Table Of ContentHuman Molecular Genetics, 2009, Vol. 18, No. 6 1156–1170
doi:10.1093/hmg/ddn442
Advance Access published on January 6, 2009
Functional SNPs in the SCGB3A2 promoter are
associated with susceptibility to Graves’ disease
Huai-Dong Song1,2,(cid:2),{, Jun Liang3,{,{, Jing-Yi Shi1,{, Shuang-Xia Zhao1,{, Zhi Liu1,{,
Jia-Jun Zhao3,{, Yong-De Peng4, Guan-Qi Gao5, Jiong Tao1, Chun-Ming Pan1, Li Shao1,
FengCheng1,YiWang6,Guo-YueYuan7,ChaoXu1,BingHan1,WeiHuang8,XunChu8,YiChen1,
Yan Sheng1, Rong-Ying Li1, Qing Su9, Ling Gao3, Wei-Ping Jia10, Li Jin6, Ming-Dao Chen1,
Sai-Juan Chen1,2, Zhu Chen1,2 and Jia-Lun Chen1 Do
w
n
lo
1Ruijin Hospital, State Key Laboratory of Medical Genomics, Molecular Medicine Center, Shanghai Institute of ad
e
CEnednotecrrifnoorloSgyys,teSmhasnBgihoamieJdiaicoinTeo,nSgJTUUni,v8e0rs0ityDo(SnJgTCUh),uaSnchRoooaldo,fSMheadnicgihnaei,2S0h0a2n4g0h,aCih2i0n0a2,53,DCephainratm, 2eSnhtaonfghai d from
h
Endocrinology, Shandong Province Hospital, Shandong University, 324 Jing 5 Road, Jinan 250021, China, ttp
4Department of Endocrinology, The First People’s Hospital, Shanghai Jiaotong University, Shanghai 200080, China, s://a
5DepartmentofEndocrinology,ThePeople’sHospitalofLinyi,ShandongProvince,27LiberationRoad,Linyi276003, ca
d
China, 6Centre of Anthropology, Fudan University, 220 Handan Road, Shanghai 200433, China, 7Department of em
Endocrinology,HospitalofJiangsuUniversity,Zhenjiang,Jiangsu212001,China,8ChineseNationalHumanGenome ic.o
Center at Shanghai, Zhang Jiang High Tech Park, 250 Bi Bo Road, Shanghai 201203, China, 9Department of up
.c
Endocrinology,XinHuaHospital,ShanghaiJiaoTongUniversity(SJTU),SchoolofMedicine,Shanghai20092,China om
and 10Shanghai Diabetes Institute, Shanghai Jiaotong University, No. 6 Hospital, Shanghai 200233, China /hm
g
/a
ReceivedNovember14,2008;RevisedDecember22,2008;AcceptedDecember30,2008 rtic
le
-a
b
s
Graves’disease (GD)isone ofthemostcommon humanautoimmunediseases, andrecent dataestimateda tra
c
prevalenceofclinicalhyperthyroidismof0.25–1.09%inthepopulation.SeveralreportshavelinkedGDtothe t/1
8
region 5q12–q33; and a locus between markers D5s436 and D5s434 was specifically linked to GD suscepti- /6
/1
bility in the Chinese population. In the present study, association analysis was performed using a large 1
5
number of single-nucleotide polymorphisms (SNPs) at this locus in 2811 patients with GD recruited from 6/6
different geographic regions of China. The strongest associations with GD in the combined Chinese Han 13
1
cohorts were mapped to two SNPs in the promoter (pSNP) of SCGB3A2 [SNP76, rs1368408, P51.433 14
1026, odds ratio (OR)51.28 and SNP75, 2623(cid:2)2622, P57.6231025, OR51.32, respectively], a gene by
g
implicated in immune regulation. On the other hand, pSNP haplotypes composed of the SNP76 u
e
(rs1368408)1SNP74(rs6882292)orSNP761SNP75(2623(cid:2)2622,AG/T)variantsarecorrelatedwithhighdis- st o
ease susceptibility (P50.0007, and P50.0192, respectively) in this combined Chinese Han cohort. n
1
Furthermore, these haplotypes were associated with reduced SCGB3A2 gene expression levels in human 1 A
tShNyPro7i6d1tSisNsPue7,5wahnidleSfNuPnc7t6i1onSaNlPa7n4alhyaspislorteyvpeeasleidnadrrievliantgivgeelyneloewxpefrfiescsieionncy. TohfeSsCeGreBs3uAlt2spsruogmgoetsetrsthoaft tthhee pril 2
0
1
SCGB3A2 gene may contribute to GD susceptibility. 9
(cid:2)Towhomcorrespondenceshouldbeaddressed.Tel: þ862164370045Ext.610808;Fax:þ862164743206;Email:[email protected]
†Theauthorswishittobeknownthat,intheiropinion,thefirstsixauthorsshouldberegardedasjointFirstAuthors.
‡Presentaddress:DepartmentofEndocrinology,theFourthHospitalofXuzhou,JiangsuProvince,China.
# The Author 2009. Published by Oxford University Press. All rights reserved.
For Permissions, please email: [email protected]
Human Molecular Genetics, 2009, Vol. 18, No. 6 1157
INTRODUCTION RESULTS
Defining the GD susceptibility region by association
Graves’ disease (GD) is one of the most common human
analysis of a 3.0Mb region surrounding marker D5s2090
autoimmune diseases with recent data estimating frequencies
of up to 1.3% (0.5% clinical and 0.7% subclinical) in the TonarrowdowntheGDsusceptibilitylocus,westartedwitha
USA (1) and 0.25–1.09% in China (2). The hallmark of GD 3.0Mb region surrounding D5s2090, defined bya decrease in
is the production of thyroid-stimulating hormone receptor theLODscoreof1.5ormorewithan (cid:2)99%confidenceinter-
(TSHR)-stimulating antibodies, leading to hyperthyroidism. val for linkage (Fig. 1A). The NCBI database indicates that
GDisacomplextraitdiseaseanddevelopsingeneticallysus- this region, from markers D5s436 to D5s413, contains 25
ceptible individuals, which arises through the interactions genes (Fig. 1B, Supplementary Material, Table S1). Accord-
of susceptibility genes (3) and non-genetic factors, such as ingly, 179 SNPs distributed with an average space of 15Kb
infection (4). were selected from the NCBI SNP database (dbSNP) (NCBI
Many genetic studies of GD have been carried out and Human Genome Build 36.1) for genotyping of 384 GD Do
w
several genes, suchas humanleukocyte antigen (3),cytotoxic patients and 382 healthy subjects from Shandong province, n
T lymphocyte antigen 4 (CTLA-4) (5,6), CD40 gene (7), China. Data quality control (QC) filters removed 40 SNPs loa
d
PTPN22 (8), TSHR (9) and SAS-ZFAT (10) have been with minor allele frequencies (MAFs) ,1% (N¼32) or a e
d
linked to GD susceptability. However, none of these genes Hardy–Weinberg equilibrium (HWE) P(cid:3)1(cid:4)1026 in con- fro
show an absolute correlation with disease predisposition and trols (n¼8) (missing data in Supplementary Material, m
h
the exact genetic requirements for the development of GD Table S2) (15). Out of the 139 SNPs, 4 SNPs have signifi- ttp
aCrheinsetsilel HuannknGowDnp.eAdigprereesviporuosvigdeendomthee-wstirdoengsetsutdeyviodfen5c4e icnantthley GdiDffearnendtnaolrlemlealfrseuqbujeecntcsieasnd(atthPe-svtarlounege,st0a.0s0so1cilaetvieoln) s://ac
a
for linkage at D5s436 on chromosome 5q31. When four was measured for SNP rs1368408 (P¼3.69(cid:4)1025). It is d
e
additional markers around D5s436 were used, a maximum also notable that the four SNPs, including SNP rs1368408, m
ic
two-point LOD score of 4.31 and a maximum multipoint form a cluster, suggesting a locus of strong association .o
u
LOD score of 4.12 were obtained for marker D5s2090 (11). (Fig. 1C, Supplementary Material, Table S2). These results p
.c
Interestingly, from a dataset of 123 Japanese sibling pairs, lead us to further investigate a 1.0Mb region surrounding om
the 5q31 locus was also linked with autoimmune thyroid SNP rs1368408 (between SHGC-111280 and RH92492), /h
m
disease (AITD), including GD and Hashmoto’s disease, with which contains 11 genes. g
aDamtaaxfirmomumlinmkualgteipoaninatlyLsiOsDcosncdourceteodf o3n.1444a5t sDu5bsje4c3t6s f(r1o2m). /article
29 families of a homogeneous founder Caucasian population, Identification of a susceptibility gene in a 1.0Mb region -a
b
theOldOrderAmishofLancaster County,Pennsylvania,also surrounding rs1368408 stra
supports a linkage with AITD at chromosome 5q (13). Given The83SNPsintheexonsandpromotersofthe11genesinthe ct/1
theinherentinaccuraciesoflinkageanalysisinidentifyingsus- 1.0Mb region surrounding rs1368408 were identified by 8
ceptibility genes (14), it is reasonable to hypothesize that the re-sequencing. In addition, 39 SNPs in the intergenic /6/1
previouslyobservedlinkagespointtothesamelocusinvolved sequencesofthesameregion,distributedwithanapproximate 15
6
in GD predisposition. interval of 5Kb, were selected from the NCBI dbSNP. The /6
1
Inthepresentstudy,wehaveperformedassociationanalysis allele frequencies for the 122 SNPs within the 1.0Mb region 31
onalargenumberofsingle-nucleotidepolymorphisms(SNPs) were measured (Fig. 1D and E and Table 1) from 541 GD 14
to identify the putative GD susceptibility gene at the 5q31 patients and 478 normal subjects from Shandong province. by
locus in the Chinese Han population. First, we used 179 Data QC filters removed 18 SNPs from the analysis. gu
e
SanNdPsfowunitdhinthea m3.0osMt bsigrneigfiiocanntsuarrsosoucnidaitniognmsaigrknearl Dto5sb2e09a0t Ncaonttalbylyd,ifofuerteonft tahlelelreemfraeiqnuinegnc1ie0s4bSeNtwPese,n20theexhtwiboitgsrigonuipfis-, st on
SNPrs1368408.Subsequentassociationanalysiswasthenper- with P-values ,0.05 (Table 1 and Fig. 2A). Further analysis 11
formed using 122 SNPs from a 1.0Mb region surrounding of these 20 SNPs revealed that 7 are distributed in the Secre- Ap
rs1368408 for two independent populations collected from toglobin Family 3A Member 2 (SCGB3A2, also designated ril 2
Shandong province and the city of Shanghai. The results Uteroglobin-related protein 1, UGRP1) gene, including 4 in 01
9
suggested that the SNP76 (rs1368408) and SNP75 in the pro- the promoter region [pSNPs: SNP72 (21351, G/A); SNP74
moter of Secretoglobin Family 3A Member 2 (SCGB3A2) (rs6882292); SNP75 (2623(cid:2)2622, AG/T); SNP76
gene may be the causal variants of GD. Next, these results (rs1368408)], 2 in the introns [iSNPs: SNP77 (rs2278376);
were further confirmed by association analysis in 2811 SNP78 (rs3217372)] and one synonymous SNP in exon 3
Chinese Han patients with GD and 2807 healthy individuals (cSNP): SNP89 (rs34212847) (Table 1 and Fig. 2A).
recruited from different geographic regions in China. The most significant association was measured at SNP76
Finally, functional analysis in vivo and in vitro has revealed (P¼4.11(cid:4)1028) and SNP75 (P¼1.37(cid:4)1028) (Table 1
that the susceptible alleles of the SNP76, SNP75 and and Fig.2A and C). SNPswithrelatively weak,albeit signifi-
SNP74, which are located on the promoter of SCGB3A2 cant, GD associations were also detected in adjacent regions,
gene, affect the binding of transcription factors to the including the promoter/coding portions of the SPINK5
promoter of SCGB3A2 and that the SNP76þSNP75 and (2 SNPs), KIAA0555 (2 SNPs), MGC23985 (1 SNP) and
SNP76þSNP74 haplotypes are associated with lower levels SPINK1 (1 SNP) genes, and in intergenic regions (7 SNPs)
of SCGB3A2 gene expression. (Table 1 and Fig. 2A). Furthermore, in order to exclude
1158 Human Molecular Genetics, 2009, Vol. 18, No. 6
D
o
w
n
lo
a
d
e
d
fro
m
h
ttp
s
://a
c
a
d
e
m
ic
.o
u
p
.c
o
m
/h
m
g
/a
rtic
le
-a
b
s
tra
c
Figure1.Linkageandassociationanalysis,aswellasSNPsdistributionandgenecontentoftheregionbetweenmarkersD5s436andD5s413onchromosome t/1
5q31.(A)Non-parametricLODscore(NPL)sketchmapfromtheoriginalgenomescan(11).ThemultipointanalysislocalizedtheGDsusceptibilitylocusto 8
/6
withinanapproximateintervalof2cMbetweenmarkersD5s436andD5s434.ThemultipointLODscoresthroughoutthisintervalaregreaterthan3.0,witha /1
maximummultipointLODscoreof4.12atthemarkerD5s2090(11).(B)The3.0MbregionsurroundingD5s2090,definedbyadecreaseinLODscoreby1.5or 1
5
more,an(cid:2)99%confidenceintervalforlinkage,wasusedasthefocalpointofoursearchtoidentifycandidateGD-susceptibilitygenes.Theregionidentified 6/6
contains25genes.Redlinesrepresentthegeneswithforwardorientations,andbluelinesrepresentthosewithreverseorientations.Thesymbols1(cid:2)25represent 1
3
thegenenames(SupplementaryMaterial,TableS1).(C)Thegenotyperesultsofthe179SNPsselectedfromthe3.0MbregionsurroundingmarkerD5s2090 1
1
(D5s436–D5s413).FourSNPswithsignificantdifferencesattheP-value,0.001levelbetweenGDandcontrolsubjectsaremarkedin(B)witharedcross,and 4
themostsignificantGDassociationswereobservedinSNPrs1368408(P¼3.69(cid:4)1025)(seeSupplementaryMaterial,TableS2fordetailedinformation).(D) by
Thepositionsof122 SNPslocated in11geneswithinthe1.0Mbregion(frommarkerSHGC-111280toRH92492).Of these,83SNPswereidentifiedby g
u
re-sequencingthesegenesand39SNPswereselectedfromtheNCBIdbSNPinaproportionalspaceof5Kb,whicharemarkedin(D)(seeSupplementary e
s
Material,TableS1fordetailedinformation).Eachgeneisindicatedbyabox.(E)TheSNPslocatedonexon3,intronsandthe50 and30 flankingregionsof t o
theSCGB3A2gene.Atotalof38SNPswereidentifiedbyre-sequencinga15KbregionofSCGB3A2. n
1
1
A
false positives, we analyzed 20 neutral SNPs on different examined for their locations within the LD block structure, 7 p
chromosomes as genomic controls (GCs). In the population, of them were found to be distributed in the middle region, ril 2
the GC inflation factor (lgc) was 0.5351. Our statistical whereas 5 and 8 of them, with relatively weak association 01
9
results were all normalized to the GC. Notably, the above signals with GD (P-value: 0.0402(cid:2)0.0028), were found in
Mass array results were corroborated with the results of the the left and right LD blocks, respectively (Fig. 2A and
sequencing analysis for the three pSNPs of the SCGB3A2 Table 1). It was notable that all SNPs in this 1Mb region
gene(SNP76,SNP75andSNP74)intheShandongpopulation. with P-value less than 0.001 are distributed in the middle
Next, the linkage disequilibrium (LD) regions of the 104 region (Table 1 and Fig. 2A and C).
SNPs within 1.0Mb region were evaluated using the Haplo- ToidentifycausalvariantsofGDinthis1.0Mbregion,the
view program (16). Three LD regions composed of these genotype data of 104 of the 122 SNPs suitable for logistic
SNPs were observed in the Shandong population (Fig. 2A, regression analysis in the Shandong population were further
bottom panel). They were located between SNP32 and mined by logistic regression analysis (5,17) (Fig. 2D–K and
SNP39, SNP65 and SNP103, and SNP141 and SNP148, Supplementary Material, Table S3). When SNP72 (21351,
respectively (Fig. 2A, bottom panel). Interestingly, when the G/A), SNP74 (rs6882292), SNP75 (2623(cid:2)2622, AG/T),
20 SNPs with significantly different allele frequencies SNP76 (rs1368408), SNP77 (rs2278376), SNP78
between the GD and control populations in Shandong were (rs3217372) and SNP89 (rs34212847) were individually put
Table1. ThenameandlocationoftheSNPsinthe1.0Mbregionaroundrs1368408andtheresultsofassociationanalysisfortheseSNPs
SNP Description Marker Shandong Shanghai CombinedHan Position Sequencenearthe
symbols location Control Case P-value OR OR Control Case P-value OR OR Control Case P-value OR OR polymorphism
(%) (%) (95%CI) (%) (%) (95%CI) (%) (%) (95%CI)
SNP27 rs4705132 STK32A 40.19 39.53 0.7781 0.97 34.35 33.57 0.7006 0.97 146599399 GGGAGC[G/C]AACACT
SNP28 rs6894633 STK32A 33.54 32.30 0.6548 0.95 32.06 33.37 0.5351 1.06 146637662 TTCTAT[G/T]TTTACT D
SNP29 rs6580458 STK32A 40.68 39.90 0.7679 0.97 40.08 37.71 0.3782 0.91 146637777 AGATCA[T/C]GTTTTA o
SNP30 rs55936730 STK32A 6.00 6.13 0.9437 1.02 5.50 6.64 0.2177 1.22 146639268 TTGACA[C/T]AATTGC w
n
SNP31 rs6884181 STK32A 146703083 ACTTTT[C/T]AGCTGG lo
SNP32 I7-1,1113728 STK32A 40.36 37.78 0.2775 0.90 35.29 32.74 0.1698 0.89 146708589 CAAATG[C/T]TGTGCT a
d
SNP33 rs918797 STK32A 28.57 26.32 0.3571 0.90 26.77 26.51 0.8932 0.99 146708683 GAGGAT[A/G]AGTGAC e
d
SSNNPP3345 rrss31800459513731 DDPPYYSSLL33 2132..2406 2121..1006 00..55648520 00..9930 1291..7000 1284..9111 00..60056486 01..9250 114466775512914731 CATCCCTATTAT[[GG//AA]]TTTCTTACCTAG fro
SNP36 E14-2,160813 DPYSL3 23.27 19.68 0.0567 0.80 19.79 19.94 0.9244 1.01 146752641 GGGGAA[C/T]TGGGAA m
SSNNPP3387 Ir1s317-14,9172514766 DDPPYYSSLL33 2233..1321 2223..7189 00..89315189 00..9989 2108..2230 2109..6224 00..84083757 11..0027 114466775538262898 CTCCACTAAAGA[[GC//AT]]CGTTCCATGACC http
s
SSNNPP3490 rrss2925481667976 IDnPteYrgSeLn3etic 1311..5473 1218..1153 00..81002984 00..9855 1351..2027 1268..8617 00..32171622 10..1839 114466788442545292 ACTGGGCTTTTG[[GG//TA]]GAATTTAAGCAA ://a
c
SNP41 rs7716144 Intergenetic 146892300 GCAAGG[C/T]GTTCCT a
d
SNP42 rs981644 Intergenetic 40.70 38.39 0.2869 0.91 43.58 51.67 0.0010 1.38 1.14–1.68 146947379 TAGGCA[G/T]GTTAAA e
SNP43 rs3763094 KIAA0555 23.96 19.66 0.0264 0.78 0.63–0.97 26.19 31.77 0.0238 1.31 1.04–1.66 146992484 ACAGGA[C/T]GCCAGA m
SSNNPP4445 rrss32716136079656 KKIIAAAA00555555 1323..5288 369..8768 00..01558738 01..1757 3142..8394 3128..9380 00..90762459 11..0109 114467909024469669 ATGCAAAACCTA[[GA//TG]]AGTAGAGCTTGA ic.ou
SSNNPP4476 rrss17473325842073 KKIIAAAA00555555 4496..9015 4437..2042 00..07002589 01..7064 0.64–0.91 4530..5070 4477..2493 00..13122542 10..1960 114477000538914283 GGAAAGAATTCA[[AT//CT]]CATCATCATAGA p.co
SNP48 rs6895278 KIAA0555 31.95 28.49 0.0916 0.85 24.62 25.63 0.6438 1.05 147102213 TTACTA[C/T]GTGCCA m
SNP49 P1,2963 KIAA0555 147143408 NTATAG[T/C]TAGAAA /h
m
SNP50 rs6895278 Intergenetic 28.22 29.32 0.6914 1.06 28.21 24.36 0.0253 0.82 0.69–0.98 147150530 TTACTA[C/T]GTGCCA g
SNP51 rs12655012 Intergenetic 35.36 41.03 0.0203 1.27 1.04–1.55 38.18 41.81 0.0780 1.16 147156489 ATTATT[C/T]AGGTAG /a
SSNNPP5523 rrss112061569190045 IInntteerrggeenneettiicc 266..8557 326..4157 00..05099670 10..3839 1.08–1.64 264..1821 264..1753 00..52203442 01..9330 114477116672223590 TGTCATTACTAC[[AA//GG]]TTGTGTTGACTT rticle
SNP54 rs4705201 Intergenetic 30.72 34.96 0.0561 1.21 33.01 31.39 0.3696 0.93 147172314 ATGTAG[A/C]GGTTAA -a
SNP55 rs17107298 Intergenetic 16.05 18.09 0.2757 1.16 15.15 17.01 0.3043 1.15 147183226 TTATCT[A/G]AAGTTT b
s
SSSNNNPPP555786 Prrss131,81203611939235 SISnPPteIINNrgKKen11etic 11604...034503 11038...099822 000...097417047265 100...599386 1.08–2.17 1378...687028 1883...817577 000...358869397766 101...190421 111444777111989142539882552 TGTTCGTCTTTCCAACGC[[[TCC//C/TT]]]GGGACCCTGAAAGAGAGG Hum tract/1
SNP59 rs4705194 Intergenetic 4.48 5.08 0.5594 1.14 4.04 4.79 0.3359 1.20 147200067 TAAGCC[A/G]AGTGTG a 8
SSNNPP6610 rrss11356984461721 IInntteerrggeenneettiicc 84..3389 74..8446 00..79842524 01..9032 244..9529 255..8879 00..61134608 11..0350 114477221025280345 GGTCCTATCGCC[[AC//GT]]ACAGACTTTTCT nM /6/11
SSSSNNNNPPPP66662345 rrrrssss1736077820775277481289289358 IIISnnnCttteeeGrrrgggBeee3nnnAeeettt2iiiccc 11129700....36149020 21110916....99925046 0000....4220114617850457 1110....11270606 1117778....48823678 1119948....09981081 0000....0175443346791353 0111....81101806 0.66–0.99 18.93 20.32 0.1683 1.09 111144447777222213236462989388225667 CTAGCTATCTTAGCAACGTATTGA[[[AC[AA///GG/GT]]]]TCTTCACTAATCCTTAAGCAGAGA olecula 56/6131
SNP66 rs6895894 SCGB3A2 147234964 AATAAA[A/G]GTCGTT r 14
SNP67 rs6877478 SCGB3A2 5.81 6.47 0.5554 1.12 6.72 4.60 0.0448 0.67 0.45–0.99 6.43 6.11 0.5514 0.95 147235002 ATTTGC[A/G]TATGAA G b
SNP68 rs7726085 SCGB3A2 12.67 13.93 0.4289 1.12 12.15 13.65 0.3222 1.14 12.60 13.45 0.2500 1.08 147235514 TGTATA[C/T]GTATGT en y g
SNP69 rs7726552 SCGB3A2 10.20 7.92 0.2082 0.76 8.72 9.06 0.7672 1.04 9.00 9.02 0.9830 1.00 147235795 CTTGGC[A/T]TTTATA e u
SNP70 rs7727031 SCGB3A2 7.29 7.39 0.9653 0.99 6.35 6.12 0.8059 0.96 6.54 6.50 0.9512 0.99 147236113 GGCCTG[C/T]GTGGCA tic es
SNP71 P6,21664 SCGB3A2 5.25 4.13 0.2659 0.78 3.42 5.58 0.0153 1.67 1.10–2.54 3.84 4.47 0.1431 1.17 147236803 ATTTAT[A/T]TATACT s, t o
SSNNPP7732 PP45,,2211330511(cid:2)21303 SSCCGGBB33AA22 47..7395 124..3343 00..06050240 10..7970 1.30–2.42 73..3020 87..5021 10..42699(cid:4)51025 12..1484 1.61–3.69 73..4685 94..3381 00..01023750 11..2189 1.10–1.49 114477223377111664 TATACAAGTAGT[[GA/AAA]T/G2T]GCATTAATG 200 n 11
SNP74 P3,rs6882292 SCGB3A2 8.63 14.71 0.0001 1.83 1.36–2.44 5.27 5.96 0.4986 1.14 6.83 8.43 0.0041 1.26 1.09–1.45 147237749 ATTTAT[G/A]TTCCCA 9 A
SSSNNNPPP777756 IPP121-,,1r2,sr16s32262387(cid:2)48032876622 SSSCCCGGGBBB333AAA222 121150...482474 131479...668095 041...0134174(cid:4)(cid:4)311002288 121...317273 111...064173–––122...781320 1496...948509 12820...624559 000...001303614628 111...342578 11..0126––11..7885 1889...764267 121031...151992 017...0461325(cid:4)(cid:4)811002256 111...132928 111...011467–––111...354500 111444777222333878683845845 ATTCTGGATTAATAAT[GA[G[GC/A//AT]]G]ACTTCGTAAGCGCTAC ,Vol. pril 20
SNP78 I1-2,rs3217372 SCGB3A2 9.75 14.61 0.0016 1.58 1.20–2.09 9.17 13.56 0.0014 1.55 1.18–2.04 8.70 10.67 0.0033 1.25 1.09–1.44 147238737 TTTTTT[T/2]ATTTTA 1 19
8
SNP79 rs10058203 SCGB3A2 19.03 24.88 0.0896 1.41 19.74 21.52 0.4304 1.11 18.94 20.71 0.0823 1.12 147239235 GCTTCT[A/G]CCTAAG ,
SNP80 rs2116805 SCGB3A2 11.92 11.83 0.9544 0.99 10.89 11.33 0.7379 1.05 11.38 11.67 0.6778 1.03 147239598 CCTACA[A/C]TGGCAA N
SNP81 I1.3,11454 SCGB3A2 7.21 8.90 0.2027 1.26 6.41 9.55 0.0146 1.54 1.09–2.19 8.40 9.82 0.0341 1.19 1.03–1.38 147239920 CACATG[C/A]ATGTGT o
.
SNP82 I1.4-1,11779 SCGB3A2 11.35 12.44 0.4452 1.11 8.54 11.23 0.0427 1.35 1.01–1.82 10.12 11.61 0.2018 1.17 147240245 AAGGCT[C/T]ACCATC 6
SNP83 rs13355689 SCGB3A2 147240275 TCCTAA[C/T]GGTTCC
SNP84 I1.4-2,11939 SCGB3A2 5.36 6.49 0.3037 1.23 6.20 4.97 0.2119 0.79 5.44 6.10 0.5167 1.13 147240405 CATGTT[A/G]GAATTA
SNP85 rs6859234 SCGB3A2 11.86 11.67 0.8998 0.98 10.35 9.87 0.7062 0.95 11.67 11.36 0.8300 0.97 147240931 ATGACG[A/G]AGAGTG 1
SNP86 rs41291429 SCGB3A2 12.67 12.76 0.9549 1.01 11.64 14.15 0.0918 1.25 11.19 12.03 0.2283 1.09 147240961 CTTCTC[C/T]GAGGAG 1
5
SNP87 rs6859391 SCGB3A2 147241008 AGAAAG[C/G]TAAGTA 9
Continued
Table1.Continued
1
1
SNP Description Marker Shandong Shanghai CombinedHan Position Sequencenearthe 60
symbols location Control Case P-value OR OR Control Case P-value OR OR Control Case P-value OR OR polymorphism
(%) (%) (95%CI) (%) (%) (95%CI) (%) (%) (95%CI)
H
SNP88 rs3910207 SCGB3A2 147241677 GTTTCC[C/T]CATCAG u
SNP89 E3-1,rs34212847 SCGB3A2 6.99 11.97 0.0003 1.81 1.32–2.47 7.25 8.83 0.1653 1.24 8.05 9.54 0.0110 1.20 1.05–1.37 147241803 CTTGGT[G/A]TGACAT m
SNP90 rs3843496 SCGB3A2 28.85 28.56 0.8912 0.99 26.02 26.12 0.9536 1.01 27.94 28.49 0.5728 1.03 147242005 CCAGAT[C/T]AGTTTT an
SNP91 rs3910183 SCGB3A2 11.85 12.21 0.8031 1.03 9.38 12.01 0.0535 1.32 10.67 11.44 0.2396 1.08 147242108 CTCTAA[G/T]TTAAAC M D
SNP92 3U1-1,13679 SCGB3A2 2.89 2.51 0.6245 0.86 2.56 4.06 0.0682 1.61 2.88 2.85 0.9413 0.99 147242145 ATCTCA[T/C]GGTGTT o
SNP93 rs17107376 SCGB3A2 11.59 12.24 0.6651 1.06 11.16 10.71 0.7626 0.96 11.07 11.38 0.6520 1.03 147242413 TTTCCT[C/T]TACTCT ole wn
SNP94 rs61012413 SCGB3A2 11.46 11.95 0.7441 1.05 10.94 10.15 0.5557 0.92 11.24 11.34 0.8866 1.01 147243151 CACCTA[C/G]TTGACT c lo
SSNNPP9956 rrss640700450250541 SSCCGGBB33AA22 3.99 4.32 0.7465 1.09 5.48 4.63 0.4249 0.84 6.03 5.83 0.7105 0.97 114477224433633406 CCATTTTACTAT[[CG//TT]]TACTTGGCTAGT ula ade
r d
SSSNNNPPP999789 rrrsss111777111000777333778890 SSSCCCGGGBBB333AAA222 111331...114890 111321...184885 000...989947613877 101...090070 111021...860893 111610...139185 000...049005098567 100...589789 1.22–2.03 111130...343891 111220...674568 000...067739526172 101...190342 111444777222444333778381145 TTTCTAACGTCAATTTTG[[[AAA///GGC]]]AGCTGTGCAATACCAATG Gen from
SSNNPP110001 rrss717701806733581 SSCCGGBB33AA22 178..0515 271..2311 00..18597129 11..1093 178..0815 179..7675 00..14213287 10..1897 1180..8295 2100..4110 00..08821893 10..1908 114477224443881604 CTCCTATTTCCA[[CG/T/T]]GCCCCATTAACC etic http
SSNNPP110023 rrss11051904766646 SInCteGrgBe3nAet2ic 259..1468 279..6946 00..08555254 11..5022 269..3406 297..2926 00..83542036 01..9079 10.08 10.27 0.7830 1.02 114477224457495293 TAGCTTAAGAAT[[AC//CG]]AACACGACTTGG s,20 s://ac
SNP104 rs1549204 Intergenetic 16.22 14.74 0.4823 0.89 16.60 17.17 0.7005 1.04 147251658 AAAATT[A/C]TTTGTG 0 a
9 d
SNP105 rs2250145 MGC23985 36.34 38.51 0.3311 1.10 35.86 36.89 0.5930 1.05 147266247 CTGTCT[C/T]AGTACT , e
SNP106 rs1432974 MGC23985 22.21 23.95 0.4041 1.10 20.64 22.72 0.2342 1.13 147266805 GAAGGT[A/G]TCACAA V m
SSSSNNNNPPPP111100017890 Prrrsss2917,61725514132440581888290 MMILnOtGGeCrCCg3e229n331e998t88i3c559 43519...683509 34268...688339 000...001301037102 010...844175 01..6174––01..9980 3116..3536 1355..2939 00..80459219 01..9388 111144447777222266787700662977060766 CAAGAGGACCGGGCAAGAAATGGA[[[[AGAC////GAGT]]]]GTCATCAACTCAACGAAAGACATC ol.18, ic.oup.co
SNP111 rs721570 LOC391839 32.26 35.83 0.1257 1.17 39.38 38.46 0.6864 0.96 147283244 TCATTA[A/G]AGGAAA N m
SNP112 rs1153084 Intergenetic 8.78 7.14 0.2466 0.80 147304359 CCCTGA[A/G]CCTTCA o. /hm
SNP113 rs11958481 Intergenetic 12.68 10.87 0.3542 0.84 9.80 9.17 0.6025 0.93 147307881 AGTCAT[G/T]AGAAAA 6 g
SNP114 rs1432973 Intergenetic 21.33 20.17 0.6221 0.93 25.07 26.43 0.4501 1.07 147311055 ATGCTA[A/G]GATGAT /a
SSNNPP111156 rrss74772025401467 IInntteerrggeenneettiicc 10.07 5.86 0.0603 0.56 10.48 10.77 0.8234 1.03 114477332124728273 AAGAATGCCGCA[[AG//CT]]GCTTCAAAGTCT rticle
SNP117 rs7703202 Intergenetic 147323729 CCATTG[C/T]TCTGTG -a
SNP118 rs1432978 Intergenetic 45.77 43.10 0.2593 0.90 49.60 53.50 0.0615 1.17 147328074 ATTCTG[A/T]GAAGTT b
s
SSNNPP111290 rrss4926713854912 IInntteerrggeenneettiicc 331..2371 245..3613 00..03332337 01..7363 0.59–0.97 312..8519 345..0042 00..01816699 11..1568 114477333348756860 TTGCTGTTCACG[[GC//TT]]TGTGCTAGAATT trac
SNP121 rs1363525 Intergenetic 35.63 35.15 0.8362 0.98 31.95 26.46 0.0060 0.77 0.63–0.93 147363753 GGTTTT[C/T]CTGTGT t/1
SNP122 rs2161337 Intergenetic 38.42 39.07 0.7863 1.03 34.94 34.56 0.8427 0.98 147370184 GACTCA[A/G]TGATAC 8
SSNNPP112243 rrss24048201008951 IInntteerrggeenneettiicc 8.50 12.16 0.0176 1.49 1.08–2.05 4110..4794 466..4422 00..00104961 10..2527 10..0347––10..4847 114477338797441948 CACACTCATTGA[[CA//TG]]CTATACCTGAAA /6/11
SNP125 rs7700964 Intergenetic 4.81 4.64 0.9176 0.96 5.01 4.21 0.3467 0.83 147391761 CCTACA[C/T]CTCTTT 56
SNP126 rs7703112 Intergenetic 147397943 GAAATA[A/G]TTTAAT /6
SNP127 rs17775074 Intergenetic 20.79 16.22 0.0152 0.74 0.58–0.94 17.92 15.05 0.0775 0.81 147411105 TGCTCT[A/G]TGGCTT 13
SNP128 rs7706528 Intergenetic 21.85 16.22 0.0029 0.69 0.55–0.88 17.89 14.24 0.0220 0.76 0.60–0.96 147417300 TACATA[C/T]GGTGAG 1
1
SNP129 rs2895729 Intergenetic 5.64 6.25 0.5716 1.11 147421180 CATACA[C/T]GTACAA 4
SNP130 rs2287771 SPINK5 22.36 25.33 0.1488 1.18 25.22 25.13 0.9624 1.00 147425205 CCTTCA[T/C]GTTAAT b
y
SNP131 rs2303062 SPINK5 147460200 TCTTCT[A/G]TCTCGG g
SNP132 rs2303063 SPINK5 147460220 TTTGCA[G/A]TGAATA u
e
SNP133 rs2303064 SPINK5 48.61 46.60 0.3809 0.92 51.31 47.19 0.0353 0.85 0.73–0.99 147460273 GAGAAC[G/A]ATCCTA s
SNP134 rs2303065 SPINK5 44.49 44.14 0.8771 0.99 40.03 48.98 0.0001 1.44 1.19–1.73 147460305 AGTGCA[T/C]GGCAAC t o
SSNNPP113356 rrss22330033006678 SSPPIINNKK55 4445..8403 4474..5381 00..26622289 10..1926 4415..4639 4467..8817 00..03260877 11..2049 1.03–1.50 114477446611124181 GCCATACGCGAT[[GA//AG]]CAAAATCCTACA n 11
SNP137 rs4349706 SPINK5 46.33 40.99 0.0197 0.80 0.67–0.96 44.64 47.35 0.3165 1.12 147496791 CCCCAG[T/C]TCTGAA A
SSNNPP113389 rrss23300838016943 SInPteINrgKen5etic 4458..8993 4500..8190 00..06227451 01..8025 0.68–0.98 4439..1211 4542..0846 00..60679408 11..0146 114477459068955950 AGGAAGCAAATC[[CA//GG]]TACTCCACCTCA pril 2
SNP140 rs2287770 Intergenetic 147519728 AGGTGA[C/T]GCTGAA 0
1
SNP141 rs6881658 SPINK5L2 49.22 47.63 0.5029 0.94 47.19 43.05 0.0595 0.85 147528521 AACCTT[T/G]CATAGT 9
SNP142 rs6895745 SPINK5L2 49.02 46.48 0.2854 0.90 48.76 44.11 0.0221 0.83 0.71–0.97 147528541 GAACTT[G/C]CAATCA
SNP143 rs4705055 SPINK5L2 48.46 46.57 0.4198 0.93 48.87 43.93 0.0112 0.82 0.70–0.96 147528612 AGAGCA[C/T]ATCAGC
SNP144 rs4269285 SPINK5L2 49.33 47.61 0.4600 0.93 47.69 46.72 0.6422 0.96 147529356 AATGGG[T/C]GGAGTA
SNP145 rs17096690 MGC21394 34.17 38.37 0.1137 1.20 35.19 28.81 0.0125 0.75 0.59–0.94 147562510 AATATA[A/G]GAATCA
SNP146 rs10477364 MGC21394 6.27 7.11 0.5192 1.14 6.55 9.07 0.0569 1.42 147566982 CATTTC[A/G]TATCTC
SNP147 rs9325091 LOC402232 23.33 22.59 0.7546 0.96 21.56 17.40 0.0079 0.77 0.63–0.93 147602376 AAGGAC[A/T]ACCAGG
SNP148 rs1023714 LOC402232 22.82 22.33 0.8401 0.98 21.55 18.95 0.0964 0.85 147604459 ATTCAG[A/T]TCTTAA
TheP-valueswithboldlettersindicatethoseallelefrequencieswithsignificantdifferencesbetweenGDandnormalsubjects.BlankinlineofP-valueindicate40SNPswithMAF,1%oraHWE
P(cid:3)1(cid:4)1026incontrolsremovedfromanalysis.
Human Molecular Genetics, 2009, Vol. 18, No. 6 1161
D
o
w
n
lo
a
d
e
d
fro
m
h
ttp
s
://a
c
a
d
e
m
ic
.o
u
p
.c
o
m
/h
m
g
/a
rtic
le
-a
b
s
tra
c
t/1
8
/6
/1
Figure2.TheresultsoftheassociationandlogisticregressionanalysisforSNPslocatedinthe1MbregionaroundSNPrs1368408intheShandong,Shanghai, 1
5
andthecombinedHanpopulations.Atotalof122SNPslocatedinthe1MbregionaroundSNPrs1368408weregenotypedinallsubjectsfromShandongand 6
Shanghai.AfterremovaloftheSNPswithMAFs,1%orHWEP(cid:3)1(cid:4)1026inthecontrols,theSNPscase–controlassociationsplotted[2log10(P-value) /61
3
againstlocationinmegabase]andSNPslinkagedisequilibrium(LD)regionanalysisfortheShandong(A)andShanghai(B)arepresentedin(A)and(B).The 1
1
SNPsfromtheSCGB3A2regionthathavestrongassociationswithGDaremarkedwithintheredverticallines.ThemostsignificantlyassociatedSNPsare 4
locatedintheSCGB3A2geneintwoindependentstudies,withthesmallestP-valuesof1.37(cid:4)1028and1.46(cid:4)1025inShandong(topportionofA)andShang- b
y
haipopulations(topportionofB),respectively(Table1fordetailedinformation).TheLDregionsoftheseSNPsinthe1.0MbregionwereanalyzedwithHaplo- g
u
viewsoftwareintheShandong(bottomportionofA)andShanghaipopulations(bottomportionofB).ThreeLDblockscomposedoftheseSNPsareobservedin e
s
thesetwoindependentpopulations(bottomportionofAandB).TheyarelocatedbetweenSNP32andSNP39,SNP65andSNP103,andSNP141andSNP148, t o
respectively.TheSNPsintheSCGB3A2genearemarkedbytherectangle.(C)The38SNPslocatedinthe15.0KbregionofSCGB3A2weregenotypedin2811 n
casesubjectswithGDand2807controlssubjectsinthecombinedChineseHanpopulation.Thecase–controlassociationplots[2log10(P-value)]fortheSNPs 11
locatedinthe15KbregionweremagnifiedinShandong,ShanghaiandthecombinedChineseHanpopulationin(C).(D–K)Twolocuslogisticregression A
p
panuatliynsdeisviodfuSalNlyP7in5to(2th6e2r3e(cid:2)gr2es6si2o2n,mAGod/Tel)saansdthSeNbPe7s6tm(rsa1k3e6rs84in08t)heinSSChGaBnd3oAn2gg(eDn–e,Ga)nadnadllthoethceormmbainrkeedrsHwaner(eHs–eqKu)enptoipalullyataiodndse.dStNoPs7ee5iafnadsSeNcoPn7d6lwoceures ril 2
0
couldimprovethemodel.IntheShandongpopulation,8ofthe104SNPssuitableforlogisticregressionanalysisimprovedthemodelwithSNP75(D)and 1
9
eightmarkersimprovedthemodelwithSNP76(F),attheP-value ,0.01level.Incontrast,wetestedaregressionmodelbytakingeachoneof104lociin
turnandaddingthetestlocustoit.AllthemarkerscouldbeimprovedbyaddingSNP75(E)orSNP76(G)(seeSupplementaryMaterial,TableS3fordetailed
information).Moreover,inthecombinedHanpopulation,6ofthe33SNPssuitableforlogisticregressionanalysisimprovedthemodelwithSNP75(H)and10
markersimprovedthemodelwithSNP76(J),attheP-value,0.01level.Incontrast,whenwetestedaregressionmodelbytakingeachoneofthe33lociinturn
andaddingthetestlocustoit,allthemarkerscouldbeimprovedbyaddingSNP75(I)orSNP76(K)(seeSupplementaryMaterial,TableS4fordetailedinfor-
mation).
intotheregressionmodelsasthebestmarkerfortheregionof contribute to the susceptibility of GD because their mutation
SCGB3A2, only SNPs in the other three regions could frequencies are lower in the GD group than in the control
improve these models, with a cut-off P-value ,0.01 group (Table 1). Next, we tested the regression model by
(SNP47, SNP53; SNP107; and SNP128, respectively) taking each one of the 104 loci in turn and adding the
(Fig. 2D and F and Supplementary Material, Table S3). testing locus to it. Interestingly, the majority of the markers
However, the SNP47, SNP107 and SNP128 are unlikely to could be improved by adding each of the SNPs in
1162 Human Molecular Genetics, 2009, Vol. 18, No. 6
%CI) 04481144748226 708068365484 SSCNGP8B93)A(2Sugpepnleem(SeNntPa7ry2,MSNatPe7ri4a,l,STNaPb7le5,SS3NaPn7d6,FSigN.P27E8aanndd
R(95 67–4.27–2.64–5.02–2.17–4.57–0.01–0. 10–2.52–0.15–1.03–1.00–1.70–0. GSN).PI5n3,coanttraast,Po-nvlaylu1e6oSfNPlesmsotdhealns c0o.u0l1d b(eSuipmppleromveendtabryy
O 1.1.1.1.1.0.0. 1.0.1.1.1.0.
Material, Table S3). These results suggested that SNP53 was
R 607789583668060321726539182477 %. not likely to be the causal variant, owing to the very limited
O 2.1.2.1.2.0.0.1.1.1.0.1.1.1.0. 2 impactontheoverallmodelofSNPs,andtheweakassociation
n
25 24 24 25 27 25 28 tha weobserved for thisSNP was probablydue toLDwithcausal
P-value 31.111037.041031.31100.03920.013534.041032.67100.87810.25640.015737.23100.00070.01920.044831.3510 aremore vSSaNNrPPias7n5tsi(n2res6tih2de3in(cid:2)gS2CinG62tBh23e,AAS2GC/GTreB)g3aioAren2,prroSegbNiaoPbn7l.y6Wth(eirtshm13roe6sg8ta4irm0d8p)toortaatnhndet
s for the susceptibility to GD because they improve the model
e
Percent 7.309.984.715.362.6859.610.185.398.315.0675.735.208.903.7873.90 frequenci wtahniedthSFaNignP.ys2oEonfeanSodCfGG1B0).43HASo2NwP(eSsv,ueprwp,ilttehhmestehenetraelrsoyuwlMtessatdtoePr-invaola,tluTreeajbeaclmetotSnhg3e Download
CaseNumber 7910851582964524874456742574401873655 swhose preogsBisoeibncialauictsyteinmthcuaolttmipmbleiunlSattiNipolPnestmoSNainyPcsarecatlsoiencatctheoedmribsiinknaottfihoeGnDtSo.CiGncBre3aAs2e ed from
Percent 2.945.881.683.471.1668.382.945.246.993.0082.783.807.623.0678.68 haplotype tgchoeennetrrioswklegorrefoudinpisvseewassteeirg,eahtcaeopdmloaptnyadpreetdsh.eoIinfrttfhhreeeqSpuNoepnPucsliaeotsniointnhoethfSeSChGGaDnBd3oaAnn2dg https://ac
ControlNumber 2856163311651286384369952004011614140 nhereare aPfolrlromhvaienpdcloeft,ryo7pmhesa9p(lTSoaCtybGpleeBs23)wA.i2FthivSaeNfoPrefsqtahuneedsnecayhcacopoflumontotyerpdeestfhosarhno(cid:2)2w%8e5d%wseiogref- ademic.ou
89 show nthifiecacnotnlytrohligghreorufpre.quAesncsihesowamnoinngiTnadbivleidu2a,lsthweithhGapDlottyhpane p.com
SNP 010000001000100 data 000101110 displayed the highest statistical difference (P¼ /hm
P77SNP78 100010010101010 alsubjects.All 0tc01ro10.a1n00s1tt00,r11(cid:4)oh11lsa001p000tlh102oat5(ny(,PPpOie¼n¼R0G7012.D0.0.360410p0(cid:4),a0(cid:4)C1t0i0e01I2n001t24s.w,64O(7,aPs–RO¼4mR1.0o.474r2.7e)0.,,84fCf9ro(cid:4),eIlqlC1o1u.w0I2e2n7e1t5d–.l,6y2b4O.yo4–Rb85hs).ae.01pr.I16vnl)o8ectd,yaonCpninde-I g/article-abstra
SN 100010110101010 orm 0.57–0.82) (Table 2). Notably, all the haplotypes with close ct/1
n associations with GD contained one or two variants of the 8
P76 and SNP76, SNP75 or SNP74 alleles (Table 2). /6/11
N D Atthesametime,areplication studywasperformedin545 5
S 111110011101110 G patients and 603 normal subjects from Shanghai, a metropoli- 6/6
n 1
P75 wee tancityinChinawheremanyindividualscomefromdifferent 311
s SN 011000001000100 bet regions and have multiplex founders. After 16 SNPs were 4 b
aplotypesindifferentpopulation peSNP72SNP73SNP74 001100000000010000000001100010000001100010000 eswithsignificantdifferences r1pnc(1S(qer2a0oi.uCs6mnn6pe2G11etnu2o3–SBclw7va0ayN3s8e3te1s.di3APrd6oo(cid:2)e7is9nc2ff62]riffhao)oeaatm1runi(gedao3nTanenn0dltadncyhd3bieeisef,fnls,iofesSeauAbtNrnhn(eAenaT1edPtnalw)Aay7tSm.ibes8/nCdl2eieeIsiGdnnts()htbtrB1,rpeesyi3ar3bPSaetpA2udniNsr¼e1tatd2oiniP7tonmatg137Fnsge.76oQil4ang2ypt6eCne.),ard,,t(cid:4)(2tfirwoetBchshlrf1o1itanrte0n3edhatsrh2te6nsrtii8d5ohssn(,4lie1SsgCg0tO5Nnmhe8i))nRien.P),fio,estO2scSw2t4ah[f.nosSSi4anoittNNn4ghiung,noPPtfdhtirs77Chfioeeae37efI---i, y guest on 11 April 2019
A2h plotyP71 otyp pendent populations (Table 1). We noticed that SNP76
B3 HaSN 000010000100010 apl (rs1368408), the nucleotide variant with the most significant
G h association signal in the Shandong population, also exhibited
C e
Table2.FrequenciesofS PopulationSNPno. ShandongSNP74SNP75 SNP76 Other ShanghaiSNP74SNP75SNP76OtherCombinedHanSNP74SNP75SNP76Other Boldlettersindicatethos (1i(SstvnhTTi0eNgaaar1nnPsbb0tui7hllfi0seei6enc1a111a2nh1n4))ct.e.0d.ol9ay,nIA5lrnttwe%rhlhlolaytai,hlgstsoeehiPfdmneSdr(¼othPhihravaaee1p¼ilnsdl.leef2gour0l0htaeey.ral0qe(cid:4)psi1usferu5epc1senl7oo0qtct,slp2uoluiee3nnsOcln,tfatrceReitoOirnideonrdResngidf1,vlryi.1io7nsod.mu2n4uss,pl7uacya,glSestCgphioCeetwaIninsInbeittgteis11hldhhi..ta11wayGi60tpihDtlt––(oaoh212tt0tyG..hG87.tp4Dha50De9ne)),.
Human Molecular Genetics, 2009, Vol. 18, No. 6 1163
Table3. Falsepositivereportprobability(FPRP)valuesforeightSNPswithsignificantdifferencebetween2811patientswithGDand2807healthindividuals
SNPsymbols Description Oddsratio(95%CI) ReportedP-value Statisticalpower Priorprobability
underrecessivemodela 0.25 0.1 0.01 0.001 0.0001 0.00001
SNP72 P5,21351 1.28(1.10–1.49) 0.0035 0.980 0.004 0.013 0.128 0.596 0.937 0.993
SNP74 P3,rs6882292 1.26(1.09–1.45) 0.0041 0.993 0.004 0.011 0.112 0.559 0.927 0.992
SNP75 P2, –623(cid:2)–622 1.32(1.16–1.50) 7.62(cid:4)1025 0.975 0.000 0.000 0.002 0.021 0.175 0.680
SNP76 P1,rs1368408 1.28(1.17–1.40) 1.43(cid:4)1026 1.000 0.000 0.000 0.000 0.000 0.001 0.007
SNP77 I1-1,rs2278376 1.19(1.04–1.35) 0.0158 1.000 0.020 0.058 0.405 0.873 0.986 0.999
SNP78 I1-2,rs3217372 1.25(1.09–1.44) 0.0033 0.994 0.006 0.018 0.166 0.667 0.953 0.995
SNP81 I1.3 1.19(1.03–1.38) 0.0341 0.999 0.060 0.161 0.679 0.955 0.995 1.000
SNP89 E3-1,rs34212847 1.20(1.05–1.37) 0.0110 1.000 0.021 0.059 0.409 0.875 0.986 0.999
D
aStatisticalpoweristhepowertodetectanoddsratioof1.5forthehomozygoteswiththeraregeneticvariant,withanalevelequaltothereported o
w
P-value.FPRPvaluesbelow0.2areinboldface. n
lo
a
d
e
d
To further confirm the associations of the SCGB3A2 var- ferred susceptibility to GD, particularly when they existed in fro
iants with GD susceptibility, the 15Kb region containing the haplotypes of SNP76 and SNP75 or SNP76 and SNP74 m
h
SCGB3A2 gene and its 50 and 30 flanking regions were com- (Table 2). ttp
pletely re-sequenced. A total of 38 SNPs were found in this The false positive report probability (FPRP) of the SNPs s://a
gene, with 13, 12 and 13 SNPs distributed in the exons and with significant association with GD in the combined c
a
introns, and 50 as well as 30 flanking regions of SCGB3A2, Chinese Han cohorts was also analyzed. In the present d
e
m
respectively. Subsequent association analyses of the 38 SNPs study,foreachgeneticvariant,theFPRPvaluewascalculated
ic
residing in and around the SCGB3A2 gene were performed usingtheassignedpriorprobabilityrange,thestatisticalpower .o
u
from 2811 patients with GD and 2807 healthy individuals, to detect an odds ratio (OR) of 1.5 and detected ORs and p.c
which were collected from Jiangsu, Henan, Anhui and P-values. As showed on the Table 3, among the eight om
Fujian Province, along with samples collected from the Shan- genetic variants with a significant difference between the /h
m
dong and Shanghai populations; all subjects were from the patients with GD and healthy individuals, the FPRP values g
/a
C1h(cid:4)in1e0s2e6Hainn pcoopnutrloaltsio,no.fExthcleudrienmga5inSinNgPs33witShNHPsWEinPth(cid:3)e o0f.25fivteoS0N.0P1s, wwehriechbewloaws a0.r2elfaotrivtehlye phriigohr pprrioobrabpirloitbyabfirloitmy rticle
SCGB3A2 region, 8 had significant frequency differences in range. However, the FPRP values for the SNP76 and SNP75 -ab
s
the patients with GD compared to healthy individuals in the were very low even for low prior probabilities, since the tra
combined Han population. Similarly, the most significant FPRP value remains below 0.2 even for a prior probability ct/1
differences between the GD patients and controls were of 0.0001 (0.001 and 0.175, respectively). This relationship 8
/6
measuredforSNP76andSNP75,whicharelocatedinthepro- was especially true for the SNP76, as the FPRP value was /1
moter of SCGB3A2 (P¼1.43(cid:4)1026 and 7.62(cid:4)1025, 0.007 even for a prior probability of 0.00001 (Table 3). Inter- 15
6
respectively) (Table 1 and Fig. 2C). Interestingly, in the estingly,thecase–controlstudyfortheseeightSNPswithsig- /6
1
Chinese Han cohorts recruited from different geographic nificant differences between the 2811 patients with GD and 31
1
regions of China, four haplotypes with frequencies higher 2807 healthy individuals have more than 97% statistical 4
b
than 2% were formed from nine SCGB3A2 SNPs and power to detect a SNP with an a level equal to their reported y
g
accounted for more than 90% of all haplotypes (Table 2). P-value, corresponding to relative risks of 1.5 for GD u
e
Threeofthesehaplotypeshadsignificantlyhigherfrequencies (Table 3). st o
among patients with GD than the control group. Notably, n
1
similar to the results from the Shandong population studies, 1
The pSNPs (SNP76, SNP75 and SNP74) most strongly A
the haplotypes of the SNP76 (rs1368408, G/A)þSNP74 p
(rs6882292, G/A) (000101110) or SNP76þSNP75 aSsCsoGcBia3tAed2wexitphreGssDioanre also correlated with lower ril 20
(2623(cid:2)2622, AG/T) (010011001) variants also correlated 1
9
with high disease susceptibility in the combined Chinese Since the GD-associated SNP haplotypes are located in the
Han cohort (P¼0.0007 and P¼0.0192, respectively) SCGB3A2 promoter, a region that contains relatively well-
(Table 2). In contrast, haplotype 000000000 was more fre- conserved transcription factor binding sites (Fig. 3), we
quently observed in the control group than in GD patients hypothesized that these pSNPs may affect the expression of
(P¼1.35(cid:4)1028, OR 0.77, CI 0.70–0.84) (Table 2). More- SCGB3A2. To test this, seven SCGB3A2 promoter/luciferase
over, the results of logistic regression analysis (Fig. 2H–K reporter constructs were made and transfected into HeLa and
and Supplementary Material, Table S4) of the combined SPC-A1 cells, which are human cervical carcinoma and lung
Chinese Han cohorts also suggested that pSNPs in the carcinoma cell lines, respectively (Fig. 4A and B). As
SCGB3A2gene,SNP76andSNP75,werethestrongestdeter- showninFigure4,theluciferaseactivitiesofpGL3-(SNP76þ
minantsinthesusceptibilityofGDbecausetheyimprovedthe SNP75), pGL3-(SNP76þSNP74) and pGL3-(SNP76þ
model when combined with any one of the other 33 SNPs SNP75þSNP74) were decreased in both HeLa and SPC-A1
(Fig. 2H–K and Supplementary Material, Table S4). All the cells, relative to other haplotypes (Fig. 4A and B). The
results strongly suggested that the SNP76 and SNP75 con- co-transfection of thyroid transcription factor-1 (TTF-1)
1164 Human Molecular Genetics, 2009, Vol. 18, No. 6
D
o
w
n
lo
a
d
e
d
fro
m
h
ttp
s
://a
Figure3.SequenceconservationandtranscriptionfactorbindingsitesneartheSNP76,SNP75andSNP74,aspredictedbythewebsiteofUCSC(http://genome. ca
ucsc.edu/)andusingtheAlibaba2.1software,respectively.Inthehumansequence,twoTTF-1,oneNFkBandoneC/EBPabindingsitenearSNP76,andone de
TTF-1motifadjacenttoSNP75,werepredicted.InthepresenceofpSNPs,theC/EBPanearSNP76disappears,whileaTBPbindingsiteappearsatthepositions m
ic
ofSNP75andSNP74.ThebrokenlinesindicatetheputativeTBPbindingsitesalleleswiththeSNP75orSNP74. .o
u
p
.c
o
m
increased the overall luciferase activity levels, while the rela- fragment length polymorphism (RFLP) located at SNP /h
m
tive influence of the pSNPs on reporter gene expression rs34212847 (SNP89) in exon 3 of the SCGB3A2 gene g
remained unchanged. Next, using electrophoretic mobility (Fig. 4F). As shown in Figure 4Fc, the intensities of the 380 /a
shiftassays(EMSAs),weaskedwhethertheGDsusceptibility and 253bp bands represented the SCGB3A2 mRNA levels rticle
alleles of the SNP76, SNP75 and SNP74 affected the binding transcribed from the GD-susceptible haplotype T:A:A and -a
b
of transcription factors to the SCGB3A2 promoter. Two main the non-susceptible haplotype AG:G:G at the corresponding stra
bands,IandII,wereidentifiedintheEMSAswitheachofthe positions (SNP75, SNP76 and SNP89 SNPs). Because the c
SNP76, SNP75 and SNP74 SNP probes after incubation with intensities of the bands depend on the lengths of the digested t/18
nuclear extracts of SPC-A1 cells. Compared to probes for RT–PCR products from ASTQ, when the mRNA transcribed /6/1
alleles not linked to GD, the SNP76 and SNP75 probes pro- from the two alleles are equal, the ratio of the intensities 15
6
duced one band of stronger intensity (Fig. 4C), whereas one betweenthe380bpbandandthe253bpbandshouldtheoreti- /6
1
band produced by the SNP74 probe was less intense cally be greater than 1:1. In fact, when equal amounts of the 3
1
(Fig. 4C). In addition, use of unlabeled AG and T allele ASTQ products amplified from the lung tissue of six individ- 1
4
probes to compete for the labeled AG allele probe of uals with homozygous AG:G:G alleles were separated on an b
y
SNP75, showed that the T allele was better able to compete agarose gel, with or without MaeIII digestion, the actual g
u
e
forbindingofAGallelewithbandII.Thisdataalsosuggested ratio of intensities between the 380bp band and the 253bp s
thatthesusceptiblealleleTofSNP75hadhigherbindingaffi- band was 2.1+0.4 (mean+SD) (Fig. 4Fb). However, the t on
nity with the transcription factor band II than the non- ratio of the ASTQ bands derived from thyroid tissues of five 11
susceptible allele AG (Fig. 4C, right panel). individuals with heterozygosity at the SNP75, SNP76 and A
p
We next sought to determine if the differential promoter SNP89 positions was 0.9+0.2 (mean+SD) (Fig. 4Fc), ril 2
activity associated with the GD-linked SNPs is also seen in which was significantly lower than what was measured in 0
1
thyroid tissue. Samples of thyroid tissue were collected from individual homozygous for non-susceptible alleles (P, 9
93 patients in the Shandong province with thyroid adenoma 0.001). These results suggested that SCGB3A2 mRNA levels
or multinodular goiter but not hyperthyroidism. The werelowerinindividualswiththeGD-susceptiblehaplotype.
expression of the SCGB3A2 gene in the thyroid tissue
samples derived from patients with SNP76þSNP75 and
SNP76þSNP74 alleles was significantly lower than it was in The expression pattern of SCGB3A2 and its receptor
samples from patients with wild-type alleles (P¼0.047 and MARCO gene in human and mouse
0.027, respectively) (Fig. 4D and E). The effect of these With regard to the SCGB3A2 gene expression, it was pre-
SNPs on SCGB3A2 transcription was further confirmed viously reported that the highest mRNA level was observed
using allele-specific transcript quantification (ASTQ) (5). in the human lung by the northern blot analysis, whereas
TherelativecontributionofeachhaplotypetoSCGB3A2tran- low expression was also detected in human thyroid tissue
scriptproductioninfivesamplesofthyroidtissuefromhetero- (18). In the present study, using RT–PCR analysis, we con-
zygous individuals was evaluated using a Mae III restriction firmed that the mRNA of SCGB3A2 was expressed at high
Human Molecular Genetics, 2009, Vol. 18, No. 6 1165
D
o
w
n
lo
a
d
e
d
fro
m
h
ttp
s
://a
c
a
d
e
m
ic
.o
u
p
.c
o
m
Figure 4. The effect of SNPs on SCGB3A2 expression in in vitro and in vivo analyses. Relative luciferase activities of the reporter plasmids containing /h
SCGB3A2promoterregionswithdistinctpSNPcombinationandawild-typecontrolweredetectedinSPC-A1(A)andHela(B)celllines.Openandfilled m
barsrepresentco-transfectionwithorwithouta plasmidexpressingthegeneforthyroidtranscription factor-1(TTF-1).Luciferaseactivitiesarenormalized g/a
a(pcGcoLr3d-inBgastioc)pinRLeaOcharcetipvoirtyte,ragnednerealsastaivye.Tluhceifreersausletsaacretivthiteya(vfeorladg)eisofetxhprreeessineddepbeanseddenotnextpheeriimndenutcstipoenr-ffoorlmderdeliantitvreipltiocatthee.Ttrhaensbfaercstiionndicoafteemthpetystavnedcatordr rticle
error.(C)Bindingaffinityofnuclearfactorstothe25(cid:2)50bppromoterregionsaroundtheSNP76,SNP75andSNP74ofSCGB3A2.The25(cid:2)50bpoligonucleo- -a
tides,includingwildandmutationallelesoftheSNP76,SNP75andSNP74ofSCGB3A2,werelabeledwith[g-32P]dATP.Arrowsindicatethebandsofthe bs
EMSAsusingeachoftheSNP76,SNP75andSNP74probesincubatedwithnuclearextractsfromSPC-A1cells.TopandbottomarrowscorrespondtobandIand tra
c
bandII,respectively.LWPandNLWP:thelabeledandunlabeledwild-typeprobes,respectively;LMPandNLMP:labeledandunlabeledmutantprobes,respect- t/1
ively; NP: extracted nuclear protein. (D) The expression levels of SCGB3A2 in thyroid tissues with haplotype SNP76þSNP75 (n¼11) were significantly 8
decreasedbasedonrealtimeRT–PCRanalysis,ascomparedwiththosedevoidofSNP76,SNP75orSNP74(n¼16).(E)ComparisonofSCGB3A2gene /6/1
expressionwithSNP76þSNP74haplotype(n¼5)andwild-typehaplotypes.(F)Allele-specificASTQofSCGB3A2usingtheMaeIIIRFLPlocatedatthe 1
5
position SNP89 (rs34212847) G/A in exon 3 of RNA (cDNA) derived from thyroid tissues of five heterozygous individuals at the SNP75, SNP76 and 6
SNP89positions(Fb).Relativecontributionsofthesusceptible(SNP75T2SNP76A2SNP89A)andnon-susceptible(SNP75AG2SNP76G2SNP89G)haplo- /61
typestoSCGB3A2expressionarepresentedasaSNP89A(380bp)toG(253bp)ratio.ThesmallersizedbandsfromtheSNP89Gallele(127bp)arenot 31
includedincalculatingtheratio,owingtotheirweakintensities.Asaresult,insixcontrolsampleshomozygousfortheSNP89Gallele(Fc),themeanratio 14
ofintensitybetweenthe380bpbandandthe253bpbandwas2.1:1,insteadofthetheoreticalratioof1:1. b
y
g
u
e
level in lung tissues in both mouse and human, though low SNP75). Furthermore, the results of the logistic regression s
t o
level transcripts were also present in thyroid and kidney in analysis in the combined Chinese Han cohorts suggested that n
human, and adrenal gland, thymus, brain, muscle and skin in these two SNPs were probably the causal variants because 11
mice (Fig. 5A). Recently, the macrophage scavenger receptor they improved the model when combined with any one of Ap
withcollagenousstructure(MARCO)proteinwasidentifiedas the other 33 SNPs in SCGB3A2 gene. Interestingly, in our ril 2
a receptor for SCGB3A2 (19). Interestingly, we found that study cohorts that were recruited from different geographic 01
9
MARCO was expressed in a wide range of tissues, including regions of China, three of haplotypes showed significantly
immunity-related ones such as spleen, thymus, lymph node higher frequencies among patients with GD than those in the
and liver by semi-quantitative RT–PCR analysis (Fig. 5B). control individuals. However, the haplotypes contributing to
the susceptibility of GD were different in two subsets, the
Shandong and Shanghai populations. The haplotypes of the
DISCUSSION
SNP76 (rs1368408, G/A)þSNP74 (rs6882292, G/A)
Ourcase–controlstudyof2811GDpatientsand2807healthy (000101110) or SNP76þSNP75 (2623(cid:2)2622, AG/T)
individualsusingalargenumberofSNPslocatedinthe5q12– (010011001) variants were correlated with high-disease sus-
q33region,whichislinkedtoGD,hadidentifiedandvalidated ceptibility in the Shandong subset, and the significant asso-
a new gene (SCGB3A2) associated with GD. A significant ciation between the haplotype of SNP76þSNP73
association between GD with several SNPs in the SCGB3A2 (21301(cid:2)21303, AAA/2)þSNP71 (21664, A/T)
gene was identified, with the strongest associations mapped (101001110) and GD collected from Shanghai subset was
to SNPs in the SCGB3A2 promoter (pSNP) (SNP76 and identified. These results were similar to the observation in
Description:Tech Park, Shanghai 201203, China 9Department of Endocrinology, Xin Hua homogeneous founder Caucasian population, the Old Order Amish of by the web site of UCSC (http://genome.ucsc.edu/) and using the Alibaba 2.1.