Table Of ContentFerreiraetal.BMCMicrobiology2013,13:93
http://www.biomedcentral.com/1471-2180/13/93
RESEARCH ARTICLE Open Access
Impact of agr dysfunction on virulence profiles
and infections associated with a novel
methicillin-resistant Staphylococcus aureus (MRSA)
variant of the lineage ST1-SCCmec IV
Fabienne Antunes Ferreira1, Raquel Rodrigues Souza1, Bruno de Sousa Moraes1, Ana Maria de Amorim Ferreira2,
Marco Antônio Américo1, Sérgio Eduardo Longo Fracalanzza1, José Nelson dos Santos Silva Couceiro1 and
Agnes Marie Sá Figueiredo1*
Abstract
Background: Anovelvariantof theST1-SCCmecIV methicillin-resistant Staphylococcus aureus (MRSA) lineage,
mostly associated withnosocomialbloodstream infections (BSI), has emerged inRio de Janeiro.Bacterial biofilm has
been considereda major virulence factor incentral venous catheter-associated BSI. The mechanisms involved in
biofilm formation/accumulation are multifactorial and complex. Studies have suggested that biofilm production was
affected in vitro and vivo foragr-nullmutants of S. aureus.
Results: The impact of naturally occurring inhibition of agr signaling on virulence profiles and infections associated
withtheST1 variantwas investigated. agr dysfunction was detected ina significant percentage (13%)of the isolates
withconcomitant increase inbiofilmaccumulation in vitro and in vivo, and enhanced ability to adhere to and
invade airway cells. The biofilmformedby these ST1 isolates was ica-independent and proteinaceous innature. In
fact, theimproved colonization properties were paralleled by an increased expression of thebiofilm-associated
genes fnbA,spa and sasG. The transcription of sarA,a positive regulator ofagr,was two-times reduced for the
agr-dysfunctionalMRSA. Remarkably, the agr inhibition was genetically stable. Indeed, agr-dysfunctionalisolates
succeed to colonize and cause both acute and chronic infections inhospitalized patients, and alsoto effectively
accumulate biofilmin a mouse subcutaneous catheter implant model.
Conclusion: The ability of agr-dysfunctional isolatesto cause infections inhumans and to form biofilm in the
animal model suggests that therapeutic approaches based on agr-inactivation strategies are unlikely to be effective
incontrollinghuman-device infections caused by ST1 isolates. The increased biofilm accumulation associated with
theacquisition ofmultiple antimicrobial resistant traits might have influenced(atleast inpart)theexpansion ofthis
USA400 related clone in our hospitals.
Keywords: MRSA, ST1-SCCmecIV,USA400, agr,Biofilm, Virulence factors
*Correspondence:[email protected]
1DepartamentodeMicrobiologiaMédica,InstitutodeMicrobiologiaPaulode
Góes,UniversidadeFederaldoRiodeJaneiro,RiodeJaneiro,RJ,Brazil
Fulllistofauthorinformationisavailableattheendofthearticle
©2013Ferreiraetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative
CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and
reproductioninanymedium,providedtheoriginalworkisproperlycited.
Ferreiraetal.BMCMicrobiology2013,13:93 Page2of12
http://www.biomedcentral.com/1471-2180/13/93
Background production, host cell adhesion and invasion as well as
Community-acquired methicillin-resistant Staphylococcus othermechanismsinvolvedintheestablishmentandcourse
aureus (CA-MRSA) lineage ST1- SCCmec IV was first ofstaphylococcaldiseaseswereaffectedbyknockoutofthe
reported in the 1980s among aborigines in Australia agr locus [26-28]. Despite the improvements achieved in
(WA-1 clone) and in the USA (MW2/USA400 clone) staphylococcal virulence, most of the investigations have
where cases of fatal infections were reported in Michigan, been carried out using relatively few laboratory construc-
Minnesota and North Dakota [1-3]. Nowadays, CA-MRSA tionsorclinicalisolates[28].Inaddition,thoseresultshave
infections have been described in different countries not been validated using current clinical isolates of MRSA.
involvinganumberofgeneticallydistinctlineages[4,5]. In this paper we characterized the biofilm formed by
Many CA-MRSA isolates (including USA300, USA400 USA400-related (ST1-SCCmecIV) MRSA emergent in Rio
and USA1100) carry lukSF encoding for Panton-Valentine deJaneiro,investigatedtheadhesiveandinvasiveproperties
leukocidin (PVL). Despite the controversy regarding the of naturally agr-dysfunctional isolates and analyzed
role of the PVL, this leukocidin has been linked to severe the impact of the agr inhibition on S. aureus infections
skin infections and necrotizing pneumonia [6-8]. In the associated with the use of medical device. Our results
USA, USA300 has replaced USA400 as the predominant suggestthatstrategiesbasedonagrinactivationapproaches
clone in manycommunities [9]. However, USA400isolates may not be effective as an anti-biofilm strategy in the
were the main cause of an outbreak of skin infections that management of device-associated infections caused by
occurred in rural southwestern Alaska, in 1996–2000 [10]. theseMRSAisolates.
Indeed, USA400 was the far most common CA-MRSA
clone recovered from three northern remote communities Results
of Saskatchewan, Canada [11]. In 2005, a novel variant of Biofilm
the lineage ST1-SCCmecIV emerged in Rio de Janeiro city AllsixtyST1isolatestestedwereabletoproducebiofilmon
asanimportantcauseof bloodstreaminfections(BSI)[12]. inert surfaces. The majority (58.3% and 25%; respectively)
It is intriguing that despite the genetic relationship with exhibited a moderate (BU varying from 0.468 to 0.901) or
Australian WA-1 and MW2/USA400, isolates of this strong(BUvaryingfrom1.008to3.615)biofilmphenotypes
novel clone were PVL-negative, multiresistant and mostly (Figure 1, top). For 19 randomly selected isolates, the
involved in hospital-associated BSI [12]. It is still poorly abilityto accumulatebiofilmonhumanFn-coatedsurfaces
understood why isolates of CA-MRSA have become suc- increasedsignificantly(p<0.01top<0.0001)whencom-
cessfulsoquickly[13].Nevertheless,forhospital-associated paredwiththatoninertsurfaces(Figure1,bottom).
MRSA(HA-MRSA),thebacterialabilitytoproducebiofilm
has been recognized as an important virulence factor for Proteinaceousnatureofthebiofilm
thepathogenesisofintravenouscatheter-relatedbacteremia Treatment with proteinase Kvirtually disrupted preformed
andinfectionsassociatedwiththeuseofmedicalprosthesis. biofilms for 12 ST1 isolates tested. However, the carbohy-
In addition, the bacterial ability to adhere to, colonize and drate oxidant metaperiodate almost did not affect the bio-
invade host tissues is considered important factor associ- film accumulated by these isolates (Figure 2, top). CLSM
atedwithbacterialvirulence,adaptationandspread[14,15]. studiesrevealedthattheagr-dysfunctional08–008accumu-
Different surface proteins have been implicated in biofilm lated a denser and compactbiofilm whencompared to the
formation/accumulation and host colonization, including heterogeneous film formed by the agr-functional isolate
fibronectin-binding proteins A and B (FnBPAB), S. aureus (96/05). Despite the stronger biofilm phenotype displayed
surfaceproteinG(SasG)andstaphylococcalproteinA(Spa) by the isolate 08–008, proteinase K could significantly
[16-19].Inaddition,extracellularDNA(eDNA)hasalso removethebiologicalfilmaccumulated(Figure2,bottom).
beenassociatedwithbacterialbiofilms[20].
It is also well known that virulence in S. aureus is RoleofeDNAinST1biofilm
modulated by an intricate regulatory network [21]. The No correlation was detected between the activity of
accessorygeneregulator(agr),themajorS.aureusquorum bacterial DNase and the levels of biofilm accumulated
sensing system, down-regulates a number of genes by 17 USA400-related isolates displaying strong, moderate
encodingforcell-surfaceproteinsinvolvedincolonization orweakbiofilmphenotypes(Figure3,top).Theadditionof
processes, and up-regulates (by an indirect mechanism 28U/wellDNaseIintheculturemediadidnotsignificantly
involving RNAIII dependent down-regulation of Rot) affect the biofilm formed by these ST1 isolates. However,
differentexoproteinsassociatedwithhost-celldamages when this concentration was increased to 56U/well,
[22]. Previous works have suggested that inactivation of a significant (p=0.0078) reduction of 31% in biofilm
AgrcouldbeveryeffectiveatinhibitingS.aureusinfections accumulation was detected (BU untreated =0.91±0.1 and
[23], including those associated with implantable medical treated=0.63±0.078;Figure3,leftbottom).Inaddition,the
devices[24,25].Studieshavedemonstratedthatbiofilm concentration of eDNA recovered from the supernatant of
Ferreiraetal.BMCMicrobiology2013,13:93 Page3of12
http://www.biomedcentral.com/1471-2180/13/93
Figure1BiofilmformedbyST1isolates.Top:Percentageofthetotal60ST1isolatesdisplayingstrong,moderateandweakbiofilm
phenotypes.WellsshowthedifferentbiofilmphenotypesformedoninertpolystyrenesurfacesbyrepresentativeST1isolates.Bottom:Biofilm
formedoninertorfibronectin-coatedsurfacesby19ST1isolates.
the strong biofilm producer (BU=1.167 ±0.07) isolate 0.004), 89/05 (RQ=1.194±0.1), 08–068 (RQ=2.841±0.816),
08–008 was 182 ng/mL, three-times higher than that 07–135 (RQ=1.867±0.69), 07–058 (RQ=1±0.62), displaying
determined for the weaker producer (BU=0.348±0.01) different levels of agr expression (Figure 5, top left), we
isolate 117/05 (Figure 3, right bottom). In agreement could not find a negative linear correlation between mecA
with these results, we have also detected a moderate and agr expressions (correlation coefficient, r = 0.823).
correlation (r=0.59) between bacterial autolysis and Thus,anoverexpressionofmecAcannottobeimplicated
biofilm accumulation, when 4 stronger biofilm producers in the inhibition of RNAIII transcription. Because agr is
werecomparedwiththesamenumberofweakerproducers positively regulated by SarA, the expression of sarA gene
(Figure4). was also analyzed by RT-qPCR. Our data showed a
significant (p=0.0052) attenuation of sarA for the agr-
agrRNAIIIinhibition dysfunctional isolate 08–008 when compared with the
About 13% (8/60) of the USA400 related isolates exhibited agr-functional 96/05 (Figure 6).
noapparenthemolyticactivity(Figure5,topright).These8
isolates had almost undetectable agr expression by Animalmodel
RT-qPCR (Figure 5, top left). Of significance is the fact Thenaturallyagr-dysfunctionalMRSAwasabletocolonize
that 4 out of 8 agr-dysfunctional MRSA were recovered and grow on the surface of implanted catheter fragment,
fromBSI(50%).TheRNAIIItranscriptionallevelsforthe8 as well as to accumulate an increased amount of biofilm
agr-functional isolates analyzed were significantly lower (2-log CFU/mL) when compared with the agr-functional
than that of strain RN6390B (Figure 5, top left). When we isolate (Figure 7, top). The stability of the agr expression
correlatedthebiofilmvalues(BU)withthelevelsofRNAIII intheagr-dysfunctionalMRSAwasexaminedbyobserving
transcription, we found that the population of clinical the hemolytic activity of individual colonies. No hemolytic
isolates with no hemolytic activity showed significant halo was detected before and after passages in mice
increase (p=0.01) in biofilm formation/accumulation (Figure7,bottom).
(Figure 5, bottom). No significant difference could be
detectedinthevaluesofoxacillinMICwhenagr-functional Expressionofagr-regulatedgenes
(MIC =128μg/mL)werecomparedwithagr-dysfunctional Total RNA obtained from isolates with significant differ-
90
isolates (MIC = 128μg/mL). Indeed, when we quantified ences (p<0.001) in the RNAIII transcription level (08–008;
90
mecA transcripts for 5 ST1 isolates, 08–008 (RQ=0.06± RQ=0.0001±0.16 and 96/05; RQ=0.53±0.13) was used to
Ferreiraetal.BMCMicrobiology2013,13:93 Page4of12
http://www.biomedcentral.com/1471-2180/13/93
Figure2Proteinaceousnatureofthebiofilm.Top:Effectof1mM/wellsodiummetaperiodateor6U/wellproteinaseKonpreformedbiofilm.
WellsshowtheeffectofthesecompoundsonbiofilmspreformedoninertpolystyrenesurfacesbyrepresentativeST1isolates.Bottom:Confocal
laserscanningmicroscopy(CLSM)imagesofproteinaseK-treatedand-untreatedbiofilmsstainedwithSYTO9.Thesquareindicatesthesliceof
thebiofilmfromwhichtheXYimagewastaken.ThehorizontalbarindicatesthelocationoftheXplanefromwhichthecross-sectionwastaken.
Isolate08–008(strongbiofilmproducer,agr-dysfunctional),96/05(moderatebiofilmproducer,agr-functional).
analyze the expression of genes that are well known to be Expressionofbiofilm-associatedgenesfnbAB,sasGandspa
regulatedbyagr.Asexpected,theagr-up-regulatedhlawas The agr-dysfunctional isolate 08–008, which showed
less expressed (p<0.01) in the isolate 08–008 (Figure 8) increased biofilm accumulation in vitro and in vivo,
when compared with the isolate 96/05 (RQ=0.05±0.01 and had a significant increase (p=0.02) in fnbA transcripts
RQ=0.33±0.05, respectively). Similar pattern of expression (RQ =10.08±0.18) when compared with the isolate
fnbA
was found for another agr-up-regulated gene, psmα 96/05RQ =4.91±0.19;Figure8).However,nosignificant
fnbA
(RQ =75.90±0.10 and RQ =0.005±0.12; p<0.001), difference was detected when fnbB expression were ana-
96/05 08-008
except that in this case we also observed a very high lyzed (RQ =0.11±0.04; RQ =0.18±0.05; Figure 8).
96/05 08-008
expression of psmα for 96/05 (Figure 8). To verify if SimilarlytofnbA,theexpressionofsasG(Figure8;p=0.03)
this amplified expression was a characteristic of this and spa (Figure 8; p<0.001) was also increased in 08–008
MRSA clone, other agr-functional isolates were randomly (RQ =1.13±0.11; RQ =52.8±0.17) compared with
sasG spa
selected for testing. High level of psmα transcripts 96/05isolate(RQ =0.65±0.14;RQ =0.8±0.20).
sasG spa
was also detected for the isolates 07–035, 07–059 and
08–068 (RQ =35.71±0.06; RQ =48.90±0.07; Adherenceandinvasion
07 035 07-059
RQ =31.30±0.07). For all virulence genes tested, The naturally agr-dysfunctional isolate 08–008 showed
08-068
the expression of the agr-functional isolate BMB9393 significant increase (p<0.05) in the adherence to human
was higher than that of USA400-related isolates, except airway cells, reaching 25.27%±0.4% at 3h30min of incuba-
for psmα gene (Figure 8). Accordingly, the RNAIII- tion. In contrast, at the same conditions, the adherence of
down-regulated spa gene showed a very significant the agr-functional (isolate 96/05) to airway cells occurred
lower expression (p<0.001) in the agr-functional 96/05 in much less extent (4.94%±0.2%). Similarly, invasion was
(RQ=0.8±0.20) compared with the agr-dysfunctional also higher for the agr-dysfunctional isolate (6.37%±0.3%)
isolate08–008(RQ=52.8±0.17;Figure8). when compared with the agr-functional (1.76%±0.2%) at
Ferreiraetal.BMCMicrobiology2013,13:93 Page5of12
http://www.biomedcentral.com/1471-2180/13/93
Figure3BacterialDNaseactivity,treatmentofthebiofilmwithDNaseIandeDNAassay.Top:DNaseactivitywasdetectedinculture
supernatantsof16ST1isolatesbymeasuringthehalosize(cm)producedonDifco™DNaseTestAgar(BD).BU:Biofilmvaluesfor16ST1isolates
usinginertpolystyrene.Leftbottom:For16ST1isolates,56U/wellofDNaseIwereaddedtotheculturemediaandtheamountofbiofilm
accumulateddetermined.Rightbottom:TheconcentrationofeDNAdeterminedinthebiofilmsupernatant.Isolate08–008(strongbiofilm
producer,agr-dysfunctional),96/05(moderatebiofilmproducer,agr-functional).
3h30minincubation(Figure9,top).Likewise,anincreased Discussion
invasive ability in the stationary phase was observed The great majority of the USA400-related isolates
for the agr-knockout MHC474 (10.6%±0.3%) when (50/60; 83.3%) were able to accumulate strong/moderate
compared with the wild type (HC474; 2.8%±0.1%) and biofilms on polystyrene surfaces. The isolates remaining
complemented construction CMHC474 (2.3%±0.1%; producedweakbiofilms.Theabilitytoaccumulatebiofilm
p=0.0033;Figure9,bottom). increased when the surfaces were covered with human
fibronectin,asalsoreportedbyothers[19,29].Inopposition
to our results, it was reported that MW2 MRSA had a
weak biofilm phenotype [30,31]. Similarly, a slight biofilm
accumulation (OD=0.25-0.3) was observed for another
USA400 strain called BAA-1683 [32]. In addition, recent
data from our laboratory (Ramundo MS & Figueiredo
AMS, 2012; unpublished observations) showed that
anotherSCCmecIVisolates(ST30CA-MRSA)accumulated
much lower amount of biofilm compared with ST1-SCC
mecIVisolates.
Previousdatafromourgroup[12]havealsodemonstrated
thattheST1isolatesfromRiodeJaneirodonotcarrylukSF
genes and have acquired a number of antimicrobial
resistance traits. Thus, it is possible that the enhanced
Figure4AutolysisassaysforUSA400-relatedisolates.07–058, abilityto accumulatebiofilm,associatedwiththebiological
105/05,107/05arestrongbiofilmproducers;07–035,07–042,07–135 cost of acquired resistance and the absence of PVL,
moderate;and07–062,117/05weakproducers.
might have been the results (at least in part) of the
Ferreiraetal.BMCMicrobiology2013,13:93 Page6of12
http://www.biomedcentral.com/1471-2180/13/93
Figure5agrdifferentialexpressioninUSA400-relatedisolates.Topleft:rnaIIIexpressionwasanalyzedbyRT-qPCRusingΔΔC comparative
T
method.RQ:Relativequantity,(BSI):bloodstreaminfection,(CT):cathetertip,(P):Pneumonia,(C):colonizationand(PF):prosthesisfragment.Top
right:Thearrowindicatesthearrow-tip-likezoneoftheδ-hemolysinactivityonsheepbloodagar.Bottom:Meanbiofilmvalues(BU)forthe
populationsformedbyisolatesshowinghemolyticactivityorabsenceofhemolysis.
microevolutionary events that accounted for changes resultswerealsoobservedbyothersusingdifferentMRSA
in a previously community pathogen, promoting enhanced isolates [33,34]. Some researchers have suggested that the
bacterialfitnesstospreadinhospitalsandcausehealth-care bacterial autolysis increases eDNA concentration and,
associated diseases. The ica-independent nature of the consequently, enhances the level of biofilm accumulation
biofilmformedbyUSA400-relatedisolateswasrevealed [20]. In fact, in our study, we observed a moderate
bythedisruptionofbacterialfilmbyproteinaseK.Similar correlation between biofilm accumulation and autolysis. In
addition, we detected threefold increase in eDNA for the
ST1 MRSA displaying enhanced ability to accumulate
biofilm.Indeed,theadditionofDNaseI(56U/Well)caused
asignificantreduction(about30%)inbiofilmaccumulation,
suggesting eDNA cooperatively contributes to the biofilm
architectureofST1isolates.
The statistical analysis showed that the group of clinical
isolates with no hemolytic activity (agr-dysfunctional) had
significant increase in the level of biofilm accumulation
whencomparedwithagr-functionalisolates.Thesedataare
in agreement with previous studies for agr-laboratory
knockouts [27,35,36], which have indicated that some
agr mutants can display increased levels of biofilm
accumulation. In spite of that, using another S. aureus
strainitwasreportedthatinhibitionofagrreducedbiofilm
Figure6TranscriptionallevelsofsarAdeterminedbyusing accumulation significantly [24,25]. In fact, agrRNAIII is a
ΔΔCTcomparativemethod.(1)USA400-relatedisolates08–008 negative regulator of different surface proteins [22,23], and
(agr-dysfunctional)and(2)96/05(agr-functional).(3)BMB9393wasused
consistent with this regulation, amplified expression of
asacontroland(4)RN6390Bascalibrator.RQ:Relativequantity.
genes encoding for biofilm-associated proteins FnBPA,
Ferreiraetal.BMCMicrobiology2013,13:93 Page7of12
http://www.biomedcentral.com/1471-2180/13/93
with the enhanced expression of PSMα were not clarified
[39]. Despite the importance of these virulence factors for
S. aureus pathogenicity, it is remarkable that among the
agr-dysfunctional variants, 4 were recovered from cases of
BSI, 2 from colonization, 1 from pneumonia and 1 from
infectedprosthesis,showingthatthesevariantswereableto
colonizeandcausebothsevereacute(pneumoniaandBSI)
andchronic(foreign-bodyinfection)staphylococcaldiseases
in humans. These data demonstrated that regardless the
reduced virulence of agr-laboratory knockouts in some
animalmodels[40],thevirulenceofnaturallydysfunctional
agr variants was confirmed for hospitalized patients. In
contrast to the assumption that agr-dysfunctional isolates
may not be able to initiate infections [41], the isolate
08–008 was able to colonize polyurethane endovenous
catheter in a foreign-body mouse model, forming a
denser biofilm accumulation when compared with the
agr-functionalisolate.Itisimportanttostatethatbecause
the ST1 isolates studied were not isogenic, it is possible
that factors other than the inhibition of agr might also
have accounted for the increased biofilm accumulation
observed. Nevertheless, supporting our data, similar
increase of the biofilm formed on catheters implanted
Figure7Invivobiofilmaccumulationandstabilityofagr
in mice was previously reported for an agr laboratory
inhibition.Top:Fortheforeignbodyanimalmodel,datawere
transformedinpercentageconsideringtheCFU/mLoftheisolate knockout [28]. In opposition to the results obtained by
08–008asthereferencevalue(100%).Bottom:Thestabilityofagr Traber et al. [41], all individual colonies formed by the
inhibitionwastestedbyexaminingthehemolyticactivityof agr-dysfunctional MRSA remained non-hemolytic before
individualcoloniesoftheisolates08–008before(left)andafter
and after passages in mice, strongly suggesting the genetic
(right)passageintheanimal.
stability of the phenotype. This stability was confirmed
for all agr-dysfunctional isolates from our collection.
SasG and Spa was found for the agr-dysfunctional variant. Corroborating our findings, while we were finishing
BothFnBPAandBhavebeenimplicatedasmajorproteins thismanuscript,wenoticedtheworkbyParketal.[42]
for biofilm formation/accumulation in S. aureus [19,33]. that found agr dysfunction in S. aureus significantly
However, despite the detection of an enhanced expression associated with persistent bacteremia with eradicated
of fnbA, we could not find a significant increase in the foci, even though the predominant MRSA isolates
transcription of fnbB-mRNA for the agr-dysfunctional showed SCCmecII, agrII (possible belonging to USA100-
ST1-MRSA. Equally, a study from Wolz and collabora- New York/Japan clone) while the isolates studied here
tors suggested that fnbB was not significantly affected displayed SCCmecIV, agrIII and clustered in USA400-
byagr[36]. MW2/WA-1 clone. In fact, the bacterial ability to adhere
Confirming the agr inhibition detected, the expression toandinvadeepithelialcells,andconsequentlyevadehost
oftwo genesup-regulated byRNAIII, hlaand psmα,was defense mechanisms, has already been associated with
lower compared with the agr-functional MRSA. Both persistenceinhostcellsanddevelopmentofdisseminated
cytolysins (HLA and PSMα) seem to have remarkable infections [43,44]. In the present study, the differential
roles in the pathogenesis of S. aureus. HLA has been expression of agrRNAIII in MRSA clinical isolates had
associated with lethal pneumonia in USA400 and USA300 a significant impact on adherence and invasion at
strains [37,38]. It was also previously found that psmα- 3h30min incubation. The same impact was observed
deletedmutantofCA-MRSAexhibitedattenuatedviru- for the agr isogenic knockout, as previously showed by
lence in animal models [39]. In this study, we detected others using different cell lines and mostly laboratory
asuperiorexpressionofpmsαbytheagr-functionalisolates mutants[26,45].
of USA400-related clone detected in Rio de Janeiro. In Recently, Pozzi et al. demonstrated that high level of
fact, it was shown by others that the transcription of PBP2aexpressionbythehomogeneousmethicillin-resistant
psmα-mRNA was increased in most prevalent CA-MRSA derivative of the strain 8325–4 induced a proteinaceous
lineages, including MW2, compared with other S. aureus biofilm and significant repression of the agr locus [46]. In
isolates[39].However,themolecularmechanismsinvolved addition, excision of the SCCmec element from the MRSA
Ferreiraetal.BMCMicrobiology2013,13:93 Page8of12
http://www.biomedcentral.com/1471-2180/13/93
Figure8Transcriptionallevelsofvirulence-associatedgenesdeterminedbyRT-qPCR,usingΔΔC comparativemethod.(1)USA400-related
T
isolates08–008(agr-dysfunctional)and(2)96/05(agr-functional).(3)BMB9393wasusedasacontroland(4)RN6390Bascalibrator.RQ:Relativequantity.
strain BH1CC, with consequent loss ofoxacillinresistance, mutants had lower ability to bind to fibronectin due to
had the opposite effect on biofilm and lead to an increase sarA down-regulation of fnbA transcription [36]. Possible
of the agrRNAIII transcription. In addition, Rudkin et al. explanationsforthisapparentdivergencecouldbethefact
showedthatmethicillinresistancereducedthevirulence thattheagr-dysfunctionalST1studiedshowedonlypartial
of HA-MRSA by interfering with agr [47]. The great sarAinhibition,ormaydisplaystrain-dependentvariation
majority of ST1 isolates studied had MIC of 128 μg/mL in the genetic background affecting other genes apart to
(agr-functional or -dysfunctional), which is compatible thosestudied.
with heterogeneous resistance to this drug. Indeed, mecA
overexpression was not detected in the agr-dysfunctional Conclusion
isolates tested. SarA, a global transcriptional regulator of Isolates of this novel hospital-associated USA400 clone
S. aureus, was previously found to be a positive regulator were able to accumulate moderate/strong amount of
of agr and of biofilm formation/accumulation [21,48]. biofilms,invitroandinvivo,andcouldefficientlyadhere
Thus, aiming to understand the mechanism involved in toandinvadehumanairwaycells.Moreover,agrinhibition
agr impairment in these clinical isolates, the level of sarA wasanordinaryphenomenonamongthoseisolates,which
transcripts was also examined. It was observed that seems to have impacted the expression of some important
sarA expression was significantly diminished in the virulencegenesstudied.Althoughitisdifficulttointerpret
agr-dysfunctional compared with the agr-functional in vitro studies in the light of what occurs in an infected
MRSA,suggestingthedefectwasupstreamagr.Beeken human host, it follows logical that the enhanced adhesive
et al. indicated that sarA repression inhibited biofilm properties combined with the acquisition of multiple drug
accumulation due to SarA inhibition of both proteases resistancetraitsbyST1isolatescouldhaveprovidedfitness
andnucleasesactivityeitherinthepresenceorabsence advantagesforspreadinginhospitalenvironments.Indeed,
of agr mutations [49]. In contrast, the results obtained agr-dysfunctional isolates were recovered from cases of
heredemonstratedthat agr-dysfunctional isolates showed hospital pneumonia, bacteremia and infected prosthesis.
increased biofilm accumulation, despite the fact that Finally,ourresultsstronglysuggestthatstrategiesforcon-
sarA-mRNA transcripts were reduced. In fact, other trollingMRSAbiofilmbasedonagrinhibitionapproaches
studies have showed that sarA or agr-sarA laboratory areunlikelytobeeffective,atleastforST1MRSAisolates.
Ferreiraetal.BMCMicrobiology2013,13:93 Page9of12
http://www.biomedcentral.com/1471-2180/13/93
S. aureus RN4220 and RN6390B, a gift from Richard
Novick (New York University), were used for hemolytic
activity and gene expression analyses; respectively. This
study was approved (#1055/09) by the Human Research
EthicsCommitteefromFederalUniversityofRiodeJaneiro,
RJ,Brazil.
Minimalinhibitoryconcentration(MIC)
OxacillinMICwasdeterminedusingMüllerHintonplates
andperformedinaccordancewiththeClinicalLaboratories
StandardsInstitutes(CLSI)guidelines[50].
Invitrobiofilmassay
For all 60 isolates, biofilm was tested using 96-well inert
polystyrenemicrotiterplates(Nunclon;NuncA/S,Roskilde,
Denmark) as previously described [28]. The biofilm unit
(BU)wasdefinedasindicatedbyAmaraletal.[14]andthe
isolates were classified as non-producers (BU≤0.230), weak
(BU>0.230 and ≤0.460), moderate (BU>0.460 and ≤0.920)
or strong producers (BU>0.920), as suggested [14]. For
19isolates,biofilmassayswerealsocarriedoutonsurfaces
covered with human fibronectin (Merck; Darmstadt,
Germany)aspreviouslydescribed[28].
In some experiments, before treatment with crystal
violet, the biofilm was treated with sodium metaperiodate
(10mM/well;Sigma;St.Louis,MO,USA)orproteinase
K (6U/well, Invitrogen; Carlsbad, California, EUA) [27].
Confocallaserscanningmicroscopy(CLSM)wasemployed
to record and contrast structural images of the biofilm
as described [28]. eDNA was quantified in biofilm su-
W
Figure9Adherenceandinvasionassaysusinghumanbronchial pernatants using Qubit 2.0 Fluorometer (Invitrogen;
epithelialcellline(16HBe14o-).Top:96/05(agr-functional)and Eugene, Oregon, USA), after ethanol precipitation. For
08–008(agr-dysfunctional).Bottom:Invasionassaywasalsodetermined
some experiments, biofilms were formed in the presence
after3h30minforthewild-typestrainHC474,isogenicagrknockout
MHC474(Δagr::tetM)andthernaIII-trans-complementedconstruction of DNase I (28U/well or 56U/well Invitrogen; Carlsbad,
CMHC474(Δagr::tetM,pbla-rnaIII). California,EUA).
Animalmodel
Methods A pair of isolates showing differential agr expression
Isolates (08–008, agr-dysfunctional, obtained from BSI and 96/05,
Sixty USA400-related isolates were obtained from patients agr-functional, from CT) wasused. The mouse subcutane-
locatedindifferenthospitalwardsinRiodeJaneiroaspart ous catheter implant model was described in detail by
of standard clinical care. Thirty isolates were recovered Ferreira et al. [28]. Briefly, two intravenous polyurethane
from BSI (50%) and 8 from catheter tips (CT; 13.3%). The catheter segments (C-UDLM-953J model; Cook Medical,
remaining were from colonization (C; 13.3%), pneumonia Bloominaton, USA) were implanted in the back of each
(P; 6.7%),skin/soft tissue infections(SSTI; 5%), urinary anesthetizedyoung-adultBALB/cmalemice.Infectionwas
tract infections (UTI; 3.3%) and prosthesis fragment induced 24 h after the implantation procedure by injecting
(PF; 1.7%). The infection sites had not been reported a mid-exponential growth phase culture (106 CFU/10 μL)
for 4 isolates. The agr-knockout MNY474 (Δagr::tetM) into the lumen of the implanted catheter segment. The
and the rnaIII-trans-complemented mutant CMNY474 animal was euthanized after three days post-infection, and
(Δagr::tetM, pbla-rnaIII) were previously constructed the catheter segments were surgically removed to assess
from the clinical S. aureus isolate NY474 [27]. BMB9393 the biofilm by counting catheter-adherent bacteria by
(ST239-SCCmecIII) was used as positive control for CFUdetermination.Threeindependentexperimentswere
biofilm and gene expression experiments [27]. The performed. The animal study was approved (#IMPPG013)
Ferreiraetal.BMCMicrobiology2013,13:93 Page10of12
http://www.biomedcentral.com/1471-2180/13/93
by The Ethics Committee for Animal Care and Use from Table1PrimersusedinRealTimeqPCR
FederalUniversityofRiodeJaneiro,RJ,Brazil. Target Primersequencea Amplicon Reference
gene length(bp)
DNaseactivity rnaIII F:AATTTGTTCACTGTGTCGATAAT 135 Thisstudy
™
Difco DNase Test Agar (BD; Becton, Dickinson and R:TGGAAAATAGTTGATGAGTTGTT
Company, Sparks, USA) was used to screen 17 USA400-
sarA F:TTCTTTCTCTTTGTTTTCGCTG 115 Thisstudy
relatedMRSA,asrecommendedbythemanufacturer.
R:GTTATCAATGGTCACTTATGCT
spa F:TGGTTTGCTGGTTGCTTCTTA 116 Thisstudy
Autolysisassay
Autolysin activity was measured in 8 selected isolates as R:GCAAAAGCAAACGGCACTAC
previously described [51], except that cells were grown hla F:TTTGTCATTTCTTCTTTTTCCCA 169 Thisstudy
inTSB1%Glc. R:AAGCATCCAAACAACAAACAAAT
psmα F:TATCAAAAGCTTAATCGAACAATTC 176 53
Hemolyticactivity
R:CCCCTTCAAATAAGATGTTCATATC
Theδ-hemolysin(Hld),encodedbythehldgene,iscodified
sasG F:GGTTTTCAGGTCCTTTTGGAT 192 Thisstudy
within the rnaIII region and, consequently, the detection
of δ-hemolysin is an indicative of agr expression. Sixty R:CTGGTGAAGAGCGAGTGAAA
USA400-related isolates were screened for hemolytic fnbpA F:ACTTGATTTTGTGTAGCCTTTTT 185 Thisstudy
activity on sheep red blood (5%) agar plates (Plast Labor, R:GAAGAAGCACCAAAAGCAGTA
RJ,Brazil)aspreviouslydescribed[52].
fnbpB F:CGTTATTTGTAGTTGTTTGTGTT 118 Thisstudy
R:TGGAATGGGACAAGAAAAAGAA
Geneexpression
rrna16S F:AGAGATAGAGCCTTCCCCTT 84 Thisstudy
For RNA preparations, bacterial cells grown in TSB
(18h/37°C; 250 rpm) were obtained in the exponential R:TTAACCCAACATCTCACGACA
phase (OD = 0.3) and in the stationary phase. mecA F:TCCAGATTACAACTTCACCAGG 162 54
600nm
Total RNA was prepared using the RNeasy Mini kit R:CCACTTCATATCTTGTAACG
(Qiagen; Maryland, USA) and quantified by the Qubit aFandR:forwardandreverseprimers,respectively,in5´→3´orientation.The
2.0Fluorometer.TheRNAqualitywasanalyzedbyrunning cyclingconditionsforallprimerswereasfollows:Onecycleof48°C/30min
RNA-gel electrophoresis. The real-time quantitative PCR and95°C/10min,followedby35cyclesof95°C/30s,55°C/45sand72°C/45s.
W Eachrunincludedanontemplateandagene-negativeRNAcontrols.
(RT-qPCR) was carried out using Power SYBR Green
™
RNA-to-C 1-Step Kit (Applied Biosystems; Foster city, 0.25% (wt/vol) trypsin (11,000 U/mg; Sigma; St. Louis,
T
CA, USA) as recommended, using ΔΔCt comparative MO USA), lysed (5 min/37°C) with 0.025% (vol/vol)
method.TheprimersandrunconditionsusedforrnaIII, Triton X-100 (Sigma) and plated in TSA. For determining
hla, psmα [53], sarA, mecA[54], spa, sasG, fnbA and the CFU of invasive bacteria (CFU), infected monolayers
I
fnbB genes and for the endogenous control rrna 16S are werewashedtwiceinDMEMandincubated(20min/37°C)
listedinTable1.Allprimersdesignedforthisstudywere with 100 μg/mL lysostaphin (500 U/mg; Sigma) to lyse
validated as recommended (Guide to Performing Relative adherent bacteria. Monolayers were washed twice and
Quantitation of Gene Expression Using Real-Time incubated(5min/37°C)with0.25%(wt/vol)trypsin.The
Quantitative PCR; Applied Biosystems). The run was epithelial cells were lysed (5 min/37°C) with 0.025%
™
performed in the Step One Real Time PCR System (vol/vol) triton X-100 and plated. For each aliquot, the
(Applied Biosystems). Data were analyzed using the totalCFUinthesupernatantwasalsodetermined(CFU ).
S
StepOneSoftware2.2(AppliedBiosystems). The CFU of adherent bacteria (CFU ) was obtained by
A
the formula: CFU = CFU - CFU. The percentages of
A AI I
Adherenceandinvasionkinetics invasiveoradherentbacteriawerecalculatedconsideringas
Bacterial adherence and invasion were investigated using 100%thetotalCFUobtainedbythesumofCFU +CFU
AI S
human bronchial epithelial cells (16HBE14o- cell line) as foreachaliquot.InadditiontotheUSA400-relatedisolates,
described [14], except that monolayers were prepared the wild-type HC474, and the isogenic Δagr::tetM and
using Dulbecco´s Modified Eagle Medium (DMEM, rnaIII-trans-complemented constructions were also used
LowGlucose1X;Gibco,Invitrogen,GrandIsland,USA) forinvestigatingbacterialinvasion.
and 10% Fetal Bovine Serum (Gibco, Invitrogen). For
determining the colony forming units (CFU) of the Statisticalcalculations
total adhered and invasive bacteria (CFU ), infected Student’s t-test (unpaired data) was used to compare the
AI
monolayers were washed twice in DMEM (to remove means of the biofilm values and of the data from gene
non-adherent bacteria), incubated (5 min/37°C) with expression experiments. In addition, correlation coefficient
Description:Results: The impact of naturally occurring inhibition of agr signaling on virulence profiles and .. DNase Test Agar (BD; Becton, Dickinson and.