Table Of ContentOncogene(2011)30,2367–2378
&2011MacmillanPublishersLimited Allrightsreserved0950-9232/11
www.nature.com/onc
ORIGINAL ARTICLE
Epidermal growth factor regulates Mcl-1 expression through the
MAPK-Elk-1 signalling pathway contributing to cell survival
in breast cancer
EP Booy1,2, ES Henson1,2 and SB Gibson1,2
1DepartmentofBiochemistryandMedicalGenetics,UniversityofManitoba,Winnipeg,Manitoba,Canadaand2ManitobaInstitute
ofCell Biology, University of Manitoba, Winnipeg, Manitoba, Canada
Myeloid cell leukaemia-1 (Mcl-1) is an anti-apoptotic Introduction
memberoftheBcl-2familythatiselevatedinavarietyof
tumour types including breast cancer. In breast tumours, Myeloid cell leukaemia-1 (Mcl-1) is an anti-apoptotic
increased Mcl-1 expression correlates with high tumour memberoftheBcl-2familyofproteinsthathasacritical
grade and poor patient survival. We have previously role in regulating the balance between survival and
demonstrated that Her-2 levels correspond to increased deathsignals(YipandReed,2008).Anti-apoptoticBcl-
Mcl-1 expression in breast tumours. Epidermal growth 2 family members are frequently deregulated in human
factor(EGF)receptorsignallingisfrequentlyderegulated cancers and Mcl-1 is elevated in a variety of tumour
in breast cancer and leads to increased proliferation and types(Backusetal.,2001;Zhangetal.,2002;Songetal.,
survival. Herein, we determined the critical downstream 2005) including breast cancer, where it has been found
signals responsible for the EGF mediated increase of to correlate with poor prognosis (Ding et al., 2007).
Mcl-1 and their role in cell survival. We found that both Small molecule inhibitors targeting pro-survival Bcl-2
Mcl-1 mRNA andproteinlevels arerapidly induced upon family members are currently in clinical trials (Vogler
stimulationwithEGF.Promoteranalysisrevealedthatan et al., 2009); however, due to inherent low affinities for
Elk-1 transcription factor-binding site is critical for EGF Mcl-1, Mcl-1 overexpression was frequently found to
activation of the Mcl-1 promoter. Furthermore, we found mediate resistance (Oltersdorf et al., 2005; van Delft
thatknockdownofElk-1orinhibitionoftheErksignalling et al., 2006; Lin et al., 2007; Tse et al., 2008). More
pathway was sufficient to block EGF upregulation of recentlydevelopedsmallmoleculeinhibitorsthathavea
Mcl-1 and EGF mediated cell survival. Using chromatin higher ability to disrupt Mcl-1 function have overcome
immunoprecipitation and biotin labelled probes of the resistance to other pan-Bcl-2 family inhibitors (Nguyen
Mcl-1 promoter, we found that Elk-1 and serum response etal.,2007).ThisdemonstratestheimportanceofMcl-1
factor are bound to the promoter after EGF stimulation. in the regulation of apoptosis.
TodeterminewhetherMcl-1confersasurvivaladvantage, Theepidermalgrowthfactor(EGF)receptorfamilyis
we found that knockdown of Mcl-1 expression increased composed of four key membrane spanning receptors
apoptosis whereas overexpression of Mcl-1 inhibited drug referred to as ErbB1-4 (Her-1-4). Of these receptors,
induced cell death. In human breast tumours, we found a ErbB1 (Her-1) and ErbB2 (Her-2) are most frequently
correlation between phosphorylated Elk-1 and Mcl-1 overexpressed in human cancers (Klapper et al., 2000).
proteinlevels.TheseresultsindicatethattheEGFinduced In breast cancer, ErbB2 (Her-2) is overexpressed in
activation of Elk-1 is an important mediator of Mcl-1 roughly 20% of cases and correlates with poor prog-
expression and cell survival and therefore a potential nosis(SingletonandStrickler1992;Nanda2007).Mcl-1
therapeutic target in breast cancer. has previously been described in the literature as a
Oncogene(2011)30,2367–2378;doi:10.1038/onc.2010.616; downstream target of the EGF signalling pathway in
published online 24 January 2011 oesophageal (Leu et al., 2000), colorectal (Schulze-
Bergkamen et al., 2008) and lung (Song et al., 2005)
Keywords: Mcl-1;Elk-1;breastcancer;regulation;drug cancer cell lines. We have evidence that suggests a
resistance similarresponseisseeninbreastcancerandhavefound
a correlation between Her-2 positive breast cancers and
high levels of Mcl-1 expression (Henson et al., 2006).
Although one report has demonstrated a correlation
between phosphorylated Stat-3 and elevated Mcl-1 in
breast tumours (Hsieh et al., 2005), the transcriptional
Correspondence:Dr SBGibson,ManitobaInstituteofCell Biology, mechanisms governing Mcl-1 expression in breast
University of Manitoba, 675 McDermot Ave, Winnipeg, Manitoba, cancer have not been thoroughly investigated.
CanadaR3E0V9.
A number of studies exist describing the transcrip-
E-mail:[email protected]
tionalregulationoftheMcl-1geneinadiversesetofcell
Received 23 August 2010; revised 6 December 2010; accepted 14
December2010;publishedonline24January2011 types. The Mek/Erk pathway has been implicated to
EpidermalgrowthfactorregulatesMcl-1expression
EPBooyetal
2368
govern Mcl-1 transcription in several cell line models Figure 1a, both MCF-7 and SK-BR-3 cells demon-
(Boucher et al., 2000; Leu et al., 2000; Schubert and stratedamarkedelevationofMcl-1proteinlevelswithin
Duronio 2001). Two independent studies have demon- 2h of treatment and protein levels remained elevated
strated that Elk-1 and serum response factor (SRF), after 8h of treatment. As Mcl-1 has a short half-life
downstreamofErkactivation,contributetobasalMcl-1 (Akgul et al., 2000), rapid fluctuations in protein levels
expressionlevelsaswellasinductionoftranscriptionby can occur in the absence of a change in relative
treatmentwith12-O-tetradecanoylphorbol-13-acetatein transcription of the Mcl-1 gene. Therefore it was
HEK 293, HeLa and Ml-1 cell lines (Townsend et al., necessary to determine whether the observed changes
1999;Vickersetal.,2004).Inothercelltypes,thePI3K/ werearesultofelevatedtranscriptionormodificationof
AKT pathway has been described as critical for Mcl-1 proteinstability.Mcl-1mRNAlevelsweredetectedover
regulation (Wang et al., 1999; Kuo et al., 2001; Longo a 120min time course following stimulation with EGF
etal.,2008).Additionally,thetranscriptionfactorStat-3 by semi-quantitative real-time PCR. After 30min of
has been tied to Mcl-1 expression in cells of hemato- EGF treatment, the Mcl-1 mRNA level was increased
poieticorigin(Puthieretal.,1999;Liuetal.,2003).The by fourfold in MCF-7 cells and at 60min EGF
precise signalling and transcriptional mechanisms reg- treatment in SK-BR-3 cells the mRNA level had
ulating Mcl-1 in breast cancer cells remains unclear. increased nearly threefold. The mRNA levels peaked
Herein, we determined that Erk activation of the after90min ofEGFstimulation ata12-foldincreasein
transcription factor Elk-1 is critical for transcriptional MCF-7 cells and fourfold increase in SK-BR-3 cells.
regulation of Mcl-1 following EGF treatment and also Controltreatedcellsfailedtodemonstrateanincreasein
has a significant role in EGF mediated cell survival in Mcl-1 mRNA levels over the same time course (dashed
breast cancer. line, Figure 1b). This strongly suggests that EGF
signalling elevates transcription of the Mcl-1 gene in
breast cancer cells.
Results
Stimulation of the EGF signalling pathway upregulates A small region of theMcl-1 promoter containinga serum
Mcl-1 protein and mRNA levels response element is necessary for EGF induced
Several studies have suggested that EGF signalling transcription
regulates transcription of Mcl-1 (Leu et al., 2000; Cetin We set out to identify the key regulatory elements
et al., 2010). We have previously found a correlation necessary for EGF induced transcription of Mcl-1 in a
between elevated Her-2 and Mcl-1 levels in breast breast cancer cell line model. To determine the critical
tumours(Hensonetal.,2006).Tofurtherassesswhether region of the Mcl-1 promoter, a 3974bp fragment
Mcl-1 expression is modified by EGF receptor activa- upstream of the translation start site was amplified by
tion in breast cancer, we studied Mcl-1 protein and PCR and cloned into the PGL-3 luciferase reporter
mRNA levels in MCF-7 and SK-BR-3 breast cancer vector. A series of deletion mutants were generated to
cell lines following treatment with EGF. As shown in narrow down the region of interest. A small segment of
Figure1 StimulationoftheEGFpathwayelevatesMcl-1proteinandmRNAlevels.(a)Westernblottimecoursefollowingaddition
of1mg/mlEGFtothecellculturemedia.Cellswereserumstarvedfor24hbeforetreatmentwithEGF.Blotswerere-probedwithanti-
tubulinantibodiesasaloadingcontrol.(b)Real-timePCRanalysisofMcl-1transcriptlevelsfollowingstimulationwithEGF.Inall
100ngtemplateRNAwasamplifiedwithprimersspecifictoMcl-1.Resultswerestandardizedusingprimerstothehousekeepinggene
cyclophilin. Results are expressed as a fold change relative to the basal levels observed in the unstimulated control sample. Data
representsthemeanofthreeexperiments±thes.d.
Oncogene
EpidermalgrowthfactorregulatesMcl-1expression
EPBooyetal
2369
thepromoter,B300bpupstreamofthetranslationstart and putative nuclear factor (NF)-kB binding sites (data
site, was found to be sufficient for both basal and EGF not shown) were deleted, but failed to significantly alter
induced expression of the luciferase reporter in MCF-7 Mcl-1 promoter activity. The full-length Mcl-1 promo-
cells (Figure 2a). Sequence alignment of the human and ter ((cid:2)3974) was used as a positive control. Similar
mouse Mcl-1 promoters showed a region of high results were obtained with SK-BR-3 cells (Supplemen-
identity within this fragment (Figure 2b). A series of tary Figure 1A and B).
7bp deletions were created within the 4kb promoter
reporter construct to identify potentially important cis-
actingDNAelements.Specifically,highscoringputative Elk-1isactivatedbystimulationwithEGFandisessential
transcription factor binding sites and the region of high for control of Mcl-1 protein levels
identity with the mouse Mcl-1 promoter were targeted The Mek/Erk pathway is activated by EGF and has
for deletion (Figure 2b). Transcription factor binding been shown to activate the transcription factor Elk-1
sites were identified using the TFSearch software (Yordy and Muise-Helmericks, 2000). To determine
(Heinemeyer et al., 1998). We found that deletion of whetherEGFstimulationresultedinactivationofErk1/
two regions corresponding to a potential Elk-1 binding 2 and Elk-1, MCF-7 and SK-BR-3 cells were treated
site (Del. 3) and SRF CarG box (Del. 6 and Del. 7) with EGF over a 60min time course. As shown in
reduced EGF activation of the Mcl-1 promoter Figure3a,Erk1/2werephosphorylatedwithin5minand
(Figure 2c). Both of these sites were within the region phosphorylation decreased after 60min of EGF treat-
of high identity between the human and mouse ment. Following similar kinetics, phosphorylation of
promoters (Figure 2b). Additional transcription factor Elk-1 at Ser383 was detected at 5min following EGF
binding sites including an ATF2 consensus site (Del. 1) treatment and decreased by 60min. After 60min, an
Figure2 AsmallregionoftheMcl-1promotercontainingaserumresponseelementisnecessaryforEGFinducedtranscription.
(a)LuciferaseassaydemonstratingactivityofeightdeletionmutantsoftheMcl-1promoterinMCF-7cells.Promoterinsertscloned
intothePGL3vectorareshowntoscaletotheleftoftheaxis.Sequencelengthupstreamfromtranslationstartsiteisindicatedforeach
construct.BasalandEGFinducedpromoteractivityisshownasrelativeluciferaseunits.Datarepresentthemeanofthreeindependent
experiments±s.d.. Constructs (cid:2)204 and (cid:2)143 were the only deletions to show highly significant reduction in activity (#indicates
P¼o0.005comparedwithcontrol(cid:2)3974,*indicatesP¼o0.005comparedwithEGFtreated-3974).Nearlyidenticalresultswere
observedwiththeSK-BR-3cellline (SupplementaryFigure1). Resultswerestandardizedbyb-galco-transfection.(b)Asequence
alignmentofthehumanandmouseMcl-150promoterregionrevealedanareaofhighidentitynearthetranslationstartsite.Distance
upstreamfromtranslationstartisindicatedatthe50 endofeachsequence.(c)The7bpdeletionswereintroducedintothe3974bp
promoterconstructandtheimpactonpromoteractivityisshowncomparedwiththeunmutated3974bpfragment(barstoleftofaxis).
Deletions3and7demonstratedthestrongestreductioninbasalandEGFinducedactivity.DataareshowninthecontextoftheMcl-1
promotersequencewithpredictedtranscriptionfactorbindingsitesindicatedbelowthesequence.Deletionsareseparatedbyspaces
andbasesdeletedareindicatedbyitalics.
Oncogene
EpidermalgrowthfactorregulatesMcl-1expression
EPBooyetal
2370
increase in Mcl-1 protein was detected in MCF-7 cells. Elk-1in transcriptional regulation of Mcl-1 in breast
Control treatment failed to induce phosphorylation of cancer cells.
theseproteinsoverthesametimecourse.Similarresults
were observed in SK-BR-3 cells (Figure 3a). Pre-
treatment with U0126, a highly specific inhibitor of Elk-1 and SRF bind to the Mcl-1 promoter
Mek1/2(Favataetal.,1998)preventedbothErk1/2and To assess whether the transcription factors Elk-1 and
Elk-1 phosphorylation in MCF-7 and SK-BR-3 cells. SRF bind to the Mcl-1 promoter, a chromatin
This inhibition also prevented the elevation of Mcl-1 immunoprecipitation (ChIP) experiment was performed
protein levels following EGF treatment (Figure 3b). with MCF-7 cells using primers that amplify a 163bp
TheErkinhibitor3-(2-aminoethyl)-5-((4-ethoxyphenyl)- region containing the putative Elk-1 and SRF binding
methylene)-2,4-thiazolidinedione, previously published sites identified in Figure 2c. ChIP was performed with
topreventElk-1phosphorylationatSer383(Chenetal., Elk-1 and SRF antibodies along with two negative
2006), also produced similar results (Figure 6c). antibody controls and a no antibody control (beads
Targeted knockdown of Elk-1 expression by transfec- alone). Elk-1 was detectable on the Mcl-1 promoter by
tion of a specific small interfering (si)RNA reduced ChIP before stimulation with EGF (Figures 4a and b).
both basal and EGF induced Mcl-1 levels substantially Under unstimulated conditions, SRF was only margin-
in both cell lines (Figure 3c). Knockdown of two ally detectable on the Mcl-1 promoter; however, within
other transcription factors, Stat-3 and NF-kB, failed 10min of adding EGF there was a significant elevation
to have an effect on basal or EGF induced levels of (85-foldenrichment)ofSRFatthepromoter,whichwas
Mcl-1 (Supplementary Figure 2A). Unexpectedly, maintained after 30min of stimulation (Figures 4a
knockdown of SRF had no impact on basal or EGF and b). This was followed by an elevation of Elk-1 at
inducedMcl-1protein ormRNA levels(Supplementary the20and30mintimepoints.Isotypecontrols(ctrl1is
Figure 2A/B). This data confirms the importance of anantibodyagainstNF-kB,ctrl2isanantibodyagainst
Figure3 Elk-1isactivatedbystimulationwithEGFandisessentialforcontrolofMcl-1proteinlevels.(a)Cellswereserumstarved
for24handthenEGFwasaddedtothecellculturemediaataconcentrationof1mg/mlfora60mintimecourse.Anequalvolumeof
the EGF solvent was used as a control. Erk1/2 activation was assessed by antibodies specific for Erk1/2 only when dually
phosphorylatedatThr202andTyr204.ActivationofElk-1wasdetectedwithanantibodyspecifictoElk-1onlywhenphosphorylated
atSer383.Blotswerere-probedfortotalErk1/2andElk-1tocontrolforloading.IncreaseinMcl-1isshownforMCF-7cells.(b)Cells
werepre-treatedwiththeMekinhibitorU0126oranequalvolumeofdimethylsulfoxidefor20minbeforestimulationwithEGF.
Lysatesweretakenat15and20minpoststimulationandblotswereprobedwiththesameantibodiesasin(a). (c)Inall30pmol
siRNAspecificforElk-1orascrambledcontrolwastransfectedintoSK-BR-3andMCF-7cellsbynucleofection.Twenty-fourhour
aftertransfection,thecellswerestarvedforasubsequent24hfollowedbystimulationwithEGForcontrolfor2h.
Oncogene
EpidermalgrowthfactorregulatesMcl-1expression
EPBooyetal
2371
Figure4 ThetranscriptionfactorsElk-1andSRFbindtotheMcl-1promoterinMCF-7cells.(a)Chromatinimmunoprecipitation
usingantibodies specificto Elk-1andSRFwasperformedasdescribedin Material andmethodssection. Controls shownare two
negativeantibodycontrolsaswellasanoantibodycontrol(proteinGbeadsalone).Ctrl1isanantibodyagainstStat-3andCtrl2isan
antibodyagainstNF-kB.FoldenrichmentvalueswereobtainedbycomparingthecTvaluesforeachChIPsampletoanequalamount
ofinputDNA.PrimersweredesignedinthelastexonoftheMcl-1genetodemonstratespecificity(RT–PCRdatanotshown,PCR
productsshownin(b)).Datarepresentsthemeanofthreeindependentexperiments±standarderror.(b)PCRproductswererunonan
agarosegelfollowingeachChIPexperimenttoassessreactionspecificity.(c)Streptavidinpull-downassaytodetecttranscriptionfactor
bindingtoa50bpdouble-strandedbiotinlabelledprobespecifictotheMcl-1promoterregionofinterest.Cellswerestimulatedwith
EGFfordifferenttimeperiodsandnuclearextractsincubatedwiththeMcl-1probe.Followingpulldownwithstreptavidinbeads,the
boundproteinswere detectedby SDS/polyacrylamidegel electrophoresis andwestern blotting. Tocontrolfor specificity, abiotin-
labelledscrambledprobewasusedalongwithcompetitionwithanunlabelledspecificprobe.Blotswereprobedwithantibodiestothe
transcriptionfactorsStat-3andNF-kBtodemonstratebindingspecificity.(d)SchematicrepresentationoftheMcl-1geneshowing
approximatelocationsofthebiotinlabelledprobeusedfortheStreptavidinpulldownaswellastheprimersusedforChIP.
Stat-3) failed to immunoprecipitate Mcl-1 promoter increased recruitment of SRF to the chromatin and
fragments and demonstrated fold enrichment values thereforereducedavailabilityoftheproteinintheassay.
close to zero (Figures 4a and b). All of the antibodies
failed to enrich a region of the third exon of the Mcl-1
gene (Figure 4b). Both EGFtreatmentandmodulationofMcl-1expression
Further validation that Elk-1 and SRF bind to the impact the survival of SK-BR-3 cells
region of interest was obtained by performing a It has been established that EGF receptor activation
streptavidin pull-down assay using a biotin-labelled elevates survival and resistance to apoptosis (Klapper
50bp probe complementary to the region of interest et al., 2000). In Figure 5a, we confirmed that treatment
(155–205bp upstream of translation start). The Mcl-1 of SK-BR-3 cells with EGF significantly reduced the
promoterspecificprobewasabletopulldownbothElk- levels of apoptosis induced by both etoposide and
1 and SRF from EGF treated nuclear lysates doxorubicin treatment. Protection was most evident at
(Figure 4c). The scrambled probe did not demonstrate low drug concentrations wherein EGF reduced 5mM
observable binding and the presence of an excess of etoposideinducedcelldeathfrom42to21%and0.5mM
unlabelled probe successfully competed away the signal doxorubicin induced cell death from 32 to 12%. To
for both Elk-1 and SRF. Binding specificity was assessthecontributionofMcl-1tothesurvivalofbreast
determined by using antibodies against two other cancer cells we performed a targeted knockdown
transcription factors, NF-kB and Stat-3 (Figure 4c). experiment with Mcl-1 specific small interfering (si)R-
The decrease in SRF binding observed following NA. Twenty-four hours following siRNA transfection
stimulation in the pull-down assay may be due to there was a substantially higher number of apoptotic
Oncogene
EpidermalgrowthfactorregulatesMcl-1expression
EPBooyetal
2372
Figure5 BothEGFtreatmentandmodulationofMcl-1expressionimpactsthesurvivalofSK-BR-3cells.(a)SK-BR-3cellswerepre-
treated1hrwithEGForcontrolandthentreatedwithetoposideordoxorubicinatincreasingconcentrationsfor18h.Apoptosiswas
assessedbyanalysisofthesub-G1peakbyflowcytometry.Datarepresentsthreeindependentexperiments±standarderror.(b)SK-
BR-3cellsweretransfectedwith30pmolcontrolsiRNAorsiRNAspecifictoMcl-1.Knockdownwasverifiedbywesternblotting.
Apoptosiswasassessed24hposttransfection(*indicatesPo0.05).(c)Mcl-1overexpressionprotectsSK-BR-3cellsfromdruginduced
apoptosis. Cells were transfectedwith pCDNA3-Mcl-1 or emptyvector 24h before treatment with 5mM etoposide.Cell death was
measured18hlaterbysub-G1analysis.Resultsarethemeanofthreeindependentexperiments±s.d.(#IndicatesPo0.05comparing
controlcells,*indicatesPo0.05comparingetoposidetreatedcells.)PleasenotetheMcl-1expressionlevelsfollowingoverexpression
orknockdownweredetectedatdifferentexposuretimesanddonotreflectrelativeexpressionlevels.
cells (38%) with Mcl-1 knockdown as compared with to 19%. When the cells were also pre-treated with
untreated cells (9%) or transfection with a scrambled U0126 the EGF treatment only resulted in a reduction
control siRNA (12%, Figure 5b). This implies that a from 41 to 31% (Figure 6b).
minimal level of Mcl-1 expression is critical for cell To verify the result with U0126, the experiment was
survival in breast cancer cell lines. Overexpression of repeated using an Erk1/2 inhibitor (Figures 6c and d).
Mcl-1 by transfection of the Mcl-1 complementary TheErk1/2inhibitor alonedisplayedslighttoxicitythat
DNA resulted in resistance to transfection toxicity appeared to be enhanced in the presence of EGF.
(25%) and etoposide (45%) induced cell death as Despite the toxicity of the inhibitor, levels of apoptosis
compared with the empty vector (40 and 55%, induced by etoposide were only 5% higher with the
respectively, Figure 4c). These results demonstrate that inhibitor as compared with that of the control (28.7
Mcl-1 has an important role in cell survival. and 33.6%). Although EGF protection in the control
samples was similar to that observed in Figure 6b
(reduction from 28.7 to 12.8%), Erk inhibition com-
EGF protects breast cancer cells from apoptosis through pletely reversed the protective effect conferred by EGF
a mechanism that relies on signalling via the Mek/Erk pre-treatment. In stark contrast to the control samples,
pathway co-treatment of etoposide with EGF in the presence of
As Mcl-1 knockdown alone was sufficient to induce the Erk inhibitor showed higher levels of apoptosis
apoptosis, we determined whether prevention of Mcl-1 compare with etoposide alone. These results indicate
upregulation would reverse the protective effects con- that Mek/Erk signalling leads to increased Mcl-1
ferredbyEGFpre-treatment.TheMekinhibitorU0126 expression and has a critical role in the EGF survival
completely prevents EGF induced upregulation of response in breast cancer cells.
Mcl-1 protein levels (Figure 6a) and also results in a
significant reduction of the protective effect of EGF
(Figure6b).InboththecontrolandU0126treatedcells, Activated Elk-1 correlates with increased levels of Mcl-1
etoposide induced nearly identical levels of apoptosis in breast tumour samples
(39.4% in control and 41.4% in the U0126 pre-treated Knowledge of the molecular pathways governing Mcl-1
cells).Pre-treatmentwithEGFresultedinareductionin expression allows for the development of rationale
the amount of apoptosis induced by etoposide from 39 therapeutic approaches; however, without clinically
Oncogene
EpidermalgrowthfactorregulatesMcl-1expression
EPBooyetal
2373
Figure6 EGFprotectsbreastcancercellsfromapoptosisthroughamechanismthatreliesonsignallingviatheMek/Erkpathway.
(a)SK-BR-3cellswerepre-treatedwiththeMekinhibitorU0126ataconcentrationof15mMfor20minbeforeadditionofEGF.Mcl-1
proteinlevelswereassessedbywesternblotfollowingstimulationwithEGF.(b)SK-BR-3cellswerepre-treatedwiththeMekinhibitor
U0126ataconcentrationof15mMfor20minbeforeadditionofEGF.OnehouraftertreatmentwithEGFthecellsweretreatedwith
etoposide at a concentration of 5mM for 18h. Apoptosis was assessed by analysis of the sub-G1 peak by flow cytometry. Data
representsthreeindependentexperiments±standarderror.(c)Asimilarexperimentwasperformedasin(a)usingtheErkinhibitor3-
(2-aminoethyl)-5-((4-ethoxyphenyl)methylene)-2,4-thiazolidinedione. The cells were pre-treated for 20min with the inhibitor at a
concentrationof30mMbeforetheadditionofEGF.(d)Asin(b)exceptcellswerepre-treatedwith20mMoftheErkinhibitorbefore
additionofEGF.*indicatesPo0.05.
relevant breast tumours the significance of these results previouslyassessedasERanegativebyaligandbinding
willbediminished.Tothatend,wesoughttodetermine assay. Each tumour was represented by two separate
ifthesignallingpathwaysregulatingMcl-1expressionin spotsontheTMA.TMAswereimmunostainedwiththe
the MCF-7 and SK-BR-3 cell lines are correlated to Mcl-1andphospho-Elk-1antibodiespreviouslydemon-
Mcl-1 expression in human breast tumour samples. stratedtobeeffectiveforimmunofluorescenceaswellas
Beforeproceedingtoalarge-scaleanalysis,apilotstudy antibodies directedagainstphospho-Erk1/2,ErbB1and
was performed with 26 breast tumour samples from the ErbB2.InFigures7aandb,thetumourswereseparated
Manitoba Breast Tumour Bank. Tumour sections were into two groups based on the median Mcl-1 H-score of
stainedforimmunofluorescencewithantibodiesdirected 120. Tumours with a Mcl-1 score of 120 or less were
against Mcl-1 and phosphorylated Elk-1. Antibodies classifiedas‘lowMcl-1’andthosewithascoreabovethe
were pre-validated for immunofluorescence on tumour median were classified as ‘high Mcl-1’. A Mann–
sections byoverexpressionand knockdownexperiments Whitney test was performed to determine if the median
in MCF-7 cells (Supplementary Figure 3A and B). A phospho-Elk-1 and phospho-Erk1/2 scores (indicated
panel of 26 breast tumour sections were stained with by the solid horizontal line) were significantly different
antibodiesagainstMcl-1andphospho-Elk-1andscored between the two groups. The median phospho-Elk-1
using a 0–3 point scoring system. In Supplementary score for the low-Mcl-1 category was 75.0 and the
Figure 4A, the data was analysed by plotting the scores median score for the high Mcl-1 score was 140, a
as an XY scatter and performing a Spearman correla- difference that was statistically significant (Po0.005).
tion test. We found a statistically significant positive The median phospho-Erk1/2 scores were also signifi-
correlationbetweenphosphorylationofElk-1andMcl-1 cantly different with a score of 50.0 in the low-Mcl-1
expression (r ¼0.4303, P¼0.0282) in the tested breast subset and a score of 100.0 in the high subset. The
S
tumours. Representative images from the sampled phospho-Erk1/2 scores were also separated into two
tumours shown in Supplementary Figure 4b demon- groups based on the median phospho-Elk-1 score. As
strate that regions within an individual tissue section Elk-1 is a substrate for Erk1/2 it was hypothesized that
having high phospho-Elk-1 (green signal), also demon- elevated levels of phospho-Erk1/2 would correlate with
stratestrongstainingforMcl-1(redsignal).Conversely, elevated levels of phospho-Elk-1. A significantly higher
regions with low phospho-Elk-1 levels tended to have phospho-Erk1/2 score (150.0) was observed in tumours
corresponding low levels of Mcl-1. that demonstrated high levels of phospho-Elk-1 as
Based upon the pilot study, we further investigated compared with those that did not (50.0). In a similar
the relationship between activated Elk-1 and the manner the tumours were divided based on the median
expression level of Mcl-1 in a tissue microarray scores for ErbB1 and ErbB2. Increased expression of
(TMA) provided by the Manitoba Breast Tumour both receptors associated with a higher median Mcl-1
Bank. The TMA consisted of 255 tumours that were H-score (Figures 7d and e). This data supports the
Oncogene
EpidermalgrowthfactorregulatesMcl-1expression
EPBooyetal
2374
Figure7 ActivatedElk-1correlateswithincreasedlevelsofMcl-1inbreasttumoursamples.ATMAcontainingsamplesfrom255
ERanegativebreasttumourswasstainedbyimmunohistochemistrywithantibodiesspecificforElk-1whenphosphorylatedatSer383,
Erk1/2whenphosphorylatedatThr202/Tyr204,ErbB1,ErbB2andMcl-1.TMAswerescoredbytwoblindedindependentobservers.
TumourswereassessedusingtheH-scoremethod.Anintensityscoreof0–3wasmultipliedbythepercentageoftumourcellsstained.
Bars for all graphs represent median scores for each category. P-values were calculated by Mann–Whitney test. (a) H-scores for
phospho-Elk-1were separatedinto twogroupsbasedonthe medianMcl-1H-scoreof120. (b) H-scoresfor phospho-Erk1/2were
separatedintotwogroupsbasedonthemedianMcl-1H-scoreof120.(c)H-scoresforphospho-Erk1/2wereseparatedintotwogroups
basedonthemedianphospho-Elk-1H-scoreof100.(d)H-scoresforMcl-1wereseparatedintotwogroupsbasedonthemedianErbB1
H-scoreof85.(e)H-scoresforMcl-1wereseparatedintotwogroupsbasedonthemedianErbB2H-scoreof50.
regulation of Mcl-1 protein expression by EGF recep- an activator of apoptosis (Bingle et al., 2000). Mcl-1 is
tors through the Mek/Erk pathways mediated by Elk-1 also subjected to multiple post-translational modifica-
activation within breast tumours. tions that include cleavage by caspases or enhancement
of stability through phosphorylation (Le Gouill et al.,
2004). Mcl-1 is further regulated by the mir-29b
microRNA (Mott et al., 2007). These studies indicate
Discussion that Mcl-1 is a dynamically regulated protein, and our
results demonstrate that transcriptional control is an
Mcl-1 is unique amongst the pro-survival Bcl-2 family important aspect of Mcl-1 expression in breast cancer.
members in the degree to which its expression is tightly Overexpression or mutation of the EGF receptors is
regulated and the multiple levels at which this occurs seen in a variety of tumour types (Klapper et al., 2000).
(Akgul 2009). Besides having its expression being In breast cancer, the EGF receptor ErbB2/Her-2 is
regulated at the transcriptional level, Mcl-1 also overexpressed in B20% of cases (Nanda 2007; Single-
contains a PEST domain that confers a very short ton and Strickler 1992). The ErbB1 receptor is also
protein half-life due to degradation via the proteasome increased in breast cancer but increased gene transcrip-
pathway (Akgul et al., 2000). This property allows for tion rather than gene amplification appears to be the
tight regulation of Mcl-1 and protein levels fluctuate primary reason for overexpression (Chrysogelos and
rapidly in response to the changing extracellular Dickson, 1994). In contrast to normal tissue the
environment. Another degree of regulation exists via expression level of ErbB1 in breast cancer can be
alternative splicing to generate a smaller protein that is increased by as much as 20-fold (Herbst, 2004).
Oncogene
EpidermalgrowthfactorregulatesMcl-1expression
EPBooyetal
2375
Although less studied, ErbB3 is also found to be expression(SupplementaryFigure2)Whetherthisisdue
increased in 19–29% of breast cancer cases and this to insufficient knockdown, recruitment of other co-
increase, like that of ErbB1, is not primarily due to a activators in the absence of SRF or Elk-1 acting
change in gene copy number (Sithanandam and independently is yet to be determined. Although many
Anderson, 2008). Although the prognostic significance additional transcription factor binding sites were found
of ErbB3 in breast cancer is not as straightforward as within the Mcl-1 promoter such as Stat-3 and NF-kB,
for Her-2, a general trend towards disease progression two transcription factors that may have a role in Mcl-1
and poorer outcome is reported (Sithanandam and regulation in other cell types, it appears that these sites
Anderson, 2008). arenotcriticalfortheEGFinducedregulationofMcl-1
Therapeutics that target the EGF receptors ErbB1 in these breast cancer cell lines (Boucher et al., 2000;
and ErbB2 such as Herceptin and Lapatinib have Hensonetal.,2006;Liuetal.,2003;Tsutsuietal.,2009).
successful clinical applications in breast cancer (John- Furthermore, knockdown of both Stat-3 and NF-kB
ston et al., 2006). Despite these advances, resistance to hadnoobservableeffectonbasalorEGFinducedMcl-
treatments has been a recurring theme (Nahta and 1 protein levels (Supplementary Figure 2A). Taken
Esteva, 2006). We have previously shown a correlation together, this suggests that activation ofElk-1iscritical
between Her-2 overexpression and elevated Mcl-1 for upregulation of Mcl-1 expression at least in breast
protein expression. We have also demonstrated that cancer cells.
Mcl-1 can contribute to cell survival and resistance The Mek/Erk signalling pathway has an important
againstHerceptin(Hensonetal.,2006).Inthisstudywe roleinbreastcancerprogression(Sivaramanetal.,1997;
confirmed the relationship between EGF signalling and Mueller et al., 2000). Although Ras mutations are
upregulation of Mcl-1 and identified that the Mek/Erk infrequently observed in breast cancer, elevated activa-
signallingpathway,actingultimatelythroughactivation tion of the protein is observed in a substantial
of Elk-1, is critical in regulating Mcl-1 expression in proportion of tumours (Sivaraman et al., 1997; von
breast cancer cells. We have also taken the results Lintig et al., 2000). The basal-like subset of breast
obtained in breast cancer cell lines and used them to tumourshasbeenidentifiedasparticularlysusceptibleto
make accurate predictions in breast tumour samples, Mek inhibition (Mirzoeva et al., 2009). Furthermore,
supporting the clinical relevance of the study. Further- the Mek inhibitor PD0325901 has been found to be
more, we have determined that Mek/Erk signalling is effectiveasasingleagentaswellasincombinationwith
essentialforthesurvivaladvantageconferredbyEGFin inhibitorsofPI3Kinmurinexenograftmodelsofbasal-
our cell line models. Over activation of any of the like breast cancer (Hoeflich et al., 2009). Recently, the
downstream components of this pathway could con- use of Mek inhibitors has demonstrated success in
tribute to resistance to EGF receptor targeted therapies overcoming resistance to the EGF receptor inhibitor
through an upregulation of Mcl-1. lapatinib (Sambade et al., 2009; Zoppoli et al., 2010).
It has previously been established that Mcl-1 is Our resultspointtothepossibility thatinhibitorsofthe
overexpressed in breast tumours and correlates with Mek/Erk signalling cascade can be effective at blocking
poorprognosis(Dingetal.,2007).Inthisstudy,wehave the expression of Mcl-1 in breast cancer. Our data also
demonstrated that Mcl-1 is a downstream target of suggest that Mcl-1 is an important downstream med-
activated EGF receptor signalling and that overexpres- iatorofthesurvivalbenefitsconferredbyoveractivation
sion of Mcl-1 confers resistance to drug induced ofthissignallingnetwork.Inhibitionofthetranscription
apoptosis. We have also demonstrated that a minimal factor Elk-1 could be a further approach to block the
expression level of Mcl-1 is critical for survival of the overexpression of Mcl-1; however, small molecule
SK-BR-3 breast cancer cell line. This data indicate that inhibitors to Elk-1 are currently unavailable. Never-
Mcl-1 may be an important target for breast cancer theless, alterations in the Mcl-1 transcriptional regula-
treatment. Several in vitro studies have demonstrated tion could be a viable strategy to sensitize breast cancer
effectiveness of Bcl-2 family inhibitors against breast cells to EGF receptor inhibitors and Bcl-2 inhibitors.
cancer (Martin et al., 2009; Witters et al., 2007). The
Bcl-2 inhibitor ABT-737 has shown effectiveness in
breast cancer cells alone or in combination with EGF Materials andmethods
receptor inhibitors (Witters et al., 2007). ABT-737
resistant cells show increased Mcl-1 expression indicat- Cell cultureandreagents
ing that targeted Mcl-1 expression could be an effective The human breast adenocarcinoma cell lines MCF-7 and
treatment (Nguyen et al., 2007; Vogler et al., 2009). SK-BR-3 were obtained from the American Type Culture
We have shown that the transcription factor Elk-1 is Collection (ATCC, Manassas, VA, USA) in October of 2008
an important regulator of Mcl-1 expression. This and December of 2009, respectively. Cell identity was
confirmed by the ATCC by short tandem repeat analysis.
supports studies describing Mcl-1 transcriptional reg-
Cells were maintained in a humidified 5% CO incubator at
ulation by tetradecanoylphorbol-13-acetate in HEK 2
371Candwerepassagedtwiceweekly.Cellswerepassagedno
293, HeLa and Ml-1 cell lines (Boros et al., 2009;
more than 20 times. MCF-7 cells were maintained in
Townsend et al., 1999; Vickers et al., 2004). Although
Dulbecco’s modified Eagle’s medium (Invitrogen, Burlington,
we were able to validate the importance of Elk-1 in ONCanada)supplementedwith10%fetalcalfserum(Fisher
controlling Mcl-1 expression we found that knockdown Scientific, Pittsburgh PA, USA) and 100 units/ml penicillin
ofSRFhadlittleornoeffectonbasalorinducedMcl-1 and 100mg/ml streptomycin (Invitrogen). SK-BR-3 cells were
Oncogene
EpidermalgrowthfactorregulatesMcl-1expression
EPBooyetal
2376
maintainedinMcCoy’s5Amedium(Invitrogen)withidentical specificity was confirmed by visualizing DNA on an agarose
supplements. Recombinant human EGF was obtained from gel followingPCR.
Sigma-Aldrich(Oakville,ON,Canada)anddissolvedin10mM
acetic acid with 0.1% bovine serum albumin. For all Mcl-1 promoter constructsandluciferase assays
experiments, EGF was added to the media at a final TheMcl-1promoterwasamplifiedbyPCRfromaBACclone
concentration of 1mg/ml. Etoposide and doxorubicin (Sigma- containing the appropriate region of chromosome 1 (RP11-
Aldrich) were dissolved in dimethyl sulfoxide at a stock 54A4, Invitrogen). Primers were designed to amplify the
concentration of 50mM and stored at (cid:2)201C. The MEK 50 promoter region (3974bp downstream of the translation
inhibitorU0126(Promega,Madison,WI,USA)wasdissolved startsite),aswellastogeneratesevenlargedeletionsfromthe
indimethylsulfoxideataconcentrationof10mMandstoredat 50 end. Promoter fragments were cloned into the PGL3
(cid:2)201C. The Erk inhibitor 3-(2-aminoethyl)-5-((4-ethoxyphe- luciferase reporter vector (Promega). A 7-bp deletions were
nyl) methylene)-2,4-thiazolidinedione (EMD Chemicals, introduced into the 3974bp fragment of the Mcl-1 promoter
Mississauga,ON,Canada)wasdissolvedindimethylsulfoxide using the Quikchange II site directed mutagenesis kit accord-
at a concentration of 10mg/ml and stored at (cid:2)201C. The ing to the manufacturer’s protocol (Stratagene, Santa Clara,
following antibodies were used: rabbit anti-Mcl-1 (M8434 CA, USA). The reporter constructs were transfected into
Sigma-Aldrich), rabbit anti-Elk-1 (ab32106 Abcam, Cam- MCF-7 and SK-BR-3 cells using GenePorter 2 transfection
bridge, MA, USA), mouse anti-SRF (MAB4369 Millipore, reagent (Genlantis, San Diego, CA, USA) along with a
Billerica, MA, USA), rabbit anti-phospho-Elk-1 (Ser383) plasmid containing the b-galactosidase complementary DNA
(9181, Cell Signaling, Boston, MA, USA), mouse anti- to standardize results. Twenty-four hours after transfection,
phospho-P44/42 MAPK (Thr202/Tyr204) (9106, Cell Signal- the cells were serum starved for an additional 24h and then
ing), rabbit anti-P44/42 MAPK (9102, Cell Signaling), rabbit treatedwithEGForvehiclecontrol.After6htreatment,cells
anti-NF-kB p65 (ab7970 Abcam), mouse anti-a-tubulin were lysed in 200ml reporter lysis buffer (Promega) and
(T6074 Sigma-Aldrich), rabbit-anti-Stat-3 (9132, Cell Signal- luciferase activity was measured in 20ml lysate on an LMAX
ing),rabbitanti-Her-2(Dako,Mississauga,ON,Canada)and luminometer (Molecular devices) with 100ml luciferase assay
mouse anti-EGFR (Ventana,Tucson AZ,USA). substrate(Promega).Theb-galactosidaseactivitywasassessed
by combining 50ml lysate with 50ml 2X b-gal buffer (200mM
Westernblotting sodium phosphate pH 7.3, 2mM MgCl2, 100mM b-mercap-
toethanol, 1.33mg/ml ONPG) and measuring the absorbance
Allwhole-celllysateswerepreparedwithRIPAbuffer(50mM
at 450nm.
Tris pH 8.0, 150mM NaCl, 2mM EDTA, 1% nonident P-40,
0.5% sodium deoxycholate, 0.1% SDS) supplemented with
ChIP
protease inhibitors (Complete mini, Roche, Laval, QC,
ChIP was performed following EGF stimulation according a
Canada) and phosphatase inhibitors (phosphatase inhibitor
previouslypublishedprotocol(Spenceretal.,2003).Following
cocktail 1 and 2, Sigma-Aldrich). Equal amounts of protein
immunoprecipitation, and RNAse/proteinase K digestion of
were resolved by SDS/polyacrylamide gel electrophoresis and
samples, ChIP DNA was isolated using the QiaQuick PCR
transferred to polyvinyl difluoride membranes. Membranes
purificationkit(Qiagen,Mississauga,ON,Canada)andDNA
wereblockedinTrisbufferedsalinecontaining0.1%Tween-20
concentration was determined using the PicoGreen dsDNA
(Tris-buffered saline Tween-20) and 5% skim milk powder.
quantitation assay (Invitrogen). In all 0.1ng ChIP DNA was
Primary antibodies were incubated overnight at 41C in 5%
amplified by RT-PCR using primers specific to the Mcl-1
milk Tris-buffered saline tween-20. Following incubation,
promoter (forward: 50-TAGGTGCCGTGCGCAACCCT-30,
membranes were washed threefold in Tris-buffered saline
reverse: 50-ACTGGAAGGAAGCGGAAGTGAGAA-30) or
tween-20 and then incubated with the appropriate secondary
thelastexonoftheMcl-1gene(forward:50-TGTTGCTGGA
antibody conjugated to horse radish peroxidise for 1hour at
GTAGGAGCTGGTTT-30, reverse: 50-GCCATAATCCTC
room temperature in 5% milk tris-buffered saline tween-20.
TTGCCACTTGCT-30). To obtain fold enrichment values,
Proteins were visualized on Hyperfilm ECL by enhanced
the cT value of each ChIP sample was compared with the
chemiluminescence (GE Healthcare, Piscataway NJ, USA).
cTvalue of0.1nginputDNA.
RNA isolation andreal-time (RT)–PCR Streptavidin pull-down assay
Total RNA was isolated using the Qiagen RNeasy Plus mini To assess transcription factor binding to an Mcl-1 promoter
kit according to the manufacturer’s protocol and RNA specific probe, a streptavidin pull-down assay was performed
concentrationswerequantifiedbymeasurementofabsorbance with biotin labelled probes specific to the Mcl-1 specific
at 260nm with a spectraphotometer (SpectraMax M5, promoter. The probe sequence is as follows: 50-CAACC
Molecular Devices, Sunnydale, CA, USA). In all 100ng total CTCCGGAAGCTGCCGCCCCTTTCCCCTTTTATGGGA
RNA was used as template for the real-time PCR. One-step ATACTTTTT-30. Following treatment with EGF for the
RT–PCR was performed using the iScript One-step RT–PCR indicatedtimes,nuclearextractionwasperformedon20(cid:3)106
kit (Bio-Rad, Hercules, CA, USA) and cycling and data cells per time point. Nuclear extracts were pre-cleared with
collection were performed on an iCycler thermal cycler 50mlstreptavidinagarosebeads(Invitrogen)for30minat41C
(Bio-Rad) using the supplied software (iCycler IQ ver 3.1, withrotation.Followingpre-clearance,abindingreactionwas
Bio-Rad).ThefollowingprimersspecifictotheMcl-1mRNA prepared that contained 500mg nuclear extract, 50ng/ml poly
were used: forward: 50-GCCAAGGACACAAAGCCA dI-dC, 1/5 volume 5(cid:3) binding buffer (50mM Tris pH 7.5,
AT-30, reverse: 50-AACTCCACAAACCCATCCCA-30. The 250mM KCl, 5mM dithiothreitol) and 100nM biotin labelled
followingprimersspecifictothehousekeepinggenecyclophilin probe. Binding reactions were incubated for 30min at room
were used to standardize results: forward: 50-GCTGCGT temperature at which point 50ml streptavidin-agarose beads
TCATTCCTTTG-30, reverse: 50-CTCCTGGGTCTCTGCT were added. Following a 30min incubation, beads were spun
TTG-30. The following cycling conditions were used: 501C down at 3000r.p.m. for 1min and washed 3(cid:3)5min in
for10minfollowedby951Cfor5min,then40cyclesof951C phosphate-buffered saline. After washing, beads were resus-
for10sfollowedby551Cfor30s(datacollectionstep).Primer pendedin50ml2XSDSloadingdye,boiledfor5minandthe
Oncogene