin promoted earlier onset of dopaminergic
39 neurodegeneration and motor defects in the PD-mito-PstI mice, but it did not worsen the
40 pathology. The lack of Parkin affected mitochondrial morphology in dopaminergic axons and was
41 associated with an increase in mtDNA levels (mutant and wild-type). Unexpectedly, it did not
42 cause a parallel increase in mitochondrial mass or mitophagy. Our results suggest that Parkin
43 affects mtDNA levels in a mitophagy-independent manner.
44
45 Significance Statement
46 Parkinson's disease is characterized by progressive motor symptoms due to the selective loss of
47 dopaminergic neurons in the substantia nigra. Loss-of-function mutations of Parkin cause some
48 monogenic forms of Parkinson's disease, possibly through its role in mitochondrial turnover and
49 quality control. To study if Parkin has a role in vivo in the context of mitochondrial damage, we
50 knocked out Parkin in a mouse model in which the mitochondrial DNA is damaged in
51 dopaminergic neurons. We found that the loss of Parkin did not exacerbate the parkinsonian
52 pathology already present in the mice but it was associated with an increase in mtDNA levels
2
53 (mutant and wild-type) without altering mitochondrial mass. These results shed new light on the
54 function of Parkin in vivo.
55 Introduction:
56 Parkinson's disease (PD) is the second most common progressive neurodegenerative disease after
57 Alzheimer’s. The classical motor symptoms are caused by striatal dopamine (DA) depletion,
58 consequent to the progressive loss of dopaminergic neurons in the substantia nigra (SN) (Dauer and
59 Przedborski, 2003; Braak et al., 2004).
60 Over the last few decades, increasing relevance has been given to the role that mitochondrial
61 defects play in the etiology of PD. Disruption of oxidative phosphorylation (OXPHOS), particularly
62 Complex I, is believed to contribute to neuronal loss in PD (Schapira et al., 1990a; Schapira et al.,
63 1990b). Nigrostriatal dopaminergic neurons in both PD and aged individuals show also Complex IV
64 dysfunctions (Bender et al., 2006; Kraytsberg et al., 2006), and reduction of Complex I and
65 Complex II subunits (Grunewald et al., 2016). Mitochondrial DNA (mtDNA) is also affected in PD
66 patients: dopaminergic neurons in both PD and aged individuals have high levels of mtDNA
67 deletions (Bender et al., 2006; Kraytsberg et al., 2006); single dopaminergic neurons from PD
68 patients with Complex I and II defects, show low abundance of the mtDNA transcription factors
69 TFAM and TFB2M (Grunewald et al., 2016). Moreover, patients harboring mutations in polymerase
70 (cid:74)(cid:3)(POLG) which cause mtDNA abnormalities, exhibit dopaminergic neurodegeneration and Lewy
71 bodies accumulation (Reeve et al., 2013).
72 PARK2 is one of the genes mutated in the rare cases of familial PD (Kitada et al., 1998), its
73 mutations are the most frequent cause of autosomal recessive, early onset and juvenile PD. Parkin,
74 its encoded protein, is also downregulated in sporadic PD, supporting its importance in the
75 pathophysiology of this disease (LaVoie et al., 2005; Shin et al., 2011). Parkin is a ubiquitin ligase
76 involved in many mitochondrial pathways: it induces the clearance of dysfunctional mitochondria
3
77 through mitophagy (Koh and Chung, 2010; Narendra and Youle, 2011), it influences mitochondrial
78 biogenesis by ubiquitination of PARIS (PGC-1α transcriptional repressor) (Lee et al., 2017) and can
79 regulate mitochondrial movement by regulating Miro (Wang et al., 2011; Gaweda-Walerych and
80 Zekanowski, 2013). Parkin’s crucial role in mitochondrial functions has been extensively
81 demonstrated in vitro, but in vivo studies were less conclusive, with controversial results depending
82 on the animal model involved. Parkin mutant Drosophila display flight muscle defects, locomotive
83 behavioral problems, male sterility, and reduced lifespan (Greene et al., 2003). Parkin mutant flies
84 are also more susceptible to oxidative stress, some dopaminergic neurons display shrinkage and
85 abnormal morphology, and mitochondria are defective and swollen in muscle cells (Pickrell and
86 Youle, 2015). On the other side, ParkinKO mice do not show typical signs of PD, including motor
87 phenotypes, DA metabolism abnormalities, or nigrostriatal degeneration (Goldberg et al., 2003;
88 Perez and Palmiter, 2005; Kitada et al., 2009). Accordingly, ParkinKO mice do not have significant
89 mitochondrial defects (Damiano et al., 2014). One possible explanation for this phenomenon is that
90 a compensatory or an alternative mitochondrial quality control mechanism takes over during
91 development. The fact that nigrostriatal degeneration does occur if Parkin is conditionally silenced
92 after birth validates this hypothesis (Shin et al., 2011). Another possibility, is that age-related factors
93 make it difficult to reproduce the human phenotype in mice. Both genetic and environmental factors
94 influence the development of PD, and aging is the most important risk factor in PD. MtDNA
95 damage also accumulates with aging, so the short lifespan of a mouse would not allow for the
96 accumulation of mitochondrial dysfunction which normally occurs in patients (Bratic and Larsson,
97 2013). ParkinKO mice would not recapitulate PD phenotypes because they lack the pathogenic
98 process of human aging, and, in particular, the accumulation of damaged mtDNA in dopaminergic
99 neurons. To investigate this possibility, we knocked out Parkin in the PD-mito-PstI mouse, where
100 mtDNA damage accumulates specifically in dopaminergic neurons. Using this genetic mouse
4
101 model, we combined a heritable cause of PD (Parkin loss of function) with an acquired insult
102 (mtDNA damage) that has been observed in normal aging.
103
104 Materials and Methods
105 Animals
106 All mice procedures were performed according to a protocol approved by the University of
107 Miami. Mice were housed in a virus-antigen-free facility at the University of Miami in a 12 hr
108 light/dark cycle at room temperature and fed ad libitum with a standard rodent diet.
109 The generation of PD-mito-PstI transgenic was previously described (Kujoth et al., 2005; Pickrell
110 et al., 2011a). Briefly, a mammalian version of the bacterial PstI gene was positioned downstream of
111 a 5’mitochondrial targeting sequence from human COX VIII gene (cytochrome c oxidase subunit
112 VIII). The intervening sequence 8 (IVS8) was introduced between the tetracycline response element
113 (TRE) promoter sequence and the mito-PstI coding sequence. Mice were crossed with transgenic
114 mice harboring one allele for a dopamine transporter driven tetracycline transactivator protein
115 (DAT-tTA) (Cagniard et al., 2006). PD-mito-PstI animals with or without Parkin were always
116 compared to control animals harboring the DAT-tTA allele with or without Parkin (DAT+ PstI-).
117 PD-mito-PstI mice were crossed with ParkinKO mice (from Jackson Laboratory: B6.129S4-
118 Park2tm1Shn/J, https://www.jax.org/strain/006582) in which most of exon 3 was replaced in-frame
119 by the coding sequence of EGFP. Exon 3 skipping causes a missense mutation and premature
120 termination at a stop codon in exon 5 following 49 additional out-of-frame amino acid residues
121 (Goldberg et al., 2003). The nuclear background of all the mouse models described here were
122 C57BL/6J (backcrossed at least 10 generations). Male mice were used in this study.
5
123 For the mitochondrial morphology studies, mice were crossed with mito-eYFP mice that express
124 a TRE-promoter-regulated mitochondrial-targeted eYFP (Chandrasekaran et al., 2006). (Jackson
125 Laboratory: C57BL/6-Tg(tetO-COX8A/EYFP)1Ksn/J, https://www.jax.org/strain/006618).
126 Pole test:
127 Pole test for motor coordination/nigrostriatal dysfunction of mice was previously described
128 (Matsuura et al., 1997). Animals were hung upright on a vertical (8mm diameter; 55mm length) pole
129 and were given three minutes to change orientation and descend. Animals were given three trials
130 and average latency to descend to the base was recorded. Failure to descend or fall from the pole
131 was given a maximum time of three minutes.
132 Rotarod:
133 Motor coordination was evaluated with a Rotarod (IITC Life Sciences) designed for mice.
134 Animals were tested with three runs on a given day with one run for practice. A resting period of
135 120 seconds between each run was given. Animals were required to position limbs to stay on a
136 rotating rod accelerating from 6 rpm-20 rpm over a 180 seconds time period. Mice that completed
137 the task received a final latency time of 180 seconds.
138 Activity Monitoring:
139 Spontaneous self-initiated movement was recorded using an activity cage setup (Columbus
140 Instruments) designed for mice. Animals were housed individually in a clean cage environment
141 thirty minutes prior to their dark cycle and then monitored for a twelve-hour period undisturbed.
142 Ambulatory movement was defined by the number of infrared beam breaks that occurred inside of
143 the cage for each 30 minute-period recorded.
144 Open field test
145 Open field (Med Associates Inc.) consists of a chamber and a system of 16 infrared transmitters
146 that record the position of the animal in the three-dimensional space. With this system, we recorded
6
147 the horizontal movement and the rearing activity. Animals were placed in the chamber 30 minutes
148 before the test and the locomotor activities were recorded for 15 minutes.
149 Stereological Neuron Counting
150 Anesthetized mice were sacrificed using cervical dislocation. Brains were isolated and the
151 regions of interest were dissected using a Mouse Brain Slicer Matrix (for midbrain, the region
152 between -1mm and -4mm from bregma; for striatum, the region between -1mm and +3mm from
153 bregma). Brain segments were submerged in 4% paraformaldehyde at 4oC overnight and then
154 cryoprotected in a 30% sucrose solution. Brains were embedded in OCT (TissueTek) and frozen by
155 submersion into 2-methylbutane cooled in liquid nitrogen. Sections were cut on a cryostat (30(cid:80)m
156 sections were used) and starting from bregma -1mm, the first 30 slides were discarded.
157 Dopaminergic neurons were counted in every 5th section, with 10-12 total sections counted per
158 individual animal. Slides were permeabilized with 0.4% Triton X-100, blocked for one hour at room
159 temperature with normal goat serum (KPL) and incubated with primary antibody anti-tyrosine
160 hydroxylase (Sigma-Aldrich Cat# T1299 RRID:AB_477560) at 1:500. Secondary mouse conjugated
161 HRP antibody (KPL) was used for one hour at room temperature. Slides were subsequently
162 incubated with streptavidin-peroxidase (KPL) for 30 minutes, visualized with 0.05% 3,3’-
163 diaminobenzidine (DAB) for 7 minutes and mounted with glycerol.
164 Stereology workstation program (StereoInvestigator; MicroBrightField,) was used to quantify
165 TH+ neurons. According to the program, we set a guard zone of 3 μm from the top and from the
166 bottom of each section that was not considered in the counting. The A9 area was outlined using the
167 10 × objective and neurons were counted at 60 x magnification on an Olympus BX51 microscope. A
168 scan grid size was determined to have at least 10 grid sites per section. The estimated numbers of
169 dopaminergic neurons were calculated by counting TH+ cells present in the unbiased virtual
170 inclusion counting frames. We accepted a coefficient of error (Gunders) of <.15.
7
171
172 Western Blotting
173 Protein extracts were prepared from isolated striatum samples homogenized with a hand-held
174 rotor (VWR) in phosphate-buffered saline (PBS) containing a protease inhibitor cocktail (Roche).
175 Samples were then snap frozen twice in liquid nitrogen and stored at -80oC until use. Upon use,
176 sodium dodecyl sulfate (SDS) was added to the homogenate at the final concentration of 4%.
177 Homogenates were then sonicated, centrifuged at 10,000 g for 5 minutes, and the supernatant was
178 collected for analysis. Proteins were run on 4-20% SDS-polyacrylamide gradient gel (BioRad). The
179 gel was blotted on Polyvinylidene Fluoride (PVDF) (BioRad) membrane. Membranes were blocked
180 in 1:1 Odyssey blocking solution (LI-COR Biosciences) for 1 hour at room temperature.
181 Primary antibodies used were: mouse anti-TH (tyrosine hydroxylase) 1:1000 dilution (Sigma-
182 Aldrich Cat# T1299 RRID:AB_477560), rabbit anti-DAT (Dopamine transporter) 1:1000 (Sigma-
183 Aldrich Cat# D6944 RRID:AB_1840807), mouse (cid:68)-tubulin 1:2000 (Sigma-Aldrich Cat# T9026
184 RRID:AB_477593), rabbit anti-MAO 1:1000 (Sigma-Aldrich Cat# M1821 RRID:AB_1841010),
185 mouse anti COMT 1:1000 (BD Biosciences Cat# 611970 RRID:AB_399391), rabbit anti-Porin
186 1:2000 (Cell Signaling Technology Cat# 4866 RRID:AB_2272627), mouse anti OXPHOS cocktail
187 1:1000 (Abcam Cat# ab110413 RRID:AB_2629281), rabbit (cid:69)-actin 1:5000 (Sigma-Aldrich Cat#
188 A2066 RRID:AB_476693), mouse anti p62 1:1000 (Abcam Cat# ab56416 RRID:AB_945626),
189 rabbit anti LC3b 1:1000 (Cell Signaling Technology Cat# 2775 also 2775S RRID:AB_915950),
190 OPA1 (BD Biosciences Cat# 612606 RRID:AB_399888), Mfn2 (Abcam Cat#Ab56889,
191 RRID:AB_2142629, Tim23 (BD Biosciences Cat# 611222 RRID:AB_398754), PARIS (Sigma
192 Cat#MABN476, RRID: AB_2688024) Secondary antibodies used were infrared-conjugated
193 antibodies anti-rabbit-700/anti-mouse-800 (Rockland) at 1:3000 to 1:5000 concentrations
194 respectively, and incubated at room temperature for 1 h.
8
195 Blots were visualized with Odyssey Infrared Imaging System (LI-COR Biosciences). Optical
196 density measurements were taken by default software supplied by LI-COR on blots.
197 Dopamine and Metabolite Quantification
198 Dopamine and metabolite quantification measurements were performed at the Vanderbilt
199 University CMN/KC Neurochemistry Core Lab. Neurotransmitter and metabolite levels were
200 normalized to total protein. Determinations were achieved using two dedicated Waters high
201 performance liquid chromatography systems equipped with autosamplers and a Decade II
202 electrochemical detector.
203 Laser Capture Microdissection
204 Twenty (cid:80)m sections were immunostained for TH (Sigma-Aldrich Cat# T1299 RRID:
205 AB_477560) using HRP-conjugated secondary Ab and chromogenic substrate (DAB). After
206 dehydration, they were cleared with xylenes, and air-dried. Sections were dried overnight in a
207 chamber with desiccant chips (1g/each). TH+ neurons in the SN region were pooled from 10 slides
208 per animal using LMD Leica Laser Microdissection microscope (Leica). DNA was extracted using
209 the QIAmp DNA Micro Kit (Qiagen).
210 Real Time PCR
211 Total DNA was extracted with standard phenol:chloroform/ethanol precipitation from striatum
212 and from midbrain. To determine the relative quantity of mtDNA in each sample, we used the
213 comparative Ct method (Schmittgen and Livak, 2008) normalizing to a genomic DNA region. To
214 estimate the levels of total mtDNA (full-length and recombined) we designed primers to amplify
215 mtDNA regions distal to both PstI sites (COXI F “AGGCTTCACCCTAGATGACACA”; COXI R
216 “GTAGCGTCGTGGTATTCCTGAA” and ND1 F “CAGCCTGACCCATAGCCATA”; ND1 R
217 “ATTCTCCTTCTGTCAGGTCGAA”). To determine the relative quantity of only the full-length
218 mtDNA in each sample, we designed primers to amplify an mtDNA region inside PstI sites (ND4 F:
9
Description:this version. A link to any extended data will be provided when the final version is posted online. Research Articles: Neurobiology of Disease. Lack of Parkin anticipates the phenotype and affects mitochondrial morphology and mtDNA levels in a mouse model of Parkinson's Disease. Milena Pinto. 1.