Hanseniaspora uvarum from Winemaking Environments Show Spatial and Temporal Genetic ...

16 Pages·2016·2.44 MB·English

by  Warren Albertin

ORIGINALRESEARCH
published:20January2016
doi:10.3389/fmicb.2015.01569
Hanseniaspora uvarum from
Winemaking Environments Show
Spatial and Temporal Genetic
Clustering
WarrenAlbertin1,2*,MathabathaE.Setati3,CécileMiot-Sertier1,4,TalithaT.Mostert3,
BenoitColonna-Ceccaldi5,JoanaCoulon6,PatrickGirard5,VirginieMoine6,
MyriamPillet7,FranckSalin7,MarinaBely1,BenoitDivol3and
IsabelleMasneuf-Pomarede1,8
1UnitéderechercheŒnologie,InstitutdelaSciencedelaVigneetduVin,UniversityBordeaux,Villenaved’Ornon,France,
2ENSCBP,BordeauxINP,Pessac,France,3DepartmentofViticultureandOenology,InstituteforWineBiotechnology,
StellenboschUniversity,Matieland,SouthAfrica,4InstitutNationaldelaRechercheAgronomique,InstitutdelaSciencedela
VigneetduVin,USC1366InstitutNationaldelaRechercheAgronomique,Villenaved’Ornon,France,5CentredeRecherche
PernodRicard,Créteil,France,6Biolaffort,Bordeaux,France,7InstitutNationaldelaRechercheAgronomique,UMR
Editedby: BiodiversitéGènesetEcosystèmes,PlateFormeGénomique,Cestas,France,8BordeauxSciencesAgro,Gradignan,France
AlbertoMas,
UniversityRoviraiVirgili,Spain
Hanseniasporauvarumisoneofthemostabundantyeastspeciesfoundongrapesand
Reviewedby:
MaurizioCiani, in grape must, at least before the onset of alcoholic fermentation (AF) which is usually
UniversitàPolitecnicadelleMarche, performed by Saccharomyces species. The aim of this study was to characterize the
Italy
geneticandphenotypicvariabilitywithintheH.uvarumspecies.Onehundredandfifteen
MatthiasSipiczki,
UniversityofDebrecen,Hungary strains isolated from winemaking environments in different geographical origins were
*Correspondence: analyzed using 11 microsatellite markers and a subset of 47 strains were analyzed by
WarrenAlbertin
AFLP.H.uvarumisolatesclusteredmainlyonthebasisoftheirgeographicallocalization
[email protected]
asrevealedbymicrosatellites.Inaddition,astrongclusteringbasedonyearofisolation
Specialtysection: was evidenced, indicating that the genetic diversity of H. uvarum isolates was related
Thisarticlewassubmittedto
to both spatial and temporal variations. Conversely, clustering analysis based on AFLP
FoodMicrobiology,
asectionofthejournal data provided a different picture with groups showing no particular characteristics, but
FrontiersinMicrobiology provided higher strain discrimination. This result indicated that AFLP approaches are
Received:05November2015 inadequate to establish the genetic relationship between individuals, but allowed good
Accepted:27December2015
strain discrimination. At the phenotypic level, several extracellular enzymatic activities
Published:20January2016
of enological relevance (pectinase, chitinase, protease, β-glucosidase) were measured
Citation:
AlbertinW,SetatiME,Miot-SertierC, but showed low diversity. The impact of environmental factors of enological interest
MostertTT,Colonna-CeccaldiB,
(temperature,anaerobia,andcopperaddition)ongrowthwasalsoassessedandshowed
CoulonJ,GirardP,MoineV,PilletM,
SalinF,BelyM,DivolBand poorvariation.Altogether,thisworkprovidedbothnewanalyticaltool(microsatellites)and
Masneuf-PomaredeI(2016) newinsightsintothegeneticandphenotypicdiversityofH.uvarum,ayeastspeciesthat
Hanseniasporauvarumfrom
haspreviouslybeenidentifiedasapotentialcandidateforco-inoculationingrapemust,
WinemakingEnvironmentsShow
SpatialandTemporalGenetic butwhoseintraspecificvariabilityhadneverbeenfullyassessed.
Clustering.Front.Microbiol.6:1569.
doi:10.3389/fmicb.2015.01569 Keywords:Hanseniasporauvarum,wine,intraspecificdiversity,microsatellites,phenotypicscreening
FrontiersinMicrobiology|www.frontiersin.org 1 January2016|Volume6|Article1569
Albertinetal. H.uvarumSpatialandTemporalClustering
INTRODUCTION 2013), higher alcohols and volatile metabolites (Zironi et al.,
1993; Zohre and Erten, 2002; Moreira et al., 2011), isoamyl
Hanseniaspora uvarum (anamorph Kloeckera apiculata) is an acetate (Moreira et al., 2008), butanediol and acetoin (Romano
apiculate yeast species frequently found on mature fruits et al., 1993, 2000), and a few other compounds were reported
(Spencer et al., 1992; Morais et al., 1995) and particularly as significantly different. Some of these alterations could be
on grapes where it forms part of the grape and fermentation associated with the secretion of extracellular enzymes. Indeed,
microbiome.Its association with grapes and the first stages of several enzymatic activities of technological interest have been
alcoholicfermentation(AF)hasbeenreportedrepeatedlyduring characterized, such as β-glucosidase, xylosidase, protease, and
thelastcentury(Castelli,1955;SchützandGafner,1993;Hierro lipase activities (Charoenchai et al., 1997; Manzanares et al.,
etal.,2006)andformost—ifnotall—vineyardregionsworldwide 1999; Capece et al., 2005). Moreover, some strains of the H.
(Heard and Fleet, 1985; Holloway et al., 1990; Mateo et al., uvarum species were shown to be low producers of ochratoxin
1991; Comi et al., 2001; Beltran et al., 2002; Jolly et al., 2003; A (OTA), the main mycotoxin found in wine (Angioni et al.,
Combinaetal.,2005;Lietal.,2010;Zottetal.,2010;Kachalkin 2007). For all these reasons, the ability of H. uvarum to be
et al., 2015). H. uvarum is also frequently isolated from other preserved by lyophilization and cryopreservation was assessed
fermented beverages such as cider (Lachance, 1995; Cabranes recently, and was found satisfactory enough to maintain
etal.,1997;Vallesetal.,2007;PandoBedrinanaetal.,2012),palm its fermentation ability (de Arruda Moura Pietrowski et al.,
wine and cashew juice (Owuama and Saunders, 1990), tequila 2015).
(Bilbaoetal.,1997),sugar-caneaguardente(Moraisetal.,1997), TheabioticandbioticfactorstowhichH.uvarumisexposed
etc. It is part of the natural microbiome of many fermented in grape must have also been investigated. The data showed
foodprocesses,includingcoffee(Masoudetal.,2004)andcocoa that the growth of H. uvarum was significantly affected by
(Batista et al., 2015) fermentations. In some biotechnological temperature, pH, sulfite, and ethanol concentrations (Gao and
processessuchasyogurt(Kosseetal.,1997),orangejuice(Renard Fleet, 1988; Heard and Fleet, 1988; Albertin et al., 2014b), with
etal.,2008),beer(Wiles,1950),andhoney(Pulvirentietal.,2009) some of these factors having synergistic or buffering effects.
production, H. uvarum is considered as a spoilage species. H. SeveralauthorsreportedtheexistenceofinteractionsbetweenH.
uvarumalsodisplaysindustriallyrelevantantagonisticproperties uvarumandS.cerevisiaeduringAF(Mendozaetal.,2007;Wang
againstthedevelopmentofmoldsresponsibleforfruitspoilage. et al., 2014), associated with various underlying mechanisms
The species is thus extensively assessed as a biocontrol agent including production of killer toxin (Radler et al., 1985, 1990;
against Botrytis cinerea (gray mold) on grapes and strawberries Schmitt and Neuhausen, 1994), and release of yet unidentified
(Longetal.,2005;Liuetal.,2010a,b;Caietal.,2015),Penicilium metabolites(Wangetal.,2015).
spp. (fruit rot) on citrus (Long et al., 2005), Colletotrichum However, most of these studies evaluated single strains of
capsici (fruit rot) on chili (Basha and Ramanujam, 2014), etc., H. uvarum. Only a few authors considered several strains to
while the underlying mechanisms of action are actively studied account for potential diversity within the species (Comi et al.,
(Liu et al., 2014; Pu et al., 2014). The ecological extent of H. 2001;Capeceetal.,2005),buteventhen,thegeneticrelationships
uvarum is large: it has been collected from soils (Capriotti, between the different strains remained obscure due to the lack
1955), plants (Sláviková et al., 2009), insects (Nguyen et al., ofdedicatedtools.Indeed,themolecularapproachesavailableto
2007),birds(KocanandHasenclever,1972),molluscs(deAraujo dateallowedintraspecificdiscrimination,butnotestablishment
et al., 1995), and shrimps (Pagnocca et al., 1989), while its of genetic distance: RAPD (randomly amplified polymorphic
occurrenceasclinicalisolateonhumansisrareandconsidered DNA, Capece et al., 2005) or restriction endonuclease analysis
as opportunistic (Emmanouil-Nikoloussi et al., 1994; Garcia- associated with pulse-field gel electrophoresis (REA-PFGE,
Martosetal.,1999). Versavaud and Hallet, 1995) were described to discriminate
In winemaking, the presence of indigenous apiculate yeasts H. uvarum strains. By contrast, PCR fingerprinting was
has long been viewed as undesirable (Velázquez et al., 1991; not able to discriminate H. uvarum strains in Aglianico
Ciani,1998;ComitiniandCiani,2010),andmethodsorfactors wines (Caruso et al., 2002). More recently, FT-IR (Fourier
tolimittheirproliferationduringAFhavebeendescribed(Farías transforminfraredspectroscopy)wassuccessfullyappliedtothe
and Manca de Nadra, 2003; Sosa et al., 2008; Comitini and intraspecific discrimination of H. uvarum from grape berries
Ciani,2010).However,therenewedinterestinnon-conventional andthewineryenvironment(Grangeteauetal.,2015).However,
yeasts in the wine industry has led to the reassessment of none of these approaches allows the establishment of genetic
the species suitable—and beneficial—for winemaking purpose. relationships between the different isolates. Consequently, the
Several studies report on the characterization of the outcome extent of the diversity within the H. uvarum species remains
of AF by H. uvarum in mixed or sequential inoculation with uncharacterized.
Saccharomyces cerevisiae in grape must, as H. uvarum alone In this study, 115 strains of H. uvarum were isolated from
is not able to complete AF (i.e., to consume all the sugar winemaking environments in France and South Africa. Their
contained in grape musts). Wines resulting from mixed or geneticvariabilitywasanalyzedusingtwodifferentapproaches:
sequential inoculation of H. uvarum and S. cerevisiae were microsatellite markers and AFLP (amplified fragment-length
shown to differ from pure cultures (S. cerevisiae) in their polymorphism).Theirphenotypicdiversityregardingenzymatic
chemical composition. Indeed, the concentrations of some activities and response to environmental factors was also
organic acids, aldehydes and minor alcohols (Hong and Park, investigated.
FrontiersinMicrobiology|www.frontiersin.org 2 January2016|Volume6|Article1569
Albertinetal. H.uvarumSpatialandTemporalClustering
MATERIAL AND METHODS TABLE1|Hanseniasporasp.strainsusedinthisstudy.
Yeast Strains Species Strain Collectiona Country Yearof Substrate
isolation
OnehundredandelevenstrainsofHanseniasporaspp.,including
mainlyH.uvarumandafewHanseniasporaguillermondii,were H.uvarum CRBOL0638 CRBOeno France 2006 Grape/wine
isolated from French and South African winemaking areas H.uvarum CRBOL0552 CRBOeno France 2005 Grape/wine
between 2003 and 2014 (Table1). These strains were identified H.uvarum CRBOL1437 CRBOeno France 2014 Grape/wine
using molecular techniques like rDNA ITS analysis (Granchi
H.uvarum CRBOL0531 CRBOeno France 2005 Grape/wine
etal.,1999),andsequencingoftheD1/D2domainof26SrDNA
H.uvarum CRBOL1491 CRBOeno France 2014 Grape/wine
(O’Donnell, 1993; Kurtzman and Robnett, 1998) or the ITS
H.uvarum CRBOL0555 CRBOeno France 2005 Grape/wine
sequence(Whiteetal.,1990;Esteve-Zarzosoetal.,1999).D1/D2
H.uvarum CRBOL1468 CRBOeno France 2014 Grape/wine
andITSsequenceswerethenblastedagaineitherNCBIdatabase
H.uvarum CRBOL1481 CRBOeno France 2014 Grape/wine
orYeastIP,acuratedyeastdatabase(Weissetal.,2013).
H.uvarum CRBOL0413 CRBOeno France 2003 Grape/wine
Fifteenstrainsfromothergeographicalandsubstrate(nature,
H.uvarum CRBOL0414 CRBOeno France 2003 Grape/wine
cider, etc.) origins were included (Table1). For phenotypic
H.uvarum CRBOL1438 CRBOeno France 2014 Grape/wine
characterization, several control strains were used: S. cerevisiae
H.uvarum CRBOL1497 CRBOeno France 2014 Grape/wine
VIN13 (Mocke, 2005) was used as positive control for killer
H.uvarum CRBOL0430 CRBOeno France 2003 Grape/wine
activity, S. cerevisiae ZIM 1859 S6 (Zagorc et al., 2001)
H.uvarum CRBOL1469 CRBOeno France 2014 Grape/wine
was used as killer sensitive yeasts. Metschnikowia pulcherrima
IWBT Y1123, Schwanniomyces polymorphus var. africanus CBS H.uvarum CRBOL0406 CRBOeno France 2003 Grape/wine
8047,SaccharomycesparadoxusRO88(Redzepovicetal.,2003), H.uvarum CRBOL14124 CRBOeno France 2013 Grape/wine
Metschnikowia chrysoperlae IWBT Y955 were used as positive H.uvarum CRBOL1455 CRBOeno France 2014 Grape/wine
controls for the acid protease, β-glucosidase, pectinase, and H.uvarum CRBOL0765 UROeno France 2007 Grape/wine
chitinasetests,respectively. H.uvarum CRBOL1474 CRBOeno France 2014 Grape/wine
All strains were grown at 24◦C in traditional YPD medium H.uvarum NZ15 CRPR New- 2009 Grape/wine
containing1%yeastextract,1%peptone,and2%glucose(w/v), Zealand
supplementedornotwith2%agar(w/v). H.uvarum Gui21 UROeno France 2012 Grape/wine
Microsatellite analysis was applied to all Hanseniapora spp. H.uvarum NZ234 CRPR New- 2009 Grape/wine
Zealand
strains available, while only a subset of strains was used for
H.uvarum CRBOL0660 CRBOeno France 2006 Grape/wine
bothAFLPandphenotypingassays,moretime-consumingand
H.uvarum CRBOL0764 CRBOeno France 2007 Grape/wine
less reproducible over large number of experiments. For AFLP
approach,47strainswereselected,andforphenotypingdatawe H.uvarum CRBOL0557 CRBOeno France 2005 Grape/wine
usedasubsetof30strains(allincludedintheAFLPpanel)aswell H.uvarum CRBOL0658 CRBOeno France 2006 Grape/wine
as10otherHanseniasporaspp. H.uvarum CRBOL0659 CRBOeno France 2006 Grape/wine
H.uvarum CRBOL0763 UROeno France 2007 Grape/wine
H.uvarum CRBOL0456 CRBOeno France 2003 Grape/wine
Genome Sequencing, Microsatellite Loci
H.uvarum CRBOL0666 CRBOeno France 2006 Grape/wine
Identification, and Primers Design
H.uvarum CRBOL0554 CRBOeno France 2005 Grape/wine
A draft genomic sequence was produced using Ion Torrent H.uvarum CRBOL0639 CRBOeno France 2006 Grape/wine
technology. Briefly, a genomic library of strain CRBO L0551 H.uvarum IWBTY888 IWBT SouthAfrica 2011 Grape/wine
was produced using the Ion Xpress Plus Fragment Library Kit H.uvarum CRBOL14118 CRBOeno France 2014 Grape/wine
(LifeTechnologies,Carlsbad,USA),withanenzymaticshearing
H.uvarum CRBOL14150 CRBOeno France 2014 Grape/wine
◦
of 10min at 37 C. DNA was sequenced on an Ion Torrent
H.uvarum CRBOL14144 CRBOeno France 2014 Grape/wine
PGM (Life Technologies, Carlsbad, CA). After trimming on
H.uvarum CRBOL1442 CRBOeno France 2014 Grape/wine
qualitythreshold(Phred-typequalityscoreofQ20,QPhred=20)
H.uvarum NZ5 CRPR New- 2009 Grape/wine
and length threshold (50 bp) using CLC GenomicsWorkbench Zealand
7.0.3 (CLC bio, Boston, MA), Newbler software (version 2.7, H.uvarum CRBOL1433 CRBOeno France 2014 Grape/wine
454 Life Sciences) was used to produce a de novo assembly of
H.uvarum CRBOL1492 CRBOeno France 2014 Grape/wine
1665 contigs of more than 1000bp. This draft assembly forms
H.uvarum CRBOL14112 CRBOeno France 2014 Grape/wine
a 7.68 Mb sequence for an estimated genome size of 8–9 Mb
H.uvarum CRBOL14136 CRBOeno France 2014 Grape/wine
(Esteve-Zarzosoetal.,2001).
H.uvarum Y-1612 NRRL Indonesia NA Soil
Microsatellites(di-totetranucleotiderepeats)weresearched
H.uvarum Y-915 NRRL NA NA Cider
within the de novo genome assembly as described previously
H.uvarum NZ1 CRPR New- 2009 Grape/wine
(Albertin et al., 2014a), and primers were designed using
Zealand
the Design primers’ tool on the SGD website (http://www.
H.uvarum CRBOL1461 CRBOeno France 2014 Grape/wine
yeastgenome.org/cgi-bin/web-primer) by applying Schuelke’s
method (Schuelke, 2000) to reduce costs. Amplified fragment (Continued)
FrontiersinMicrobiology|www.frontiersin.org 3 January2016|Volume6|Article1569
Albertinetal. H.uvarumSpatialandTemporalClustering
TABLE1|Continued TABLE1|Continued
Species Strain Collectiona Country Yearof Substrate Species Strain Collectiona Country Yearof Substrate
isolation isolation
H.uvarum CRBOL1441 CRBOeno France 2014 Grape/wine H.uvarum CRBOL0551 CRBOeno France 2005 Grape/wine
H.uvarum CRBOL1415 CRBOeno France 2014 Grape/wine H.uvarum CRBOL1445 CRBOeno France 2014 Grape/wine
H.uvarum CRBOL14130 CRBOeno France 2014 Grape/wine H.uvarum Gui3 UROeno France 2012 Grape/wine
H.uvarum DSMZ70285 DSMZ Germany NA Nature H.uvarum CRBOL14125 CRBOeno France 2014 Grape/wine
H.uvarum CRBOL14113 CRBOeno France 2014 Grape/wine H.uvarum Y-1614 NRRL Russia NA Grape/wine
H.uvarum CRBOL0418 CRBOeno France 2003 Grape/wine H.uvarum CRBOL1426 CRBOeno France 2014 Grape/wine
H.uvarum CLIB303 CLIB Ukraine NA Grape/wine H.uvarum CRBOL0671 CRBOeno France 2006 Grape/wine
H.uvarum CRBOL0428 CRBOeno France 2003 Grape/wine H.uvarum CRBOL14137 CRBOeno France 2014 Grape/wine
H.uvarum CRBOL1449 CRBOeno France 2014 Grape/wine H.uvarum NZ148 CRPR New- 2009 Grape/wine
Zealand
H.uvarum CRBOL1448 CRBOeno France 2014 Grape/wine
H.uvarum Gui12 UROeno France 2012 Grape/wine
H.uvarum CRBOL14108 CRBOeno France 2014 Grape/wine
H.uvarum CRBOL1473 CRBOeno France 2014 Grape/wine
H.uvarum CRBOL1420 CRBOeno France 2014 Grape/wine
H.uvarum YB-3199 NRRL USA NA Fruit
H.uvarum 516149 MAFF(NIAS) Japan NA Nature
H.uvarum IWBTY941 IWBT SouthAfrica 2013 Grape/wine
H.uvarum CRBOL0401 CRBOeno France 2003 Grape/wine
H.uvarum YqNS2 UROeno France 2012 Grape/wine
H.uvarum CRBOL1462 CRBOeno France 2014 Grape/wine
H.uvarum IWBTY1100 IWBT SouthAfrica 2009 Grape/wine
H.uvarum CRBOL0665 CRBOeno France 2006 Grape/wine
H.uvarum IWBTY1013 IWBT SouthAfrica 2009 Grape/wine
H.uvarum CRBOL1414 CRBOeno France 2014 Grape/wine
H.uvarum IWBTY1196 IWBT SouthAfrica 2009 Grape/wine
H.uvarum CRBOL14149 CRBOeno France 2014 Grape/wine
H.uvarum IWBTY1177 IWBT SouthAfrica 2009 Grape/wine
H.uvarum CRBOL14143 CRBOeno France 2014 Grape/wine
H.uvarum IWBTY1192 IWBT SouthAfrica 2009 Grape/wine
H.uvarum CRBOL1404 CRBOeno France 2014 Grape/wine
H.uvarum IWBTY1133 IWBT SouthAfrica 2009 Grape/wine
H.uvarum CRBOL14129 CRBOeno France 2014 Grape/wine
H.uvarum IWBTY1190 IWBT SouthAfrica 2009 Grape/wine
H.uvarum CRBOL0312 CRBOeno France 2003 Grape/wine
H.uvarum IWBTY966 IWBT SouthAfrica 2013 Grape/wine
H.uvarum Gui1 UROeno France 2012 Grape/wine
H.uvarum CRBOL1418 CRBOeno France 2014 Grape/wine
H.uvarum IWBTY1173 IWBT SouthAfrica 2009 Grape/wine
H. 113816 MAFF(NIAS) NA NA Fruit
H.uvarum CRBOL0756 CRBOeno France 2007 Grape/wine guilliermondii
H.uvarum CRBOL14119 CRBOeno France 2014 Grape/wine H. IWBTY970 IWBT SouthAfrica 2013 Grape/wine
H.uvarum IWBTY968 IWBT SouthAfrica 2014 Grape/wine guilliermondii
H.uvarum TBSau1 UROeno France 2012 Grape/wine H. IWBTY1035 IWBT SouthAfrica 2009 Grape/wine
H.uvarum IWBTY952 IWBT SouthAfrica 2014 Grape/wine guilliermondii
H. IWBTY1165 IWBT SouthAfrica 2009 Grape/wine
H.uvarum CRBOL1434 CRBOeno France 2014 Grape/wine
guilliermondii
H.uvarum IWBTY1097 IWBT SouthAfrica 2009 Grape/wine
H. Y-1625 NRRL SouthAfrica NA Clinical
H.uvarum CRBOL1446 CRBOeno France 2014 Grape/wine
guilliermondii
H.uvarum CRBOL0743 CRBOeno France 2007 Grape/wine
H.opuntiae IWBTY863 IWBT SouthAfrica 2011 Grape/wine
H.uvarum CRBOL0744 CRBOeno France 2007 Grape/wine
H.opuntiae IWBTY875 IWBT SouthAfrica 2011 Grape/wine
H.uvarum IWBTY864 IWBT SouthAfrica 2011 Grape/wine
H.vineae IWBTY907 IWBT SouthAfrica 2012 Grape/wine
H.uvarum TBSem1 UROeno France 2012 Grape/wine H.vineae IWBTY971 IWBT SouthAfrica 2013 Grape/wine
H.uvarum IWBTY967 IWBT SouthAfrica 2013 Grape/wine
aCLIB, CIRM-Levures, INRA/AgroParisTech, Thiverval-Grignon, France; CRBOeno,
H.uvarum IWBTY969 IWBT SouthAfrica 2014 Grape/wine
Centre de Ressources Biologiques Œnologie, Villenave d’Ornon, France; CRPR,
H.uvarum CRBOL1427 CRBOeno France 2014 Grape/wine Centre de Recherche Pernod-Ricard, Creteil, France; DSMZ, Leibniz-Institut DSMZ,
H.uvarum CRBOL1486 CRBOeno France 2014 Grape/wine Braunschweig, Germany; IWBT, IWBT, Stellenbosch University, South Africa; MAFF
(NIAS),NIASGenebank,Ibaraki,Japan;NRRL,ARSCultureCollection,Peoria,USA;UR
H.uvarum IWBTY1044 IWBT SouthAfrica 2009 Grape/wine
Oeno,ResearchunitOenology,Villenaved’Ornon,France.
H. IWBTY901 IWBT SouthAfrica 2012 Grape/wine NAstandsfor“NotAvailable.”
guilliermondii
H.uvarum YB-783 NRRL USA NA Nature
H.uvarum CRBOL1430 CRBOeno France 2014 Grape/wine
sizesvariedfrom120to466bp,allowingsubsequentmultiplexing
H.uvarum IWBTY861 IWBT SouthAfrica 2011 Grape/wine
oftheamplicons(Table2).
H.uvarum IWBTY1116 IWBT SouthAfrica 2009 Grape/wine
H.uvarum IWBTY1139 IWBT SouthAfrica 2009 Grape/wine
Microsatellites Amplification
H.uvarum CRBOL1487 CRBOeno France 2014 Grape/wine
DNAwaspreparedasfollowed:yeastcellsweredilutedin20mM
(Continued) NaOH(concentrationof1.108 cells/mL),thenheated10minat
FrontiersinMicrobiology|www.frontiersin.org 4 January2016|Volume6|Article1569
Albertinetal. H.uvarumSpatialandTemporalClustering
observedozygosity) 0.017 0.087 0.574 0.078 0.07 0.2 0.33 0.043 0.096 0.27
Ho(eter
h
s).
Codingsequence(blastxresult) UnnamedproteinproductinKluyveromycesdobzhanskiiCBS2104[emb|CDO94325.1] HypotheticalproteinH.uvarumD499_0Z00400inDSM2768[gb|KKA01551.1] Nosignificantsimilarityfound Nosignificantsimilarityfound Nosignificantsimilarityfound Nosignificantsimilarityfound Nosignificantsimilarityfound TranslationinitiationfactoreIF-2BH.uvarumsubunitepsiloninDSM2768[gb|KKA03659.1] Nosignificantsimilarityfound FACTcomplexsubunitHuSPT16H.uvaruminDSM2768[gb|KKA03363.1] n(seeSectionMaterialsandMethod
o
ati
c
plifi
m
Allelessizerange(bp) 247–253[2alleles] 429–441[4alleles] 389–451[9alleles] 267–291[6alleles] 146–192[8alleles] 261–287[8alleles] 120–152[7alleles] 428–466[7alleles] 153–180[6alleles] 138–166[5alleles] dformicrosatellitea
e
s
u
e
ur
at
m 5 2 5 2 5 2 2 2 2 5 per
T 5 5 5 5 5 5 5 5 5 5 m
e
t
g
n
elti
asporauvarumgenotyping. Primers F:CACGACGTTGTAAAACGACTTCAAATCCGGCATAGTGGT;R:CCATTGTTGCTTCTGAAACC F:CACGACGTTGTAAAACGACAGATCAAGCAGAGACCACAAA;R:TTGTCGCTTTCTTTGTAAACA F:CACGACGTTGTAAAACGACACTGCTGTATTTGCATTTTTG;R:GGAAAAAGCAGAAAAAAAGCG F:CACGACGTTGTAAAACGACGGGTTAGCAACGTTTTCGAT;R:TGGATTGGTGAAAATGTGCA F:CACGACGTTGTAAAACGACAGGTACAGGCGTTATATCCGA;R:TGGTGTGTGATGTACGTTGTG F:CACGACGTTGTAAAACGACCTCCTTGCACCCAAAAAAA;R:TTCATCGGCTGTTATGCTTG F:CACGACGTTGTAAAACGACTTTGTCCTTCACTGGTGGTCA;R:TGTTTTGATTCCATTATCGG F:CACGACGTTGTAAAACGACCCTTTGCTGGTAAGGTACCTG;R:GCTTGGAAATGGCTGTTATG F:CACGACGTTGTAAAACGACAAAGGCTATGTTGAGCCTGA;R:AAGGCTTGTTTAAAGCAGGT F:CACGACGTTGTAAAACGACGCTTCAGAAATCAAAGCAGC;R:AGGTGCCGGATCTAAATTCA ′5-endwithM13sequence(CACGACGTTGTAAAACGAC).Tmisthem
Hanseniocifor Fluorescentdye FAM PET FAM NED NED PET FAM NED HEX PET ersweretailedon
l m
osatellite Motif TCT ACA ATA TGT ACA AC AGA TCTT TCT TCT orwardpri
2|Micr atellite einpb.F
TABLE Microsname HU292 HU409 HU440 HU467 HU508 HU593 HU594 HU620 HU68 HU853 Allelesiz
FrontiersinMicrobiology|www.frontiersin.org 5 January2016|Volume6|Article1569
Albertinetal. H.uvarumSpatialandTemporalClustering
◦ ◦ ′
94 C.ThissolutionwasusedasDNAtemplatesforfurtherPCR and MseI at 37 C followed by ligation of the EcoRI (5-
′ ′
reactions. CTCGTAGACTGCGTACC-3 and 5-AATTGGTACGCAGTC-
PCR were performed in a final volume of 15µL containing 3′) and MseI (5′-GACGATGAGTCCTGAG-3′ and
1µL of DNA template, 0.05µM of forward primer, 0.5µM 5′-TACTCAGGACTCAT-3′) adaptors. The primer pair
′ ′ ′
of reverse primer and labeled primer, 1X Taq-&GO (MP EcoRI-0 (5-GACTGCGTACCAATTC-3) and MseI-C (5-
′
Biomedicals, Illkirch, France). Universal M13 primers were GATGAGTCCTGAGTAAC-3) was used for the non-selective
labeledwitheitherFAM-,HEX-,PET-,orNED-fluorescentdyes PCR of a 5µL aliquot of the ligation mix diluted 10× with
(EurofinsMWGOperon,LesUlis,France). TE buffer, while the selective primer was performed using
′ ′
Touch-down PCR were carried out using iCycler (Biorad, EcoRI-C (5-GACTGCGTACCAATTCC-3) and MseI-AC
′ ′
Hercules, CA) thermal cycler. The program encompassed an (5-GATGAGTCCTGAGTAAAC-3) primer pair. The bands
initialdenaturationstepof1minat94◦Cfollowedby10cycles wereresolvedona2%(w/v)agarosegelwith1×TBEbufferat
of30sat94◦C,30satTm+10◦C(followedbya1◦Cdecrease 80V.ThegelwasstainedwithGelRedandvisualizedunderUV.
◦
percycleuntilTmisreached)and30sat72 C,then20cyclesof The presence/absence of AFLP markers was scored against a
30sat94◦C,30satTmand30sat72◦C,andafinalextension GeneRuler™100bpPlusDNAladder(FermentasLifeSciences,
◦
stepof2minat72 C. Finland) using GeneTools version 4.01 (SynGene, Synoptics
Amplicons were initially analyzed by a microchip Ltd., Cambridge, England). AFLP fragment sizes were rounded
electrophoresis system (MultiNA, Shimadzu) and the optimal to the closest integer and a binary matrix (presence/absence)
conditionsforPCRamplificationswereassessed.Then,thesizes of263AFLPbands,rangingfrom94to1865pbwascreated.A
oftheamplifiedfragmentsweremeasuredonanABI3730DNA dendrogram was subsequently built using Euclidean’s distance,
analyzer(AppliedBiosystems).Forthatpurpose,PCRamplicons Ward’sclusteringandmultiscalebootstrapresampling.
were diluted (1800-fold for FAM, 600-fold for HEX, 1200-fold
Screening for Extracellular Enzyme
forPET,and1800-foldforNED-labeledampliconsrespectively)
andmultiplexedinformamide.LIZ600molecularmarker(ABI Activities of Enological Relevance
GeneScan 600 LIZ Size Standard, Applied Biosystem) was 100- All yeast species were grown overnight in YPD broth (Biolab-
folddilutedandaddedforeachmultiplex.Beforeloading,diluted Merck, Wadeville, South Africa) at 30◦C on a rotary wheel. In
◦
amplicons were heated 4min at 94 C. Allele size was recorded order to standardize the number of cells spotted, the cultures
usingGeneMarkerDemosoftwareV2.4.0(SoftGenetics). were diluted to an optical density of 0.1 at a wavelength of
600nm.Oneachplate,10µLofthedilutedculturewasspotted
Microsatellite Analysis andincubatedfor3daysat30◦C.Thefollowingactivitieswere
screenedonsolidagarmediaaspreviouslyreportedinliterature.
Microsatellite analysis, based on allele size, was used to
investigate the genetic relationships between isolates. A
β-Glucosidase Activity
dendrogram was built using Bruvo’s distance (Bruvo et al.,
Extracellular β-glucosidase activity was tested on arbutin
2004) and Ward’s clustering, by means of R (R Development
substrate[1%(w/v)yeastextract,2%(w/v)peptone,0.5%(w/v)
Core Team, 2010). Bruvo’s distance is particularly well adapted
arbutin,20mL1%ammoniumferric]atpH3.5accordingtothe
in the case of multiple and/or unknown ploidy levels, which
method described by Strauss et al. (2001). S. polymorphus var.
is the case for H. uvarum species. Since classical bootstrap
africanus(previouslyDebaryomycespolymorphusvar.africanus)
resamplingispoorlyreliablewithmicrosatellitedata,weassessed
CBS8047wasusedasapositivecontrol.
the robustness of the tree nodes using multiscale bootstrap
resamplingofthelociassociatedwithanapproximatelyunbiased
Acid Protease Activity
test (Shimodaira, 2002) by means of R and the pvclust package
Thisassaywasperformedaccordingtothemethoddescribedby
v1.2-2 (Suzuki and Shimodaira, 2006; R Development Core
Bilinskietal.(1987).Sixtymillilitersofphosphate-sodiumbuffer
Team,2010).
(24g/L KH PO + 35g/L Na HPO -7H O) was microwaved
Analysis of molecular variance (AMOVA) was performed 2 4 2 4 2
with 70mL skim milk solution (100 g/L skim milk in 0.05M
by means of the pegas package (Paradis, 2010) with n =
citrate phosphate buffer) for ∼45s or until it starts simmering.
1000 permutations. We tested whether the genetic distance
Four hundred and eighty milliliters agar (20g/L, pH adjusted
wassignificantlyexplainedbygeographicallocalization(i.e.,the
to 3.5) was then added and the plates poured. M. pulcherrima
country of isolation was used as grouping factor) or year of
IWBT Y1123 (Reid et al., 2012) was used as a positive control
isolation(from2003to2014).
forproteaseactivity.
Amplified Fragment Length Polymorphism Polygalacturonase Activity
For all yeast species and isolates, genomic DNA was extracted The assay was carried out following the method described by
using mechanical cell breakage with glass beads (Hoffman, vanWyketal.(vanWykandDivol,2010).Polygalacturonicacid
2001). DNA concentrations were determined using the [1.25%(w/v)]wasdissolvedin0.68%(w/v)potassiumphosphate
NanoDrop™ 1000 spectrophotometer. The AFLP reactions (pH3.5),togetherwith0.67%(w/v)YNB,1%(w/v)glucose,2%
were performed according to Esteve-Zarzoso et al. (2010). (w/v) agar. Positive activity was measured against the control
Briefly, 1.5µg DNA was digested for 4h with EcoRI yeastS.paradoxusRO88(Mocke,2005).
FrontiersinMicrobiology|www.frontiersin.org 6 January2016|Volume6|Article1569
Albertinetal. H.uvarumSpatialandTemporalClustering
Chitinase Activity sulfate, the molecule usually contained in Bordeaux mixture)
Colloidal chitin [0.45% (w/v)] was used as substrate to test for or Cu(OH) (copper hydroxide, as contained in ChampFlo,
2
chitinaseactivityaccordingtothemethoddescribedbyAgrawal Nufarm) at concentrations varying from 0.03 to 32µg/mL of
◦
andKotasthane(2012).ThepHofthemediumwasadjustedto CuSO orCu(OH) respectively.After48Hincubationat25 C,
4 2
4.7. M. chrysoperlae IWBT Y955 was used as a positive control theminimuminhibitoryconcentration(MIC)wasdetermined.
(Ghosh,2015).
Screening for Killer Activity
RESULTS
Hanseniasporaspp.isolatesweretestedfortheirpotentialkiller
activity against S. cerevisiae ZIM1859 S6 previously reported
Development of Microsatellite Markers for
as killer sensitive strains. The so-called “spot-on-the-lawn”
technique was used, as described by Mehlomakulu et al. Hanseniaspora Uvarum
(2014).Briefly,allthestrainswerecultivatedovernightin5mL Next generation sequencing was used to produce a de novo
YPD broth on a rotary wheel. The cells were harvested by assembly of the genome sequence of CRBO L0551, a strain
centrifugationandre-suspendedinsaline[0.9%(w/v)NaCl]to isolatedfromgrapemustinBordeauxregionin2005.Although
anOD600nm of0.1(∼3×107 cells/mL).Topreparetheseeded thisdenovoassemblydisplayedanimportantnumberofcontigs
cultures, 1mL of the sensitive cells was mixed with 4mL of (1665 contigs of more than 1000 bp), it was sufficient to
a 4% (w/v) pre-autoclaved agar solution and 5mL of a filter locate repeated sequence. Microsatellite loci (dinucleotide to
sterilized commercial preservative-free white table grape juice tetranucleotide) were selected on the basis of their location: on
supplementedwith0.5%(w/v)yeastextract,adjustedtopH4.5. different contigs and not within the 5′-end and 3′-end of the
The solution was poured into Petri dishes and allowed to set. contigs (3kb exclusion in order to exclude possible telomeric
Thereafter, 10µL of overnight cultures of the potential killer orsubtelomericpositions).Primersweredesignedtoamplify11
strains in saline were spotted on the surface. The plates were microsatellite loci, four of them being located within putative
◦
incubatedat20 Cuntilalawnofseededyeastswasvisibleand codingsequence(Table2).Theampliconswereseparatedusing
azoneofinhibitionaroundthekillerpositivestrainS.cerevisiae amicrochipelectrophoresissystem(MultiNA),andtheoptimal
VIN13wasobserved. conditions for microsatellites amplifications were assessed on a
subpanel of five strains of H. uvarum (data not shown). After
Sporulation
optimization, the microsatellites markers were tested on other
Sporulation ability of Hanseniapora spp. isolates was assessed species of the Hanseniaspora genus: H. guillermondii Y-1625T,
on three different media: McClary’s acetate agar (10% glucose, 113816, IWBT Y1035, IWBT Y1165, IWBT Y901, IWBT Y970;
1.8g/L potassium chloride, 8.2g/L sodium acetate trihydrate, H. opuntiae IWBT Y863 and IWBT Y875; H. vineae IWBT
2.5g/L yeast extract, 15g/L agar), malt extract agar (5% malt Y907,andIWBTY971.Noamplificationwasobservedforthese
extract, 2% agar) as described by Kurtzman et al. (2011), and non-uvarum strains (data not shown), except for strain IWBT
potassium acetate agar (10 g/L Potassium Acetate, 15g/L agar) Y901. Strain IWBT Y901 was identified as H. guillermondii by
bystreakingcoloniesonthesemedia.Thecellswerethenstained sequencingbothITSandLSUD1/D2rRNAregions,yetallowed
accordingtothemethoddescribedbyMerrittandHurley(1972). thenormalamplificationofall11microsatellitesmarkers.
The11microsatellitesmarkerswerethenusedtogenotype115
Growth Assays under Various
strains, including 101 H. uvarum strains isolated from various
Environmental Conditions wineries in France near Bordeaux and in South Africa near
Strain ability to metabolize glycerol as sole carbon source was Stellenbosch (Table1). A few other isolates from winemaking
testedasfollowed:strainswereplatedon2%glycerolagarplates environments were added: the type strain Y-1614 from Russia,
(1% yeast extract, 2% peptone, 2% glycerol, 1.5% agar) and five strains from New-Zealand (NZ1, NZ5, NZ15, NZ148, and
incubatedat25◦Cforupto7days. NZ234) and CLIB 303 from Ukraine. Six strains from non-
In order to test the impact of low temperature (12◦C), enological environments were also genotyped: Y-1612 (soil,
anaerobiaandtheadditionofcoppersolution,yeaststrainswere Indonesia), Y-915 (cider), DSMZ 70285 (soil), 516149 (maize,
grownfor24hinYNB(BDDifco)pH3.5at25◦Cwithconstant Japan), YB-783 (tree, USA), and YB-3199 (fruit, USA). Strain
agitationthenserially10-folddilutedandspottedonYNBagar IWBT Y901, identified as H. guillermondii but able to amplify
plates(pH3.5).Tenmicrolitersofserialcellularconcentrations all microsatellites, was also added. All microsatellites were
were tested (103 cells/ml, 104 cells/ml, 105 cells/ml,) and gave polymorphic on this panel of 115 strains, with only two
similarresults.CellularsuspensionswerespottedusingaSteers alleles for HU292 and up to 9 alleles for HU440 (Table2).
multipoint inoculator. Anaerobic conditions were created in Althoughthepolymorphismofthemicrosatellitelociwaslimited
sachetbyAnaeroGensachetAN0025(Oxoid).Actualanaerobia compared to other species (Legras et al., 2005; Albertin et al.,
was checked using GasPak™ Dry Anaerobic Indicator Strips 2014a,c; Masneuf-Pomarede et al., 2015), altogether they were
(BD).Thepresenceorabsenceofgrowthwasrecordedafter48h discriminantenoughtodetect86differentgenotypesoverthe115
◦ ◦
incubation(12 Cor25 C,aerobiaoranaerobia). tested.Twentystrainsdisplayedonlyonealleleperlocus,while95
Susceptibility to copper was estimated by plating the yeast showedheterozygosityforatleast1upon10loci.Heterozygosity
strains on YNB pH 3.5 containing either CuSO (copper was detected for all loci, with observed heterozygosity ranging
4
FrontiersinMicrobiology|www.frontiersin.org 7 January2016|Volume6|Article1569
Albertinetal. H.uvarumSpatialandTemporalClustering
from 0.017 for the less polymorphic locus HU292 to 0.574 for isolationwasalsousedasagroupingfactor,andexplainedmuch
HU440,themorepolymorphiclocus. more variation (20.62%, p < 10−6). These results confirmed
thatyearofisolationaswellasgeographicaloriginsignificantly
Exploring the Genetic Relationships
shapedthediversityofH.uvarumpopulationsfromwinemaking
Between H. uvarum Isolates Using environments.
Microsatellites
Genetic Diversity of H. uvarum Populations
Thegeneticrelationshipsbetweenthe115isolatesofH.uvarum
were studied using Bruvo’s distance (Bruvo et al., 2004) and in Winemaking Environments
Ward’s clustering. The resulting dendrogram (Figure1) shows The wine strains used in this study were isolated from several
three main clusters: one cluster (group C) contained almost all wineries, sometimes from different samples over several years.
strainsfromSouthAfricanwinemakingenvironments(19ofthe This is the case of winery G, for which 19 strains were isolated
21),andwashighlysupported(bootstrapvalueof96).Thetwo from grape must between 2003 and 2014 (Table4). These 19
other groups contained mostly wine strains from France, but strains displayed 17 different genotypes distributed throughout
interestingly, these groups clustered on the basis of the year of thedendrogram,indicatingthatnoclonewasaspecificsignature
isolation: most strains collected before 2009 clustered in group ofthiswinery.Thesamepatternwasobservedforallwineries:in
A(19strainsupon29),withhighbootstrapvalue(91).GroupB mostinstances,severalgenotypesfromdifferentgeneticgroups
contained40strains,mostofthem(25)beingisolatedafter2009 were identified within the same winery, suggesting that the
fromwinemakingenvironmentsinFrance(boostrapvalueof91). absenceofgeneticsignatureatthewinerylevelwascommonfor
Toconfirmthegeneticclusteringbasedonbothgeographical H.uvarumpopulation.
distance and year of isolation, we performed AMOVA. When We also studied the genetic diversity at sample level. For
using the country of origin as grouping factor, AMOVA was example, five strains from grape must were isolated and
significant(p=0.00099),andthecountryexplained8.54%ofthe genotyped from the same sample in winery. The five strains
totalvariationofthemicrosatellitedataset(Table3).Theyearof (CRBO L0743, CRBO L0756, CRBO L0763, CRBO L0764, and
FIGURE1|DendrogramtreesofHanseniasporauvarumfrommicrosatellitedataset(115strains)andAFLPdataset(47strains).Bruvo’asandEuclidean
distancewereusedformicrosatelliteandAFLPdata,respectively.Ward’sclusteringandmultiscalebootstrapresamplingwereusedinbothcases.Forvisibility,only
theboostrapsofthehighernodeswereshownformicrosatellitedata.
FrontiersinMicrobiology|www.frontiersin.org 8 January2016|Volume6|Article1569
Albertinetal. H.uvarumSpatialandTemporalClustering
TABLE3|AMOVAresultsusingmicrosatelliteorAFLPdataset,forcountryandyearofisolationasgroupingfactors.
Dataset Factor p-value Variationexplainedbyfactor Modalities(numberofstrains)
Microsatellite Country 0.00099 8.54% France(81);SouthAfrica(21);NewZealand(5)
Microsatellite Yearofisolation <<10−6 20.62% 2003(9);2005(6);2006(8);2007(6);2009(17);2011(3);2012(8);2013(3);2014
(47)
AFLP Country 0.2258 – France(16);SouthAfrica(20);NewZealand(5)
AFLP Yearofisolation 0.7323 – 2005(1);2006(1);2009(16);2011(3);2012(6);2013(3);2014(11)
TABLE4|DiversityofHanseniasporauvarumpopulationsfor20wineriesasdetectedbymicrosatellitegenotyping.
Winery Country Numberofgenotypes/ Yearof Genetic Strains
Numberofstrains isolations groups ID
WineryA France 3genotypes/4strains 2007–2009 GroupsA-B CRBOL0413,CRBOL0414,CRBOL0428,CRBOL0430
WineryB France 3genotypes/3strains 2014–2014 GroupC CRBOL1426,CRBOL1427,CRBOL1430
WineryC France 5genotypes/6strains 2003–2014 GroupsA-B CRBOL1414,CRBOL1415,CRBOL1437,CRBOL1438,CRBOL1441,
CRBOL1442
WineryD France 3genotypes/3strains 2005–2007 GroupB CRBOL14108,CRBOL14112,CRBOL14113
WineryE SouthAfrica 2genotypes/2strains 2009–2014 GroupC IWBTY941,IWBTY967
WineryG France 17genotypes/19strains 2003–2014 GroupsA-B-C CRBOL0312,CRBOL14143,CRBOL14144,CRBOL14149,CRBO
L14150,CRBOL1468,CRBOL1469,CRBOL1473,CRBOL1474,CRBO
L1481,CRBOL1486,CRBOL1487,CRBOL1491,CRBOL1492,CRBO
L1497,Gui1,Gui12,Gui21,Gui3
WineryH New-Zealand 5genotypes/5strains 2005–2011 GroupsA-B-C NZ1,NZ148,NZ15,NZ234,NZ5
WineryI SouthAfrica 6genotypes/6strains 2003–2014 GroupsB-C IWBTY861,IWBTY864,IWBTY888,IWBTY952,IWBTY968,IWBTY969
WineryJ France 4genotypes/4strains 2005–2014 GroupsB-C CRBOL14129,CRBOL14130,CRBOL14136,CRBOL14137
WineryL France 18genotypes/19strains 2003–2014 GroupsA-B-C CRBOL0551,CRBOL0552,CRBOL0554,CRBOL0555,CRBOL0557,
CRBOL0638,CRBOL0639,CRBOL0658,CRBOL0659,CRBOL0660,
CRBOL0665,CRBOL0666,CRBOL0671,CRBOL0743,CRBOL0744,
CRBOL0756,CRBOL0763,CRBOL0764,CRBOL0765
WineryM France 3genotypes/3strains 2005–2014 GroupsB-C CRBOL1404,CRBOL1433,CRBOL1434
WineryN France 1genotypes/2strains 2007–2007 GroupB CRBOL1448,CRBOL1449
WineryO France 2genotypes/2strains 2014–2014 GroupC CRBOL1445,CRBOL1446
WineryP SouthAfrica 3genotypes/3strains 2014–2014 GroupsB-C IWBTY1013,IWBTY1173,IWBTY1177
WineryR SouthAfrica 2genotypes/2strains 2012–2012 GroupC IWBTY1190,IWBTY1192
WineryS SouthAfrica 2genotypes/2strains 2014–2014 GroupC IWBTY1116,IWBTY1196
WineryT France 6genotypes/6strains 2003–2014 GroupsA-B-C CRBOL14118,CRBOL14119,CRBOL14124,CRBOL14125,TBSau1,
TBSem1
WineryU SouthAfrica 2genotypes/2strains 2012–2014 GroupC IWBTY1097,IWBTY1100
WineryX France 2genotypes/2strains 2009–2014 GroupsA-B CRBOL0401,CRBOL0406
WineryY France 4genotypes/4strains 2006–2014 GroupsA-B-C CRBOL1455,CRBOL1461,CRBOL1462,YqNS2
CRBO L0765) exhibited five different genotypes distributed on applied to a limited number of strains in order to be reliable.
the tree. In addition, in 2005, for winery L, some strains were Here,wechosetoapplyAFLPanalysistoasubpanelof47strains,
isolatedondays1,3,4,and5duringthepre-fermentativestage in order to compare the results obtained from microsatellite
ofthesametank.Thefourcorrespondingstrains(CRBOL0552, data and AFLP data. The AFLP dendrogram was produced
CRBO L0554, CRBO L0555, and CRBO L0557) clustered in using Euclidean distance and Ward’s clustering (Figure1).
group A on the dendrogram, but they all displayed different Comparison between microsatellite and AFLP dendrograms
genotypes. Altogether, these results suggest that the diversity revealed important differences with no obvious clustering for
of the population of H. uvarum is high in winemaking AFLPdataforcountryoriginorvintage,evenwhencomparing
environments and that no specific genetic signature exists in a exactly the same subset of strains (SupplementaryFigure1).
givenwinery. WesubsequentlyperformedAMOVAanalysisusingthedistance
matrix produced from AFLP data (Table3). When using the
Comparing Microsatellite and AFLP Typing country or the year of isolation as grouping factor, AMOVA
AFLP techniques are viewed as moderately repeatable over a was not significant (p > 0.05) using AFLP data, indicating
highnumberofexperiments,sothatAFLPanalysesareusually thatAFLPclusteringwasnotabletodetectthegeneticstructure
FrontiersinMicrobiology|www.frontiersin.org 9 January2016|Volume6|Article1569
Albertinetal. H.uvarumSpatialandTemporalClustering
dependingongeographicaloriginnoryearofisolation.However, be noted that using AFLP, the amplification of multiple bands
it has to be noted that AFLP tool was able to discriminate in a single run may lead to competition between amplicons
47 strains upon 47 on the basis of their AFLP patterns. By and therefore to differences of band intensity that complicate
contrast, on the same subset, the microsatellite tool identified data analysis. In addition, AFLP techniques are usually viewed
37 different genotypes. This indicated that although AFLP tool as moderately repeatable thereby making the technique usually
lackedrobustnesstoassessthegeneticrelationshipofindividuals, poorlyreliable,whiletherepeatabilityofmicrosatellitesmarkers
itwasmorediscriminantthanthemicrosatellitetool. isusuallyhigher(Jonesetal.,1997)andcanbethusappliedtoa
largernumberofindividuals.
Phenotyping Hanseniaspora sp. Isolates Moreover, AFLP markers are non-codominant markers,
As phenotyping assays are time-consuming, a subpanel of 30 so that homozygosity or heterozygosity is difficult to assess
strains of H. uvarum and 10 other Hanseniaspora spp. were (Gaudeul et al., 2004). By contrast, microsatellites are
selected and subjected to various plate assays to assess whether codominant markers, allowing assessing heterozygosity status.
they possessed any extracellular enzyme activity that could be Here,wefoundthat95outof115strainsshowedheterozygosity,
of interest in enology (Table5). Their killer activity against allowing an unprecedented insight into the genetics of the
two strains of S. cerevisiae that are sensitive to S. cerevisiae’s species. Microsatellites are widely used to estimate relatedness
killer toxins was also investigated. Finally, their ability to grow amongindividualsordifferentiationamonggroups.Bycontrast,
when exposed to various environmental factors of scientific or AFLPshouldbetakenwithcautionduetothelackofcomplete
enologicalinterest(lowtemperature,anaerobia,copperpresence, genotypic information caused by dominance (Parker et al.,
glycerolastheonlycarbonsource)wasrecorded. 1998). Indeed, the dendrogram obtained by both approaches
With regards to extracellular enzyme activity, all strains are not comparable and the genetic structure based on year of
showedgrowthonthearbutinplates,althoughnodistincthalo isolationandgeographicaloriginevidencedusingmicrosatellite
could be observed. Most Hanseniaspora strains showed a slight wascompletelymissedbyAFLPanalysis.
browning of the colony which might be due to weak activity As expected, microsatellite genotyping proved to be a better
or even intracellular β-glucosidase activity. Weak acid protease toolforestablishinggeneticrelationbetweenstrainsandgetting
activitywasobservedformoststrains,withYB-783showingthe new insights within species at genetic level (Ross et al., 1999).
largesthalo(4mm)andstrainsGui21andCRBOL0551showing Bycontrast,AFLPisinterestingtoperformassayswheregenetic
halos of 2mm after 72-h incubation. No polygalacturonase relatedness is not needed, which is usually the case for several
activity was observed. Finally, weak chitinase activity could be biotechnological applications in enology: assessing the global
visualized in isolates NZ234 and Y-861 (1-mm halo) while the population diversity, testing for the prevalence/implantation of
otherisolatesshowednogrowthonthechitinmedia. aspecific(known)strain,searchingforcontaminationevidence,
None of the strains was able to sporulate. Regarding their etc.Intheselatterinstances,thetechnicalsimplicityandrapidity
growthability,moststrainswereunabletogrowon2%glycerol of AFLP, associated with low cost, is definitively advantageous
agarplatesafterincubationat30◦Cforupto7days.Theirgrowth comparedtomicrosatellitegenotyping.
abilityundervariousenvironmentalconditionswastested:ability
◦
togrowatlowtemperature(12and30 C),underoxicoranoxic, New Insights into the Genetic Structure of
in presence of various copper concentrations. The MIC for
Hanseniaspora uvarum from Winemaking
copper sulfate and copper hydroxide was either 2 or 4 mg/L
Environments
with no specific correlation between these 2 factors. All strains
tested showed similar ability to grow under these conditions Like many non-conventional yeasts of enological interest, the
of enological interest, and limited phenotypic variations were geneticstructureofH.uvarumfromwinemakingenvironments
recorded. Indeed, only strain Y-1614 did not show any growth remained elusive. Here, using microsatellite data, we show
at12◦Candanaerobiosis.Finally,nokilleractivitywasobserved that an important number of H. uvarum strains (95/115) are
againstS.cerevisiae. heterozygous.Thisresultcouldbecongruentwiththehypothesis
of a diploid species, although the possibility of aneuploidy
could not be excluded. Additional work should be performed
DISCUSSION
to confirm its diploid status, but will be complicated by the
absence of sporulation on classical medium. The absence of
Comparing Microsatellite and AFLP
sporulationcouldbeexplained,atleastinpart,bytheweakability
Genotyping ofthespeciestometabolizeglycerol,suggestingpoorrespiration
Inthispaper,wecomparedtheintraspecificclusteringusingtwo ability (sporulation being strongly linked to respiration ability
differenttechniques:AFLPandmicrosatellites.Bothapproaches in S. cerevisiae, Codon et al., 1995). Indeed, all H. uvarum
allowed discrimination at the strain level: 47 different patterns strains (except Y1614) showed unperturbed growth under
were scored for AFLP (for 47 strains), while 86 genotypes anaerobic conditions, indicating that respiratory metabolism is
wereevidencedfor115strainswithmicrosatellitedata.Indeed, notnecessaryfortheirnormalgrowth.
bothmethodsprovedtobediscriminantaspreviouslyreported Interestingly,strainIWBTY901–showing456/456identities
(Mariette et al., 2001; Gaudeul et al., 2004), with AFLP having for D1/D2 sequence with Hanseniaspora guilliermondii CBS
a higher discriminant power in our case. However, it has to 465T- was clustered among H. uvarum strains in group C.
FrontiersinMicrobiology|www.frontiersin.org 10 January2016|Volume6|Article1569