In Search of Archaea among the Mat Layers of the Great

17 Pages·2012·0.48 MB·English

In Search ofArchaea among the Mat Layers of the Great Sippewissett
Salt Marsh
P.M. Fidopiastis, Mm-Ken Liao, Jorge L. M. Rodrigues, and Ana Isabel Anton
Microbial Diversity, 1998
Abstract
Microbial mats are stratifiedlayers ofdiverse microbial consortiathat generally
consist ofa surface layer dominatedby cyanobacteriawith lower layers composedof
purple anoxygenic phototrophic and sulfate reducing bacteria, among others. While the
bacterial componenthas beenthe focus ofmost studies onmicrobial mat communities,
the presenceand role ofarchaearemains largelyunstudied. Recentphylogenetic
analyses have revealedthat archaeaareubiquitous, andthus, there is no apriorireason
why archaeashould notbe presentinthe complexmicrobial assemblages ofthe mats.
Our group took apolyphasic approachto determine ifarchaeaare presentinthe mat
layers ofthe Great Sippewissett SaltMarshthatincluded: i) enrichment and isolation of
methanogenic archaea, ii) F420autofluorescence (characteristic ofmethanogenic archaea)
ofcells grown in enrichment cultures, iii) insituhybridization ofarchaea-specific DNA
probes to cells grown inenrichmentcultures, and iv) sequence analysis ofarchael 16S
rDNAthat was PCRamplifiedfrombothenrichmentcultures and directlyfromthe mat
layers. After one week ofincubation at 22°C, bubble formation from in tactmat layers
added to enrichmentmediawas our firstindicationthatmethanogenesiswas taking place.
Cells from these enrichments autofluorescedwhen viewedby epi-fluorescence
microscopy at420 nm andtheirDNA hybridizedto archaea-specific DNAprobes. The
morphology ofthese cells (packets ofcoccoid cells) andtheirabilityto use methanol as a
sole substrate for methanogenesis suggestedthatthey were members ofthe genus
Methanosarcina. Sequence analysis ofthe single 16S rDNA RFLP type amplifiedfrom
these enrichments suggestedthat an archeonmost closely related to Methanogenium was
present. Archaeal 16S rDNA was also amplifieddirectly fromthe mat layers. At least 16
differentRFLP patterns were detected, suggesting that adiverse archael consortiummay
bepresent. Sequence analysis ofthese cloned 16S rDNA genes is inprogress and will i)
allowusto inferphylogeny ofthese archaea, ii) allowus to inferthe metabolic
capabilities ofthese archaeabased ontheirphylogenetic grouping, and iii) will serve as a
source ofarchael DNAforprobe designto study their ecology withinthemats.
Introduction
Microbial mats are stratifiedlayers ofcomplex microbial associations.
The dominantprimaryproducers ofmats are the oxygenic photosynthesizing
cyanobacteria. Common genera ofcyanobacteria found in mats are Nostoc,Anabaena,
Oscillatoria, and Spirulina. Below the surface mat layer(s) are diverse assemblages of
bacteriathat include members ofthe purple anoxygenic photosynthesizingbacteria and
sulfate reducingbacteria; the latter can catabolize photosynthatein the presence ofsulfate
(derived from seawateror other sources) to produce sulfide. Purple sulfurbacteria are in
turn able to utilize the sulfide fortheirmetabolic needs. Cyanobacterial filaments
produceextracellularmucopolysaccharide sheaths (fromphotosynthate) that give overall
cohesion to the mat andprotect it from disintegration and drying during low tide cycles.
Studies ofthese and other complex associations within the mat layers have focused
largely on understanding the bacterial component ofthe mats, with little orno attention
given to the presence androle ofarchaea. Our group took a polyphasic approach to
determine ifarchaea are present in the mat layers that included: i) enrichment andpure
culture isolation, ii) microscopy, iii) in situ hybridization using archaeaspecific DNA
probes, and iv) sequence analysis of 16S rDNA. We emphasized the identification of
methanogenic archaeaby enrichment andmicroscopybecause: i) they are responsible for
C4H production in a variety ofanaerobic marine and freshwaterhabitats, yet their
presencein microbial mat layers, to ourknowledge, is not documented, ii) they are
relativelyeasy to detect due to theirmetabolic activity (4CH production), and iii) they
possess aunique F420autofluorescence underepifluorescence microscopy. In situ
hybridization using archael DNA probes and purification and sequencing of 16S rDNA
from enrichment culture and mat samples were performedto provide a more
comprehensive list ofarchaeathat arepresent. The specific goals ofthis project were to:
i) detect the presence ofmethanogenic archaeathrough enrichment and subsequent
isolation, ii) use epifluorescence microscopyto detect F420autofluorescence and
fluorescence due to hybridization to labeled archael probes, and iii) extract, PCR amplify,
clone, and sequence archaeal 16S rDNA from both enrichment cultures and directly from
matlayers.
Materials and Methods
Samplingand Storage ofMatLayers
Mat layer samples fromthe Great Sippewissett Salt Marsh were collected using a core
sampler and eitherbroughtbackto the lab within 3 h ofcollection orwere inoculated
directly into enrichment cultures. Unusedmats were stored at4°C for upto two weeks in
casethey were needed for further analyses. Individual mat layers (green, pink, black, and
gray) were separatedusing arazorblade.
Enrichmentfor Methanogenic Archaea
Mat layer samples were directly inoculated into anaerobicBasic SaltwaterMedium that
was reduced byN2Sa and supplemented with 10mM methanol (according to the recipe of
B. Schirik). Enrichmentcultures were incubated at 22°C inthe dark forup to 2 weeks.
Due to alackoftime, agar shakes to isolate methanogenswere notperformed.
Genomic DNA Extraction
Genomic DNA from 1 g ofeach mat layer and 0.5 g ofsediment from a single
enrichmentculture containing all mat layers was extracted according to the procedure
providedinthe course handout. The only modificationwas that following the extraction
procedure, DNA was purifiedusing the Wizard DNA PurificationKit (Promega Corp.)
according to manufacturer’s specifications. Concentration ofextracted DNAwas
estimatedusing the DNADipstickKit (Invitrogen Corp.).
Materials and Methods cont.
PCRAmplification
To determine ifthe purifiedDNA contained any inhibitors ofthe PCRreaction, purified
DNA was mixed withuniversal forward (5’ AGAGTTGATYMTGGC 3’) and reverse
(5’GYTACCTTGTTACGACTT 3’) 16S rDNAprimers andthese PCRreactions were
performed (according to the methods outlined inthe course handout) priorto running
PCRreactions using the more specific archael primers. To amplify archael 16S rDNA,
two forward archael primers were used separatelywiththe universal reverseprimer. The
forwardarchael primers were: AF1 (5’ TCCGGTDGATCCTGCCRG 3’) and AF21 (5’
TCCGGTTGATCCYGCCGGA 3’). PCRreactions containing 0.025 to 0.05 ng of
purified DNA, 2.0 mM M2gCl and 0.5 j.il (per 50 j.fl reaction) ofAmpliTaq Gold DNA
polymerasewere cycledunderthe following conditions: 94°C, 5 mm. (hot start),
followed by 35 cycles of94°C for2 mm, 63°C for 1 mm, and 72°C for 2 mm, with afinal
extension of72°C for 10 mm.
Cloning and R1?LP Analysis ofPCRProducts
PCRproducts were cloned into the PCRIIplasmid (Invitrogen Corp.) according to
manufacturer’s specifications. Colonies ofpotential transformants were individually
spotted onto anLB-ampicillin (100 pg/mi) plate (for storage followingtheir growth) and
then immediately addedto separate PCRreactions which were mixed with TOPO
forward andreverseprimers (TOPO TA Cloning Kit, Invitrogen Corp) in orderto
amplify (andthus detect) the presence ofthe insert. PCRproducts fromthese reactions
Materials and Methods cont.
Cloning and RFLP Analysis ofPCRProducts cont.
were thenmixed withHinPI andMspI (accordingto the coursehandout) and the resulting
restrictionpatterns were analyzedby agarose gel electrophoresis. PCRproducts yielding
uniquerestrictionpatterns were either sent out immediately for sequencing or frozen for
future analyses; those PCRproducts sent outfor sequencingwere submittedto the
BLAST database.
In Situ Hybridization and MicroscopicAnalysis
Cells from methanogenenrichmentcultures were concentrated by centrifugation and
either viewed by epifluorescencemicroscopy for F420autofluorescence orwereprepared
forFluorescentIn-SituHybridizationusingthe archael DNAprobe ARCH (5’
GTGCTCCCCCGCCAATTCCT 3’) and DAPI counterstain accordingto the course
handoutprepared by S. Dawson.
Results
Evidence for Methanogenesis in Mat LayerEnrichments
After 1 week ofincubation, bubble formation suggestedthatmethanogenesis was taking
place inthe enrichment cultures. Formation ofbubbles (presumably methane)
subsequentlyincreased duringthe secondweek ofincubation.
Extraction, Purification, PCRAmplification, Cloning, and RFLP Analysis of
Archael 16S rDNA from Three ofFourMat layers and One Enrichment Culture
DNA isolated fromboth enrichment culture and directly fromthe fourmat layers was
initially brown in color suggesting thathumics and other contaminants were presentin
the samples. Such DNA, whenused inPCRreaction, wouldnot amplify without further
purificationby passage through WizardDNAKit columns. In general, dilutions ofup to
1:100 ofthe extractedDNA were also necessaryto achieve optimal amplification. The
additionofuniversal forward and reverse primers to PCRreactions yieldedproducts of
the appropriate size (1.5 kb) from all mat layers, however, we were initially unsuccessful
at amplifying 16S rDNAusing archaelprimers with all other conditions the same as those
used for amplification withthe universal primers. Afterrepeated optimization steps
usingthe Invitrogen PCR OptimizerKit (accordingto manufacturer’s specifications), an
optimized scheme was devisedfor amplifying archael DNA from at least one layer (using
Buffer B containing 2.0 mM M2,gC1 (pH 8.5) ofthe optimizer kit, 63°C primer annealing,
andvarious dilutions ofDNA ofupto 1:100; datanot shown). RFLP analysis ofthese
PCRproducts revealedthat at least 3 differentrestrictionpatterns were present.
Interestingly, no amplification ofany otherlayerwas achieved using these optimized
conditions. However, whenAmplitaq GoldPolymerase (Perkin-Elmer Corp.) was used
inplace ofTaq Beads, combined withthe PCRprotocol fromthe course handout,
Results cont.
Extraction,Purification,PCRAmplification, Cloning, and RFLP Analysis of
Archael 16S rDNA from Three ofFour Mat layers and One Enrichment Culture
cont.
we were able to amplifr archael DNA from boththe gray and blackmatlayers (Fig. 1) as
well asfromenrichmentculture, but not fromthepinkor greenlayers (datanot shown).
Subsequently, analiquot ofpink layer DNAwas analyzed by agarose gel electrophoresis
and appearedto be degraded. Fromtwo separateplates containing over 100 potential
16S rDNA insert-containing clonesfromboth gray andblack layerDNA samples, 20
were selected (10 fromcloning reactions fromeach layer) for RFLP analysis. At least 14
differentrestrictionpatterns wererepresented inthese samples (5 fromthe gray layer and
9 fromthe black layer; Fig. 2). A single RFLP patternwas achieved fromthe 16S rDNA
amplifiedfrom enrichmentculture and its sequence wasmost closelyrelatedto the
archael genusMethanogenium (Fig. 3).
F429Autofluorescence andIn Situ Hybridization Revealed the Presence ofArchaea
in Enrichment Cultures.
F420 autofluorescence was detected in concentrated samples ofmethanogen enrichment
cultures (Fig. 4), butwas not detectedin any mat layer directly. However, due to the
large number ofmicrobes in atypical mat layer sample (Fig. 6) the lesser abundant
methanogens can easily be missed. The cells appearedto be coccoidin shape and
arranged aspackets ofcells (Figs. 5a-b). Similarly, these cells hybridizedto archaea
specific DNAprobes (Fig. 5b). Theirmorphology and abilityto utilize methanol as a
sole substrate formethanogenesis suggests thatthey are members ofthe genus
Methanosarcina. Interestingly, DNA ofa filamentousbacterium (Fig. 7b) also reacted
withthe archaeal probe supporting the possibilitythata diverse archael population may
occurinthe mat layers.
Discussion
The results ofour researchprovide evidence forthe occurrence ofapotentially diverse
populationofarchaeawithinthe mat layers ofthe Great Sippewissett SaltMarsh. 16S
rDNARFLP patterns suggestthat at least 17 uniquephylogenetic types ofarchaea are
presentinthree ofthe mat layers (pink, black, and gray). Sequencing ofthese 16S
rDNAs will be required in orderto more accurately infertheirphylogenies. Based on
phenotypic data(metabolic andmorphological) there is evidence to supportthat
Methanosarcinamay bepresentinthe enrichmentcultures, whereasphylogenetic
analysis ofthe sole 16S rDNA clone suggests thatthe predominant archeonwithin the
enrichments is most closelyrelated to Methanogenium. Takentogether, these data
provide strong evidence to supportthat archaea arepresent inthe mat layers. Inthe
future, in order to isolatethese methanogens and more accurately identifr them, cultures
shouldbe started earlier. Interestingly, the potential archeonpictured in Fig 7b appears to
be morphologically identical to an archeon from sulfide-rich sediment fromthe great
Sippewissett Salt Marsh detectedby S. Dawsonin 1997. In conclusion, we have
provided datafulfilling each ofour goals as listed inthe introduction and expectthatthis
workwill: i) provide the first additions to what shouldbe a growing list ofarchaeal 16S
rDNA sequences from the mat layers, ii) facilitate more detailed future studies onthe
phylogeny (and thus, metabolic capabilities) ofarchaeainthe mat layers, and iii)
facilitate probe design for ecological studies ofthese and other archaea.
FigureLegends
Fig. 1. PCRamplification of16S rDNA usingarchaelforward primerAF1 and universal reverse
primer. Lanes2-11: Blacklayer(top gel); Lanes 12-14 GrayLayer(top gel); Lanes2-7: Graylayer
(bottom gel)
Fig. 2. RFLPpatterns ofthePCRproductsfrom Fig. 1. First 10ofthe“Pat” lanes: BlackLayer;
Last 10of“Pat” lanes: Gray layer
Fig.3. Phylogenetictreeconstructed using sequence data from thesingle 16S rDNA clonefrom
enrichmentculture
Fig. 4. F420autofluorescence ofcells from enrichmentculture
Fig. 5a. DAPI-stained cellsfrom enrichment culture
Fig. 5b. HybridizationofDNAfrom cells inenrichmentculturetoan archaea-specificDNAprobe
Fig. 6. An exampleofthe morphologicaldiversityofcellswithin the pinkmatlayer
Fig. 7a. DAPI-stained filamentous prokaryotefrom enrichmentculture
Fig. 7b. Hybridization ofDNAfrom the filamentousbacterium in 7ato an archaea-specificDNA
probe
AppendixI Checkerboard hybridization onDIG-labeled PCRproducts from four layers ofthe
microbial mat