Table Of ContentThis is a special edition of an established title widely used by colleges and
GLOBAL GLOBAL
universities throughout the world. Pearson published this exclusive edition
for the benefit of students outside the United States and Canada. If you
EDITION EDITION
purchased this book within the United States or Canada, you should be aware EG
DL
that it has been imported without the approval of the Publisher or Author. ITO
IOB
A
NL
E
s
The bestselling Essentials of Genetics successfully tackles the challenge of providing s
e
beginners with content that is truly essential for an introduction to this complex n
subject. With its concise yet thorough approach, the text builds conceptual t
i
a
understanding and problem-solving skills through practical applications.
l
s
The tenth edition has been updated to provide a comprehensive coverage
o
of modern and emerging topics such as CRISPR-Cas, epigenetics, and genetic
f
testing. Two Special Topics chapters—Advances in Neurogenetics: The Study
G
of Huntington Disease and Genetic Testing—have been added to this edition.
e
n
Key Features e
t
i
• The Evolving Concept of the Gene is a unique feature integrated into c
s
key chapters, which highlights how scientists’ understanding of the gene has
evolved over time.
• The latest ethical considerations have been explored in the essay feature,
E
Genetics, Ethics, and Society. DT
E
I
TN
• Updated case studies at the end of each chapter link the coverage of formal
IOT
H
genetic knowledge to everyday societal issues. N
Mastering Genetics, available separately for purchase with this book, is a
teaching and learning platform that empowers instructors to personalize learning
K
for every student. When combined with trusted educational content, Mastering Essentials of Genetics
l
u
Genetics helps deliver optimal learning outcomes for students and instructors. g
•
•
P
C
a
ll u
a m
d
i m TENTH EDITION
n
o i
n
• g
s
K
• Klug • Cummings • Spencer • Palladino • Killian
ill S
ia p
n e
n
c
e
r
CVR_KLUG0424_10_GE_CVR.indd 1 22/05/20 5:04 PM
EVOLVING CONCEPT OF THE GENE
The Evolving Concept of the Gene is a unique feature, integrated into key chapters,
which highlights how scientists’ understanding of the gene has changed over time.
By underscoring how the conceptualization of the gene has evolved, our goal is
to help students appreciate the process of discovery that has led to an ever more
sophisticated understanding of hereditary information.
CHAPTER 3 pg. 66 Based on the pioneering work of CHAPTER 18 pg. 383 Based on the work of the ENCODE
Gregor Mendel, the gene was viewed as a heritable unit fac- project, we now know that DNA sequences that have previously
tor that determines the expression of an observable trait, or been thought of as “junk DNA,” because they do not encode pro-
phenotype. ■ teins, are nonetheless often transcribed into what we call noncod-
ing RNA (ncRNA). Since the function of some of these RNAs is
CHAPTER 4 pg. 82 Based on the work of many geneticists now being determined, we must consider whether the concept
following the rediscovery of Mendel’s work in the very early of the gene should be expanded to include DNA sequences that
part of the twentieth century, the chromosome theory of inher- encode ncRNAs. At this writing, there is no consensus, but it is
itance was put forward, which hypothesized that chromo- important for you to be aware of these current findings as you
somes are the carriers of genes and that meiosis is the physical develop your final interpretation of a gene. ■
basis of Mendel’s postulates. In the ensuing 40 years, the con-
cept of a gene evolved to reflect the idea that this hereditary CHAPTER 15 pg. 319 The groundbreaking work of Jacob,
unit can exist in multiple forms, or alleles, each of which can Monod, and Lwoff in the early 1960s, which established the
have an impact on the phenotype in different ways, leading operon model for the regulation of gene expression in bacte-
to incomplete dominance, codominance, and even lethality. ria, expanded the concept of the gene to include noncoding
It became clear that the process of mutation was the source regulatory sequences that are present upstream (5′) from the
of new alleles. ■ coding region. In bacterial operons, the transcription of sev-
eral contiguous structural genes whose products are involved
CHAPTER 7 pg. 160 Based on the gene-mapping studies in in the same biochemical pathway is regulated in a coordinated
Drosophila and many other organisms from the 1920s through fashion. ■
the mid-1950s, geneticists regarded genes as hereditary units
organized in a specific sequence along chromosomes, between CHAPTER 13 pg. 278 In the 1940s, a time when the molecu-
which recombination could occur. Genes were thus viewed as lar nature of the gene had yet to be defined, groundbreaking
indivisible “beads on a string.” ■ work of Beadle and Tatum provided the first experimental evi-
dence concerning the product of genes, their “one-gene:one-
enzyme” hypothesis. This idea received further support and
CHAPTER 9 pg. 199 Based on the model of DNA put forward
was later modified to indicate that one gene specifies one
by Watson and Crick in 1953, the gene was viewed for the first
polypeptide chain. ■
time in molecular terms as a sequence of nucleotides in a DNA
helix that encodes genetic information. ■
CHAPTER 12 pg. 260 The elucidation of the genetic code in
the 1960s supported the concept that the gene is composed
of a linear series of triplet nucleotides encoding the amino acid
sequence of a protein. While this is indeed the case in bacteria
and viruses, in 1977, it became apparent that in eukaryotes,
the gene is divided into coding sequences, called exons, which
are interrupted by noncoding sequences, called introns (inter-
vening sequences), which must be spliced out during produc-
tion of the mature mRNA. ■
CVR_KLUG0424_10_GE_IFC_IBC.indd 1 15/05/20 12:43 PM
ESSENTIALS
GENETICS
of
Tenth Edition
Global Edition
William S. Klug
The College of New Jersey
Michael R. Cummings
Illinois Institute of Technology
Charlotte A. Spencer
University of Alberta
Michael A. Palladino
Monmouth University
Darrell J. Killian
Colorado College
A01_KLUG0424_10_GE_FM.indd 1 22/05/2020 7:03 am
Courseware Portfolio Manager: Michael Gillespie Art Coordinators: Stephanie Marquez and Mark Mykytiuk,
Director of Portfolio Management: Beth Wilbur Imagineeringart.com, Inc.
Content Producer: Brett Coker Design Manager: Maria Guglielmo Walsh
Managing Producer: Michael Early Interior Designer: Tamara Newnam
Courseware Director, Content Development: Ginnie Simione Jutson Cover Designer, Global Edition: SPi Global
Courseware Editorial Assistant: Ashley Fallon Rights & Permissions Project Manager: Pearson CSC, Eric Schrader
Acquisitions Editor, Global Edition: Moasenla Jamir Rights & Permissions Management: Ben Ferrini
Associate Project Editor, Global Edition: Aurko Mitra Photo Researcher: Pearson CSC, Eric Schrader
Senior Manufacturing Controller, Global Edition: Manufacturing Buyer: Stacey Weinberger, LSC Communications
Caterina Pellegrino Director of Field Marketing: Tim Galligan
Digital Producer: Wendy Romaniecki Director of Product Marketing: Allison Rona
Rich Media Content Producer: Robert Johnson Executive Field Marketing Manager: Kelly Galli
Media Production Manager, Global Edition: Vikram Kumar Product Marketing Manger: Alysun Estes
Full-Service Vendor: Pearson CSC Cover Photo: aida ricciardiello/Shutterstock
Full-Service Project Management: Pearson CSC, Heidi Aguiar
Attributions of third party content appear on page C-1, which constitutes an extension of this copyright page.
Pearson Education Limited
KAO Two
KAO Park
Hockham Way
Harlow
Essex
CM17 9SR
United Kingdom
and Associated Companies throughout the world
Visit us on the World Wide Web at: www.pearsonglobaleditions.com
© William S. Klug and Michael R. Cummings 2021
The rights of William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A. Palladino, and
Darrell J. Killian to be identified as the authors of this work, have been asserted by them in accordance
with the Copyright, Designs and Patents Act 1988.
Authorized adaptation from the United States edition, entitled Essentials of Genetics, 10th Edition,
ISBN 978-0-13-489841-4 by William S. Klug, Michael R. Cummings, Charlotte A. Spencer, Michael A.
Palladino, and Darrell J. Killian, published by Pearson Education ©2020.
All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or
transmitted in any form or by any means, electronic, mechanical, photocopying, recording or otherwise,
without either the prior written permission of the publisher or a license permitting restricted copying
in the United Kingdom issued by the Copyright Licensing Agency Ltd, Saffron House, 6–10 Kirby Street,
London EC1N 8TS. This publication is protected by copyright, and permission should be obtained from
the publisher prior to any prohibited reproduction, storage in a retrieval system, or transmission in any
form or by any means, electronic, mechanical, photocopying, recording, or otherwise. For information
regarding permissions, request forms, and the appropriate contacts within the Pearson Education Global
Rights and Permissions department, please visit www.pearsoned.com/permissions/.
All trademarks used herein are the property of their respective owners. The use of any trademark in this
text does not vest in the author or publisher any trademark ownership rights in such trademarks, nor does
the use of such trademarks imply any affiliation with or endorsement of this book by such owners.
This eBook is a standalone product and may or may not include all assets that were part of the print
version. It also does not provide access to other Pearson digital products like MyLab and Mastering.
The publisher reserves the right to remove any material in this eBook at any time.
British Library Cataloguing-in-Publication Data
A catalogue record for this book is available from the British Library
ISBN 10: 1-292-35042-3
ISBN 13: 978-1-292-35042-4
eBook ISBN: 978-1-292-35054-7
Typeset by SPi Global
A01_KLUG0424_10_GE_FM.indd 2 02/06/2020 14:32
Focus on essential genetic topics and
explore the latest breakthroughs
Known for its focus on conceptual understanding, problem solving, and practical
applications, the bestselling Essentials of Genetics strengthens problem-solving
skills and explores the essential genetics topics that today’s students need
to understand. The 10th Edition has been extensively updated to provide
comprehensive coverage of important, emerging topics such as CRISPR-Cas,
epigenetics, and genetic testing and Mastering Genetics includes new tutorials
on these topics, which prepare students for class and support the learning of key
concepts.
A01_KLUG0424_10_GE_FM.indd 3 22/05/2020 7:03 am
Make genetics relevant . . .
NEW! Regulation
16 of gene expression
has been expanded
and is now divided into
coverage of bacteria
Regulation of
in Chapter 15 and
Gene Expression in
coverage of eukaryotes
Eukaryotes in Chapter 16.
CHAPTER CONCEPTS
■■While transcription and translation are
tightly coupled in bacteria, in eukary-
otes, these processes are spatially and
temporally separated, and thus inde- Chromosome territories in a human fibroblast cell nucleus. Each
pendently regulated. chromosome is stained with a different-colored probe.
■■Chromatin remodeling, as well as
modifications to DNA and histones,
play important roles in regulating gene
expression in eukaryotes.
■■Eukaryotic transcription initiation Virtually all cells in a multicellular eukaryotic organism contain a
requires the assembly of transcrip- complete genome; however, such organisms often possess differ-
tion regulatory proteins on DNA sites ent cell types with diverse morphologies and functions. This simple
known as promoters, enhancers, and observation highlights the importance of the regulation of gene expression
silencers. in eukaryotes. For example, skin cells and muscle cells differ in appearance
■■Following transcription, there are sev- and function because they express different genes. Skin cells express kera-
eral mechanisms that regulate gene tins, fibrous structural proteins that bestow the skin with protective prop-
expression, referred to as posttranscrip- erties. Muscle cells express high levels of myosin II, a protein that mediates
tional regulation. muscle contraction. Skin cells do not express myosin II, and muscle cells do
■■Alternative splicing allows for a single not express keratins.
gene to encode different protein iso- In addition to gene expression that is cell-type specific, some genes are
forms with different functions. only expressed under certain conditions or at certain times. For example,
■■RNA-binding proteins regulate mRNA when oxygen levels in the blood are low, such as at high altitude or after
stability, degradation, localization, and rigorous exercise, expression of the hormone erythropoietin is upregulated,
translation. which leads to an increase in red blood cell production and thus oxygen-
■■Noncoding RNAs may regulate gene carrying capacity.
expression by targeting mRNAs for Underscoring the importance of regulation, the misregulation of genes P. 326
destruction or translational inhibition. in eukaryotes is associated with developmental defects and disease. For
■■Posttranslational modification of pro- instance, the overexpression of genes that regulate cellular growth can
teins can alter their activity or prom2o9te8 lead1 t5o u nRcoengtroullledA cteiloluNlar o prfo lgifeerNateio ne, xa hpaRllemsarski oof Nca niNce rB. TAhcerteefoRreiA,
their degradation. understanding the mechanisms that control gene expression in eukaryotes
is of great interest and may lead to therapies for human diseases.
Coverage of Streptococcus thermophilus CRISPR locus
CRISPR-Cas
302 Repeats
is expanded GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC
and Leader
iMn16_KtLUGe841g4_10r_SEa_C1t6.inedd d302 14/09/2018 13:58
in multiple
chapters – Spacer 1 Spacer 3
Chapters 1, 15, GAGCTACCAGCTACCCCGTATGTCAGAGAG TAGATTTAATCAGTAATGAGTTAGGCATAA
(Streptococcus phage 20617) (Streptococcus phage TP-778L)
17, and Special Spacer 2
TTGAATACCAATGCCAGCTTCTTTTAAGGC
Topics Chapters
(Streptococcus phage CHPC1151)
ST3 and ST6.
FIGURE 15.13 A cRispR locus from the bacterium Streptococcus thermophilus (lMg18311).
spacer sequences are derived from portions of bacteriophage genomes and are flanked on
either side by a repeat sequence. only 3 of 33 total spacers in this cRispR locus are shown.
P. 322
description of repeated DNA sequences with nonrepetitive genes encode a wide variety of Cas proteins such as DNases,
spacer sequences between them. Since then, CRISPR loci RNases, and proteins of unknown function. The CRISPR-Cas
have been identified in ∙50 percent of bacteria species mechanism includes three steps outlined in Figure 15.14.
and in ∙90 percent of archaea, another type of prokaryote
1. The first step is known as spacer acquisition. Invading
(Figure 15.13). The spacers remained a mystery until 2005
phage DNA is cleaved into small fragments, which are
when three independent studies demonstrated that CRISPR
directly inserted into the CRISPR locus to become new
spacer sequences were identical to fragments of phage
spacers. The Cas1 nuclease and an associated Cas2 pro-
genomes. This insight led to speculation that viral sequences
tein are required for spacer acquisition. New spacers are
within CRISPR loci serve as a “molecular memory” of previ-
inserted proximal to the leader sequence of the CRISPR
ous viral attacks.
locus, with older spacers being located progressively more
A01_KLUG0424_10_GE_FM.indd 4 The first experimental evidence that CRISPRs are impor- 22/05/2020 7:03 am
distal. When new spacers are added, repeat sequences are
tant for adaptive immunity came from an unexpected place.
duplicated such that each spacer is flanked by repeats.
Danisco, a Danish food science company, sought to create a
strain of Streptococcus thermophilus that was more resistant 2. In the second step, CRISPR loci are transcribed, starting
to phage, thus making it more efficient for use in the produc- at the promoter within the leader. These long transcripts
tion of yogurt and cheese. Philippe Horvath’s lab at Danisco, are then processed into short CRISPR-derived RNAs
in collaboration with others, found that when they exposed (crRNAs), each containing a single spacer and repeat
S. thermophilus to a specific phage, bacterial cells that sur- sequences (on either or both sides). This step is called
vived became resistant to the same phage strain, but not to crRNA biogenesis.
other phage strains. Furthermore, the resistant bacteria pos-
3. The third step is referred to as target interference.
sessed new spacers within their CRISPR loci with an exact
Mature crRNAs associate with Cas nucleases and recruit
sequence match to portions of the genome of the phages by
them to complementary sequences in invading phage
which they had been challenged.
DNA. The Cas nucleases then cleave the viral DNA, thus
Next, the Horvath lab showed that deletion of new spac-
neutralizing infection.
ers in the resistant strains abolished their phage resistance.
Remarkably, the converse was also true; experimental inser- In short, CRISPR-Cas is a simple system whereby bacteria
tion of new viral sequence-derived spacers into the CRISPR incorporate small segments of viral DNA into their own genome
loci of sensitive bacteria rendered them resistant! and then express them as short crRNAs that guide a nuclease
to cleave complementary viral DNA. Thus, CRISPR-Cas uses
viral DNA sequences to specifically fight that same virus.
The CRISPR-Cas Mechanism for RNA-Guided
While the three steps of the CRISPR-Cas mechanism are con-
Destruction of Invading DNA
served across bacterial species, the molecular details and Cas
Studies from several labs have elucidated the mechanism proteins involved are varied. For example, the well-studied
underlying the bacterial adaptive immune system. In addi- CRISPR-Cas system of Streptococcus pyogenes uses a single
tion to the CRISPR loci, adaptive immunity is dependent on nuclease called Cas9 for target interference while many other
a set of adjacent CRISPR-associated (cas)genes. The cas species require a large complex of Cas proteins.
M15_KLUG8414_10_SE_C15.indd 298 10/11/18 1:22 AM
with current high interest topics
SPECIAL TOPICS IN MODERN GENETICS 2 NEW! Special
Topics chapter on
Genetic Testing
Genetic Testing
guides students
through the many
contexts in which
genetic testing is
Earlier in the text (see Chapters 17 and 18), we dystrophy. Other tests have been developed for disorders that
reviewed essential concepts of recombinant DNA may involve multiple genes such as certain types of cancers. becoming prominent
technology and genomic analysis. Because of the Gene tests are used for prenatal, childhood, and adult and explores many
Human Genome Project and related advances in genomics, prognosis and diagnosis of genetic diseases; to identify car-
researchers have been making rapid progress in identifying riers; and to identify genetic diseases in embryos created by questions and ethical
genes involved in both single-gene diseases and complex in vitro fertilization, among other applications. For genetic
concerns related to its
genetic traits. As a result, genetic testing—the ability to testing of adults, DNA from white blood cells is commonly
analyze DNA, and increasingly RNA, for used. Alternatively, many genetic tests can use.
the purposes of identifying specific genes or be carried out on cheek cells, collected by
“Genetic testing,
sequences associated with different genetic swabbing the inside of the mouth, or on hair
conditions—has advanced very rapidly. including genomic cells. Some genetic testing can be carried out
Genetic testing, including genomic analysis by DNA on gametes.
analysis by DNA sequencing, is transform- sequencing, is trans- What does it mean when a genetic test
ing medical diagnostics. Technologies for is performed for prognostic purposes, and
X forming medical
PIC goenn tehtei cd itaegsntionsgis hoaf vdeis ehaasde amnadj oarr ei mrepvaocluts- diagnostics. Technolo- hproowg ndoosetsi cth teiss td pifrfeedr ifcrtosm a pae drisaognn’os sltikice tleihsto?o Ad
O tionizing medical treatments based on the gies for genetic test- of developing a particular genetic disorder. P. 474
AL T dmeavceeluoptimcaelns.t Ionf tshpiesc Sifpice cainadl Tefofpeicctsiv ceh pahpaterr- iminpgac htsav oen h tahde mdiaajgonr o- Aid ednitaigfineoss ati pc atretsict ufloarr am guetanteitoinc ocro ngdeniteitoinc
CI we provide an overview of applications change that causes theS diPseEasCe oIrA conLd itTioOn. PICS IN MODERN GENETICS 4
PE that are effective for the genetic testing of sis of disease and are Sometimes a diagnostic test identifies a gene
S children and adults and examine histori- revolutionizing medical or mutation associated with a condition,
Advances in Neurogenetics: The Study
cal and modern methods. We consider the treatments based on but the test will not be able to determine
impact of different genetic technologies on the development of whether the gene or mutation is the ocaufse Huntington Disease
the diagnosis of human diseases and dis- of the disorder or is a genetic variation that
specific and effective
ease treatment. Finally, we consider some results from the condition.
of the social, ethical, and legal implications pharmaceuticals.”
of genetic testing.
NEW! Special A ST s2 t.h2e r esPurlte onf gartouanld Gbreeankiengt iacd vTaenscetsi inn gm olec- know about the molecular and cellular mechanisms associ-
Topics chapter to Suclarre geenne tficos ra nCd ogennodmiticiso mnasde since the 1970s, ated with the disorder, particularly those discovered during
ST 2.1 Testing for Prognostic new fields in genetics and related disciplines have the study of transgenic model systems. Finally, we will con-
on Advances in
or Diagnostic Purposes emeArlgtehdo.u Ognhe g neenwet fiice tleds itsi nnge oufr aodguelntse itsi cins—crtehaes isntugd, oyv oefr t thhee passti der how this information is being used to develop a range
Neurogenetics: gentewtico bdaescisa odfe ns omrmorael agnedn aebtinco tremstailn fgu nhcatsio bneineng ouf stehde ntoe rd-etecot f therapies.
vous system, with emphasis on brain functions. Research in
TheG eSnettiuc tedstiyng woasf on e of the first successful applications of thisg feienledt iinc cclounddeist tihone sg einne bsa absiseosc itahtaend wini tahd nuelutsr.o Idne gneenwebrao-rns, a
recombinant DNA technology, and currently more than 900 simple prick of a baby’s heel produces a few drops of blood
Huntetstis nareg in tusoe thnat taDrgeits a sepeacifsic egen,e or sequence. Increas-tivet dhiasto radreer us,s wedit hto t hceh uelctkim thatee n geowalb oofr dne vfoelro mpianng ye fgfeecnteivteic dis-
therapies to combat these devastating conditions. Of the ST 4.1 The Search for the Huntington
ingly, scientists and physicians can directly examine an indi- orders. In the United States, all states now require genetic
explvoidrueal’ss DhNAo fwor m gutaetinones atsisocc iated with disease, including manteys stuincgh, doifsteeans ceas,l liendc lnuedwinbgo rAnl zschreeiemneinrg d, ifsoera scee,r tPaairnk mine-dicaGl ene
son disease, and amyotrophic lateral sclerosis (ALS), Hun-
analtyhrsoiusg hh DNaAs s eiqnuefnocinrgm, ase wde w ill discuss in Section ST 2.5. conditions (the number of diseases screened for is set by
tington disease (HD) stands out as a model for the genetic
These tests usually detect gene alterations associated with the individual state, see Box 1). There are currently abouMt apping the gene for Huntington disease was one of the
sciensitngilset-gsen ae dbisoorduerts . tBhut,e on ly about 3900 genes have been imnvoen6so0tgi cgeoanntiicdo iantn ioodfn 1ns0e tu0hr apoted crecagenen nbte epr adetneitevetecr datenisdto,, rabdluetthr sno.ue Nagorhlt y mo anallnly ay in so aift- t hesefi rst attempts to employ a method from a landmark 1980
disealinskeed’ sto scuachu dissoerdse,r s. Examples include sickle-cell anemia, lyticteasl tasp dpertoeaccth perso itne imnos loerc uoltahre gre mneettiacbs ohlaitvees b aenedn asurec cneosst -DNAp- aper by Botstein, White, and Davis in which the authors SP
stTyroempaiptc4cy5mts0sto icce mfhinbrasots,p.i sa,At Henulnrld tsiSn gfiptnuoenct dcluiuisearadesle e , h e mophilia, and muscular ficptuhrsloa lsogyriHgarr ane cDRptsie fNspiirisclAvii azaee-nend bdbc atae ebsou haey ttasd oh ava sgedi omeo usmnrtloautead ltdol ei cnycdlh sfotooeaemfrtns HttiognhsfeD. aesd,sn, e evtif andidnlciiiselsdeudoaad rtasdiiennnesdggr. wo“foaDtdrhievedirn rtgoh awrodpiru tolhgep ohamsd eadyin t hga t DNdfrkAreenas tsogetewrmcqitncueetdn eia notassncs e p dr erviefnoafsdzertiuyrraemictcneiteocdiesn ob.ssn y iTin n chf t ruhehatusetgem ilm nedangeni gnfDstfth eNc r ooAleuef n nDlwdcgNie bttsAhhe, ECIAL TOP
Mat0h2 As_aKeLUtrG 8ih4e14e_s10l _poSE_ fSs T0tq2u.inuddd e 4e5s0ntitosn s utwinvitceho d ndetecraloitnlhlee o,d ca cmnudro rvpiensmygc ewhniittasht ri(nicc h 1do0ir stetoua )1r,b5 ca yonegcanersis-, tforo Amm Eaagsatnhsaemt1tp0,/1 t3wo/18ne 2 :41 AMifpzooerld ya m udsoiisrncpguh sSissoimountsh o(eRfr RnF LFbPLlosP)tss,, c(aosneudel dCC bhheaa ppvttieesrru a11l78- IC 4
after symptoms appear. HD was one of the suddenly came upon for a discussion of Southern blots). The
review key ideas or first examples of complete dominance in two women, mother authors estimated that a collection of about
150 RFLPs distributed across the genome
facilitate personal human inheritance, with no differences in and daughter, both
could be used with pedigrees to detect link-
contemplations and perhoeznyogtoytpeess. bInet wtheee nv ahsotm moazjyogroitteys oafn cda hseest-, bowing, twisting, age anywhere in the genome between an
grimacing. I stared in RFLP marker and a disease gene of interest.
group discussions, sOyvmerpatlolm, Hs Ddo c nuorrt ednetvleyl oapff uecnttsi la abboouutt 2a5ge,0 4050. wonderment, almost In practical terms, this meant that it would
and are assignable in to 30,000 people in North America. in fear. What could it be possible to map a disease gene with no
information about the gene, its gene prod-
Mastering Genetics. The disease is named after George mean?” uct, or its function—an approach referred
Huntington, a nineteenth-century physician.
to as reverse genetics.
He was not the first to describe the disorder,
but his account was so comprehensive and detailed (see Box 1) P. 506
that the disease eventually took on his name. Further, his Finding Linkage between Huntington Disease
observation of transgenerational cases in several families and an RFLP Marker
precisely matched an autosomal dominant pattern of inheri- In the early 1980s, Huntington disease research was largely
tance. Shortly after the rediscovery of Mendel’s work in the driven by the Hereditary Disease Foundation, established
early twentieth century, pedigree analysis confirmed that by the family of Leonore Wexler, who, along with her three
HD is inherited as an autosomal dominant disorder. brothers, died of Huntington disease. One daughter, Nancy,
We will begin our consideration of Huntington disease after learning about the proposal to map disease genes using
by discussing the successful efforts to map, isolate, and clone DNA markers, used her awareness of a large population
the HD gene. We will then turn our attention to what we affected with Huntington disease in Venezuela to organize
1
A01_KLUG0424_10_GE_FM.indd 5 22/05/2020 7:03 am
M04A_KLUG8414_10_SE_ST04.indd 1 11/10/2018 07:20
Explore the latest ethical
considerations
6.9 fRAGIlE SITES IN HUMAN CHROMOSOMES ARE SUSCEPTIBlE TO BREAkAGE 117
Genetics, Ethics,
G E N E T I C S, E T H I C S, A N D S O C I E T Y and Society essays
provide synopses of
Down Syndrome and Prenatal Testing—The New Eugenics? ethical issues related
to current findings in
D
own syndrome is the most particular genetic outcomes for their movement provides us with a power- genetics that impact
common chromosomal abnor- offspring. ful cautionary tale about the potential directly on society
mality seen in newborn babies. In the early to mid-twentieth century, misuses of genetic information.
Prenatal diagnostic tests for Down syn- countries throughout the world adopted today. They include a
drome have been available for decades, eugenic policies with the aim of enhanc-
especially to older pregnant women who ing desirable human traits (positive Your Turn section called Your Turn,
have an increased risk of bearing a child eugenics) and eliminating undesirable Take time, individually or in groups, which directs students
with Down syndrome. Scientists estimate ones (negative eugenics). Many coun- to consider the following ques-
that there is an abortion rate of about tries, including Britain, Canada, and tions. Investigate the references to related resources
30 percent for fetuses that test positive the United States, enacted compulsory and links to help you discuss some of the
of short readings and
for Down syndrome in the United States, sterilization programs for the “feeble- ethical issues surrounding genetic testing
and rates of up to 85 percent in other minded,” mentally ill, and criminals. The and eugenics. websites to support
parts of the world, such as Taiwan and eugenic policies of Nazi Germany were
France. particularly infamous, resulting in forced 1. Do you think that modern prenatal deeper investigation
Some people agree that it is morally human genetic experimentation and the and preimplantation genetic testing and discussion of the
acceptable to prevent the birth of a slaughter of tens of thousands of people followed by selective abortion is
genetically abnormal fetus. However, with disabilities. The eugenics movement eugenic? Why or why not? main topic of each essay.
others argue that prenatal genetic was discredited after World War II, and
For background on these questions, see
testing, with the goal of eliminating the evils perpetuated in its name have
McCabe, L., and McCabe, E. (2011).
congenital disorders, is unethical. In tainted the term eugenics ever since.
Down syndrome: Coercion and eugenics.
addition, some argue that prenatal Given the history of the eugenics
Genet. Med. 13:708–710. Another useful dis-
genetic testing followed by selective movement, is it fair to use the term
cussion can be found in Wilkinson, S., (2015).
abortion is eugenic. How does eugenics eugenics when we speak about genetic
Prenatal screening, reproductive choice,
apply, if at all, to screening for Down testing for Down syndrome and other
and public health. Bioethics 29:26–35.
syndrome and other human genetic genetic disorders? Some people argue
disorders that it is not eugenic to select for healthy 2. If genetic technologies were more
The term eugenics was first defined by children because there is no coercion, advanced than today, and you could
Francis Galton in 1883 as “the science the state is not involved, and the goal choose the traits of your children,
which deals with all influences that is the elimination of suffering. Others would you take advantage of that
improve the inborn qualities of a race; point out that such voluntary actions option? Which traits would you
also with those that develop them to still constitute eugenics, since they choose—height, weight, intellectual
the utmost advantage.” Galton believed involve a form of bioengineering for abilities, athleticism, artistic talents?
that human traits such as intelligence “better” human beings. If so, would this be eugenic? Would it
and personality were hereditary and Now that we are entering an era of be ethical?
that humans could selectively mate unprecedented knowledge about our
with each other to create gifted groups genomes and our predisposition to ge- To read about similar questions answered
of people—analogous to the creation netic disorders, we must make decisions by groups of Swiss law and medical students,
of purebred dogs with specific traits. about whether our attempts to control read Elger, B., and Harding, T., (2003).
Galton did not propose coercion but or improve human genomes are ethical Huntington’s disease: Do future physi-
thought that people would volun- and what limits we should place on cians and lawyers think eugenically? Clin.
tarily select mates in order to enhance these efforts. The story of the eugenics Genet. 64:327–338.
50 3 Mendelian Genetics P. 141
Case Studies at CASE STUDY to test or not to test
the end of each T
homas discovered a devastating piece of family history 1. If they seek genetic counseling, what issues would likely be
chapter have been when he learned that his brother had been diagnosed with discussed? Which of these pose grave ethical dilemmas?
updated with new Huntington disease (HD) at age 49. This dominantly inher- 2. If you were in Thomas’s position, would you want to be tested
ited autosomal condition usually begins around age 45 with pro- and possibly learn that you were almost certain to develop the
topics. Students can gressive dementia, muscular rigidity, and seizures and ultimately disorder sometime in the next 5–10 years?
leads to death when affected individuals are in their early 60s. There
read and answer currently is no effective treatment or cure for this genetic disorder. 3. If Thomas tests positive for the HD allele, should his children
be told about the situation, and if so, at what age? Who
questions about a short Thomas, now 38, wonders what the chances are that he also has should make the decision about having the son and daughter
inherited the mutant allele for HD, leading him to discuss with his
tested?
scenario related to one wife whether they should seek genetic counseling and whether he
should undergo genetic testing. They have two teenage children, a Fulda, K., and Lykens, K. (2006). Ethical issues in predictive genetic
of the chapter topics. boy and a girl. testing: A public health perspective. J. Med. Ethics 32:143–147.
M06_KLUG8414_10_SE_C06.indd 117 19/09/2018 22:47
Each Case Study links
P. 74
the coverage of formal
genetic knowledge
INSIGHTS AND SOLUTIONS
to everyday societal
issues, and they include As a student, you will be asked to demonstrate your knowledge of The F2 offspring should exhibit the individual traits in the
transmission genetics by solving various problems. Success at this following proportions:
ethical considerations.
task requires not only comprehension of theory but also its appli- Cc*Cc Ww*Ww
cation to more practical genetic situations. Most students find
T T
problem solving in genetics to be both challenging and rewarding. CC WW
This section is designed to provide basic insights into the reason- Cc full Ww round
ing essential to this process. cC wW
1. Mendel found that full pea pods are dominant over constricted cc constricted ww wrinkled
pods, while round seeds are dominant over wrinkled seeds. One Using these proportions to complete a forked-line diagram
of his crosses was between full, round plants and constricted, confirms the 9:3:3:s1 phenotypic ratio. (Remesmber that this ratio
wrinkled plants. From this cross, he obtained an F1 genera- represents proportions of 9/16:3/16:3/16:1/16.) Note that we are
tion that was all full and round. In the F2 generation, Mendel applying the product law as we compute the final probabilities:
A01_KLUG0424_10_GE_FM.indd 6 obtained his classic 9:3:3:1 ratio. Using this information, deter- 22/05/2020 7:03 am
mine the expected F1 and F2 results of a cross between homozy- 3/4 round (3/4)(3/4) 9/16 full, round
gous constricted, round and full, wrinkled plants.
3/4 full
Solution: First, assign gene symbols to each pair of contrast- 1/4 wrinkled (3/4)(1/4) 3/16 full, wrinkled
ing traits. Use the lowercase first letter of each recessive trait
to designate that trait, and use the same letter in uppercase 3/4 round (1/4)(3/4) 3/16 constricted, round
to designate the dominant trait. Thus, C and c indicate full
and constricted pods, respectively, and W and w indicate the 1/4 constricted
round and wrinkled phenotypes, respectively. 1/4 wrinkled (1/4)(1/4) 1/16 constricted, wrinkled
Determine the genotypes of the P1 generation, form the
pgahmeneotetys,p ceo(ms):bine them in the F1 generation, and read off the 2. In the laboratory, a genetics student crossed flies with normal
long wings with flies expressing the dumpy mutation (trun-
P1: ccWW CCww cated wings), which she believed was a recessive trait. In the
constricted, round full, wrinkled F1 generation, all flies had long wings. The following results
T * T were obtained in the F2 generation:
Gametes: cW Cw
F1 : fulCl,c rWouwnd 729028 ldounmg-pwyi-nwgiendg efldie fslies
You can immediately see that the F1 generation expresses both The student tested the hypothesis that the dumpy wing
dominant phenotypes and is heterozygous for both gene pairs. is inherited as a recessive trait using x2 analysis of the
TMheunsd, eyloiaun e rxapteioc to tfh 9a:t3 t:h3:e1 F. L2 egte’ns ewroartiko int wouiltl aynieylwd atyh,e j uclsats tsoi c F2 data.
confirm this expectation, using the forked-line method. Both (a) What ratio was hypothesized?
gene pairs are heterozygous and can be expected to assort inde-
(b) Did the analysis support the hypothesis?
pendently, so we can predict the F2 outcomes from each gene
pair separately and then proceed with the forked-line method. (c) What do the data suggest about the dumpy mutation?
M03_KLUG8414_10_SE_C03.indd 50 07/09/2018 02:49
Learn genetics concepts and problem
solving in Mastering Genetics
NEW! Tutorials have
been added to the
library on topics like
CRISPR-Cas and
epigenetics, to help
students master
important and
challenging concepts.
A library of over
100 Practice
Problems offers more
opportunities to assign
high quality problems
for student homework or
practice. These questions
appear only in Mastering
Genetics and include
targeted wrong-answer
feedback to help students
learn from their mistakes.
They are similar to end-of-
chapter questions in terms
of topic coverage and
difficulty.
A01_KLUG0424_10_GE_FM.indd 7 22/05/2020 7:03 am
Give students anytime, anywhere
access with Pearson eText
Pearson eText is a simple-to-use, mobile-optimized, personalized reading experience. It allows students
to easily highlight, take notes, and review key vocabulary all in one place—even when offline. Seamlessly
integrated videos engage students and give them access to the help they need, when they need it.
NEW! Pearson eText increases student
engagement with embedded videos.
A01_KLUG0424_10_GE_FM.indd 8 22/05/2020 7:03 am