Table Of ContentDEVELOPMENTS IN BIOCHEMISTRY
Volume 1 —Mechanisms of Oxidizing Enzymes, edited by Thomas P. Singer and Raul N. Ondarza,
1978
Volume 2—Electrophoresis 78, edited by Nicholas Catsimpoolas, 1978
Volume 3—Physical Aspects of Protein Interactions, edited by Nicholas Catsimpoolas, 1978
Volume 4—Chemistry and Biology of Pteridines, edited by Roy L. Kisliuk and Gene M. Brown,
1979
Volume 5—Cytochrome Oxidase, edited by Tsoo E. King, Yutaka Orii, Britton Chance and Kazuo
Okunuki, 1979
Volume 6—Drug Action and Design: Mechanism-Based Enzyme Inhibitors, edited by Thomas I.
Kaiman, 1979
Volume 7—Electrofocus/78, edited by Herman Haglund, John G. Westerfeld and Jack T. Ball, Jr.,
1979
Volume 8—The Regulation of Coagulation, edited by Kenneth G. Mann and Fletcher B. Taylor, Jr.,
1980
Volume 9—Red Blood Cell and Lens Metabolism, edited by Satish K. Srivastava, 1980
Volume 10—Frontiers in Protein Chemistry, edited by Teh-Yung Liu, Gunji Mamiya and Kerry T
Yasunobu, 1980
Volume 11 —Chemical and Biochemical Aspects of Superoxide and Superoxide Dismutase, edited
by J.V Bannisterand H.A.O. Hill, 1980
Volume 12—Biological and Clinical Aspects of Superoxide and Superoxide Dismutase, edited by
W.H. Bannisterand J.V. Bannister, 1980
o
Volume 13—Biochemistry, Biophysics and Regulation of Cytochrome P-450, edited by Jan-Ake
Gustafsson, Jan Carlstedt-Duke, Agneta Mode and Joseph Rafter, 1980
Volume 14—Calcium-Binding Proteins: Structure and Function, edited by Frank L. Siegel, Ernesto
Carafoli, Robert H. Kretsinger, David H. MacLennan and Robert H. Wasserman, 1980
Volume 15—Gene Families of Collagen and Other Proteins, edited by Darwin J. Prockop and
Pamela C. Champe, 1980
Volume 16—Biochemical and Medical Aspects of Tryptophan Metabolism, edited by Hayaishi,
Ishimur, and Kido, 1980
Volume 17—Chemical Synthesis and Sequencing of Peptides and Proteins, edited by Teh-Yung Liu,
Alan N. Schechter, Robert L. Heinrikson, and Peter G. Condliffe, 1981
Volume 18—Metabolism and Clinical Implications of Branched Chain Aminoand Ketoacids, edited by
Mackenzie Walser and John R. Williamson, 1981
Volume 19—Molecular Basis of Drug Action, edited by Thomas P. Singer and Raul N. Ondarza,
1981
Volume 20—Energy Coupling in Photosynthesis, edited by Bruce R. Selman and Susanne
Selman-Reimer, 1981
Volume 21—Flavins and Flavoproteins, edited by Vincent Massey and Charles H. Williams, 1982
Volume 22—The Chemistry and Biology of Mineralized Connective Tissues, edited by Arthur Veis,
1982
Volume 23—Cytochrome P-450, Biochemistry, Biophysics and Environmental Implications, edited
by E. Hietanen, M. Laitinen and O. Hanningen, 1982
Volume 24—Interaction of Translational and Transcriptional Controls in the Regulation of Gene
Expression, edited by Marianne Grunberg-Manago and Brian Safer, 1982
INTERACTION OF TRANSLATIONAL
AND TRANSCRIPTIONAL CONTROLS
IN THE REGULATION OF GENE EXPRESSION
Proceedings of the Fogarty International Conference on
Translational/Transcriptional Regulation of Gene Expression, held at the
National Institutes of Health, Bethesda, Maryland, U.S.A., on April 7-9,1982.
Editors:
MARIANNE GRUNBERG-MANAGO, Ph.D.
Fogarty Scholar in Residence, Research Director, Institut de Biologie Physico-chimique,
Paris, France
and
BRIAN SAFER, M.D., Ph.D.
Section on Protein Biosynthesis, Laboratory of Molecular Hematology, National Heart,
Lung and Blood Institute, National Institutes of Health, Bethesda, Maryland, U.S.A.
ELSEVIER BIOMEDICAL
New York · Amsterdam · Oxford
©1982 by Elsevier Science Publishing Co., Inc.
All rights reserved.
Published by:
Elsevier Science Publishing Co., Inc.
52 Vanderbilt Avenue, New York, New York 10017
Sole distributors outside the USA and Canada:
Elsevier Science Publishers B.V.
P.O. Box 211, 1000 AE, Amsterdam, The Netherlands
Library of Congress Cataloging in Publication Data
Fogarty International Conference on Translational/Transcriptional Regulation of Gene
Expression (1982: National Institutes of Health)
Interaction of translational and transcriptional controls in the regulation of gene
expression.
(Developments in biochemistry, ISSN 0165-1714; v. 24)
Sponsored by the Fogarty International Center.
Includes bibliographical references and index.
1. Gene expression—Congresses. 2. Genetic regulation—Congresses.
3. Genetic translation—Congresses. 4. Genetic transcription—Congresses.
I. Grunberg-Manago, Marianne, 1921- II. Safer, Brian. III. John E.
Fogarty International Center for Advanced Study in the Health Sciences.
IV Title. V. Series.
QH450.F63 1982 574.87'322 82-16283
ISBN 0-444-00760-1
Manufactured in the United States of America
ix
Preface
A detailed understanding of the molecular events which occur during
protein synthesis is fundamental to increasing our knowledge of both
normal and pathologic processes. Since the isolation and purification
of most translational components required for in_ vitro assembly of ini
tiation complexes was achieved, a major shift in emphasis has occurred
from the study of the mechanism of protein synthesis to the study of how
this process is regulated. Recently, it has become increasingly apparent
that there exists a close interaction of translational components and
products with the transcriptional machinery of the cell. A greater appre
ciation has also emerged for the details of the molecular structure of
translational components which specify their complex interactions with
one another, as well as with the ultrastructure of the cell.
This Conference focuses on the molecular strategies employed during
the modulation of gene expression subsequent to transcriptional initi
ation. The intention is to survey recent developments in several key
areas in which transcriptional and translational components specifically
interact. Both prokaryotic and eukaryotic systems are explored, and when
ever possible structure-function correlations are considered. Because of
the broad area covered, it has not been possible to cover all aspects and
present all viewpoints. It is our hope, however, that this Conference
will stimulate productive interactions and provide an opportunity to
exchange new concepts between the diverse areas represented·
This Conference was planned during the tenure at the National
Institutes of Health of one of us (M. G-M.) as a Fogarty International
Scholar. This program provides the opportunity for Fogarty Scholars
to broaden their outlook from their own specialized fields, as well
as contribute their own areas of expertise to the NIH community.
The editors would like to express their gratitude to the Fogarty
International Center* for sponsoring this meeting, to Dr. E. Stadtman,
Dr. T. Stadtman, and Dr. B. Williams whose help in the organization of
this meeting was invaluable, and to Mrs. E. Church for her excellent
editing of the manuscripts. In addition, appreciation is extended to
all the speakers and discussants who were responsible for making this
meeting a highly successful one and the completion of this volume an
enjoyable and rewarding experience.
Marianne Grunberg-Manago
Brian Safer
* Fogarty International Center Director - Dr. Claude Lenfant
Scholar-in-Residence Branch Chief - Dr. Peter G. Condliffe
Conference and Seminar Program Branch Chief - Dr. Earl C. Chamberlayne
Conference Coordinator - Mrs. Nancy E. Shapiro
Published 1982 by Elsevier Science Publishing Co., Inc.
Marianne Grunberg-Manago and Brian Safer, editors
INTERACTION OF TRANSLATIONAL AND TRANSCRIPTIONAL
CONTROLS IN THE REGULATION OF GENE EXPRESSION
REGULATION OF GENE EXPRESSION BY TRANSCRIPTION TERMINATION AND RNA PROCESSING
MARTIN ROSENBERG AND URSULA SCHMEISSNER*
Laboratory of Biochemistry, National Cancer Institute, National Institutes of
Health, Bethesda, Maryland 20205 (301-496-5226)
Present address: BIOGEN, S.A. 3, Route de Troinex, 1227 Carouge/Geneva,
Switzerland
INTRODUCTION
Lysogenic development by phage λ requires the insertion of the phage genome
into the £. coli chromosome. This site-specific integration event requires
several host proteins and one phage gene product, integrase.1"3 The gene for
integrase (int) is part of the major leftward transcription unit of lambda and
is positioned immediately preceding the site at which the integrative recombin
ation event occurs (att) (Fig. 1). The at£ regulatory region extends for 200
bp beyond int and contains a variety of regulatory sequences involved in the
recombination events·^»5
b att int xis N cl ell
Hind III Bam HI
Fig. 1. Schematic genetic map of phage λ showing the two transcripts which
traverse the int gene and initiate at the P and P promoters, respectively.
x L
Also indicated is the major rightward mRNA which initiates at the PR promoter
and the BamHI-Hindlll restriction fragment used as a hybridization probe for
the tj region (see text for details). This figure, as well as figures 2-8
and 10, are from Schmeissner et al., in preparation.
2
During a normal phage infection, int is transcribed at different times from
two promoter signals.6>7 Early after infection, int transcription derives
from the major leftward phage promoter, P^, positioned approximately 8 kb
upstream of int. This high molecular weight polycistronic mRNA expresses
integrase very poorly.**» 9 In contrast, efficient int expression occurs later
in phage development from another transcript. This monocistronic mRNA derives
from the positively regulated promoter, Pj, positioned only 137 bp upstream
of int.10-13 The dramatically different levels of int expression obtained
from these two transcripts does not appear to result simply from differential
message translation (Schmeissner, U., McKenney, K., Court, D. and Rosenberg,
M. in preparation). Instead, the phage has evolved a rather remarkable
regulatory mechanism which utilizes overlapping and alternative signals for
transcription termination and RNA processing to control int expression from
the two different mRNAs. This article summarizes the work which has helped to
elucidate the molecular features of this regulatory phenomenon and in doing
so, has demonstrated a new and important role for transcription termination
in gene expression.
Pj transcription terminates at tj. The first indication of the unusual
nature of the regulation of int expression was the finding by Guaneros and
coworkers of mutations located beyond the int coding sequence which allowed
efficient int expression from the P transcription unit. * ^ It was
L
suggested that these mutations defined a regulatory site responsible for
selectively inhibiting int expression from the P^ transcript (i.e., sib, site
of inhibition in the Ä_b region). In an effort to characterize the function
of this regulatory signal, we examined int specific transcription from both
the Pj and PL promoters specifically in the region distal to the int coding
sequence. For these analyses, a 492 bp λ DNA fragment which spans the end of
the int gene, the entire att regulatory region, and extends 250 bp beyond att
into the _b region, was used as a hybridization probe (see Fig. 1). The DNA
sequence of this region has been defined (Fig. 2).^»16
We first monitored int transcription directed by the Ρχ promoter. Cells
were pulse-labeled with 32p between 10 and 11.5 minutes after infection, a
time when int is being transcribed from Ρχ. RNA was prepared, hybridized to
the DNA fragment probe, and the hybridized RNA characterized by standard two-
dimensional fingerprinting procedures.1? Each oligonucleotide was identified
and unambiguously positioned within the DNA sequence of the region (see Fig.
2).
3
Int: Trp Asp Lys Ih Ghi lie Lys Tei Te r MI
«/••••GGAGTGGGACAAAATTGAAA1CAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTT
I J I I
6 7 8
J I L
GTAAAATGATATAAATATCAATATATTAAATTAGATTTIGCAIAAAAAACAGAC1ACATAATACTG
13 14 15 16
17 18 19 19·
19b 20 21 A BC
AKJ1 I
Hindtll
Fig. 2. Partial DNA sequence of the coding strand of the BamHI-HindIII
fragment shown in Fig, 1.4>16 The orientation of the sequence is inverted
relative to the λ map shown in Fig. 1. Numbering starts at the center
of att with positive numbers extending toward int and negative numbers
extending toward Jb. Tj oligonucleotides are indicated by either numbered
or lettered brackets. Major dyad symmetries are designated by arrows.
Asterisks indicate the exact positions of transcription termination at
tl·
The results demonstrate that Ρχ transcription traverses the entire att
regulatory region and extends some 180 nucleotides beyond att. The detection
of oligonucleotide #21, but the absence of oligonucleotides A-E indicates that
the Ρχ transcript must terminate beyond residue position -182 but before
residue -194. Consistent with this analysis is the fact that the DNA sequence
of this region exhibits those features usually associated with transcription
termination signals (Fig. 3): 1) an extensive dyad symmetry rich in G-C pairs
which gives rise to a potential base paired stem and loop structure in the
corresponding RNA transcript of the region and 2) a run of consecutive
thymidylate residues immediately following the symmetry element.18 ßy analogy
with other terminators the Pj int mRNA should stop within or just beyond
this T-rich sequence. We have designated this region tj, the terminator
signal for the Ρχ directed int transcript.
4
U U
u u
U G
A U
U U
G U
G - C
A- U
A- U
C- G
G - C
C- G
G - C
A- U
U - A
U - A
A-U .OH
5' · · · GUAACAGAGC UUUU(U) Γ
NOH
Fig. 3. Potential secondary structure of the 3'-end of the Ρχ directed int
mRNA. The 3'-terminal heterogeneity of the transcript is indicated by
parentheses.
In order to better characterize the tj signal, we cloned a 242 bp λ DNA
fragment carrying tj into a plasmid vector designed specifically for studying
transcription termination signals (Fig. 4).*9 This vector, pKG1800, carries
the E^. coli galactokinase gene (galK) such that galK expression is controlled
by the gal promoter (Pgal). Insertion of a DNA fragment carrying a terminator
between Pgal and galK results in a reduction in galK expression. The extent
of the reduction is a direct measure of the ill vivo termination efficiency of
the signal. In pKG1800, the tj fragment terminates transcription from♦Pgal
with an efficiency of 98%. This result is consistent with the results
obtained on the phage: no read-through transcription at the tj site was
detected from the Ρχ promoter.
5
Fig. 4. Construction of the plasmid pKG1800sib. The 242 bp Alul restriction
fragment (Fig. 2), which carries the tj terminator region was cloned into the
Smal site of the vector pKG1800 between the gal promoter (Pgal) and the
galactokinase gene (galK).^ Ap indicates the 3~lactamase gene from pBR322.
Arrows indicate the direction of transcription.
The pKG1800 vector also allows _in vitro analysis of terminator function.
The vector containing tj was linearized and used as a template for iji vitro
transcription. The RNA products were resolved by polyacrylamide gel electro-
phoresis (Fig. 5) and the major transcripts characterized by fingerprint
analysis. The prominent 630 nucleotide transcript (T) was identified as a
Pgal-initiated RNA which terminated precisely at the tx signal. Two 3'-
terminal oligonucleotides were identified indicating that the RNA terminated
with some heterogeneity within the T-rich sequence at residue positions -192
and -193 (Fig. 2 and 3). Apparently, the tj signal also functions efficiently
in vitro and termination at this site does not require any ancillary factors
such as rho protein (i.e. tj is an independent termination signal).
PL transcription read-through tj. We next monitored int gene transcription
directed by the Ρχ, promoter. Although this transcription also traverses the
int gene coding region, little if any, integrase is expressed.**»* Our method
of analysis was identical to that used for Pj transcription, except that the
cells were pulse-labeled very early after infection using a phage which carried
an inactive Pj promoter. Under these conditions int transcription is from
p 20
