Table Of ContentUS008426186B2
(12) United States Patent (10) Patent N0.: US 8,426,186 B2
Chi et a]. (45) Date of Patent: Apr. 23, 2013
(54) ENGINEERED POTATO VIRUS A NUCLEAR Birch, et al., “Puri?cation of Recombinant Human Rhinovirus 14 3C
INCLUSION PROTEIN Protease Expressed in Escherichia coli,” Protein Expression and
Puri?cation, 6: 609-618 (1996).
(75) Inventors: Ellen Chi, San Diego, CA (US); Dougherty, et al., “Molecular Genetic Analysis of a Plant Virus
Michael Hunter, San Diego, CA (US); Polyprotein Cleavage Site: A Model”Virology, 171: 356-364 (1989).
Ronald Swanson, San Diego, CA (U S) Dougherty, et al., “Biochemical and mutational analysis of a plant
virus polyprotein cleavage site,” The EMBO Journal, 7(5): 1281
(73) Assignee: Centocor Ortho Biotech Inc., Horsham, 1287 (1988).
Gosalia, et al., “High Throughput Substrate Speci?city Pro?ling of
PA (US)
Serine and Cysteine Proteases Using Solution-phase Flurorgenic
Peptide Microarrays,” Molecular & Cellular Proteomics, 4: 626-636
( * ) Notice: Subject to any disclaimer, the term of this
(2005).
patent is extended or adjusted under 35 Higaki, et al., “Evolution of Catalysis in the Serine Proteases,” Cold
U.S.C. 154(b) by 0 days. spring harbor Syrnposia on Quantitative Biology, 52: 615-621
(1987).
(21) App1.No.: 13/086,627 Kekarainen, et al., “Comparison of the complete sequences of ?ve
different isolated of Potato virusA (PVA), genus Potyvirus,” Archives
(22) Filed: Apr. 14, 2011 ofVirology, 144: 2355-2366 (1999).
Mastumura, et al., “In vitro Evolution of Beta-glucuronidase into a
(65) Prior Publication Data Beta-galactosidease Proceeds Through Non-Speci?c Intermediates,”
Journal of Molecular Biology, 305: 331-339 (2001).
US 2011/0318808 A1 Dec. 29, 2011 Nunn, et al., “Crystal Structure of Tobacco Etch Virus Protease
Shows the Protein C Terminus Bound Within the Active Site,” Journal
Related U.S. Application Data of Molecular Biology, 350: 145-155 (2005). Parks, et al., “Expres
sion and Puri?cation of a Recombinant Tobacco Etch Virus Nia
(60) Provisional application No. 61/324,972, ?led on Apr.
Proteinase: Biochemical Analyses of the Full-Length and a Naturally
1 6, 2010.
Occurring Truncated Proteinase Form,” Virology, 210: 194-201
(1995).
(51) Int. Cl.
Rothman, et al., “How Does an Enzyme Evolved In vitro Compare to
C12N 9/50 (2006.01) Naturally Occurring Homologs Possessing the Targeted Function?
(52) U.S. Cl. Tyrosine Aminotransferase from Aspartate Aminotransferase,” J our
nal of Molecular Biology, 327: 593-608 (2003).
USPC ........................................................ .. 435/219
Tozser, et al., “Comparison of the substrate speci?city of two
(58) Field of Classi?cation Search ...................... .. None
potyvirus proteases,” FEBS Journal, 272: 514-523 (2005).
See application ?le for complete search history.
Verchot, et al., “Mutational Analysis of the Tobacco Etch Potyviral
3 5-kDa Proteinase: Identi?cation of Essential Residues and Require
(56) References Cited
ments for Autoproteolysis,” Virology, 190: 298-306 (1992).
Walker, et al., “Enzyme Engineering—The Design and Construction
FOREIGN PATENT DOCUMENTS of Novel Enzymes,” Molecular Biology and Biotechnology, London,
W0 WO 00/20619 A2 4/2000 Royal Society of Chemistry, Chapter 17: 377-388 (1989).
OTHER PUBLICATIONS * cited by examiner
Joseph et al., Arch. Virol. 145:2493-2502, 2000*
UniProt Accession No. Q9QBT7, Mar. 2010, 3 pages.* Primary Examiner * David J Steadman
Aharoni, et al., “The ‘evolvability’ of promiscuous protein func (74) Attorney, Agent, or Firm * Kirk Baumeister
tions,” Nature Genetics, 37(1): 73-76 (2005).
Anindya, et al.Potyviral NIa Proteinase, a Proteinase With Novel (57) ABSTRACT
Deoxyribonuclease Activity, The Journal of Biological Chemistry,
The present invention relates to potato virus NIa protease
279(31): 32159-32169 (2004).
variants or fragments thereof, polynucleotides encoding
Bazan, et al., “Viral cysteine proteases are homologous to the trypsin
like family of serine proteases: Structural and functional implica them, and methods of making and using the foregoing.
tions,” Proceedings of the National Academy of Science USA, 85:
7872-7876 (1988). 3 Claims, No Drawings
US 8,426,186 B2
1 2
ENGINEERED POTATO VIRUS A NUCLEAR 1995), that exhibit an extended P6-P1' recognition sequence
INCLUSION PROTEIN EXXYXQ*(S/G) (SEQ ID NO: 69) (Dougherty et al., Virol
ogy, 171:356-364, 1989). Although there are striking simi
CROSS-REFERENCE TO RELATED larities in the recognition sequence for NIa proteases across
APPLICATIONS the potyvirus members, each protease is highly speci?c for its
oWn target sequence (ToZer et al., The FEBS J. 272:514-523,
This application claims priority to US. Provisional Appli 2004). Structurally, NIa proteases appear to be related to
cation Ser. No. 61/324,972, ?led 16 Apr. 2010, the entire trypsin-like serine proteases through divergent evolution
contents of Which is incorporated herein by reference in its involving replacement of NIa catalytic cysteine by serine in
entirety.
the trypsin-like proteases (BaZan and Fletterick, Proc. Natl.
Acad. Sci. 85:7872-7876, 1988). NIa and trypsin-like serine
FIELD OF THE INVENTION
proteases share a similar overall 3-dimensional protein fold as
Well as the spatial proximity of their respective catalytic resi
The present invention relates to potato virus NIa protease
dues. The 3C-like family of cysteine proteases offers several
variants or fragments thereof, polynucleotides encoding
advantages over more complex extracellular proteases. They
them, and methods of making and using the foregoing.
can be easily produced in the cytosol of bacteria, have no
BACKGROUND OF THE INVENTION disul?de bonds, and have an extended substrate recognition
sequence. The challenge of using the 3C-like proteases is
Considerable effort has been employed to engineer 20 their activity loss in non-reducing conditions due to oxidation
enZymes and other proteins to achieve higher selectively and/ of active site and/or surface exposed cysteines, therefore lim
or speci?c activity (Matsumura and Ellington, J. Mol. Biol. iting theiruse (Higaki et al., Cold Spring Harbor Symposia on
305:331-339, 2001; Rothman and Kirsch, J. Mol. Biol. 327: Quantitative Biology, 615-621, 1987). Therefore, the pro
593-608, 2003; Aharoni et al., Nature Genetics, 37:73-76, teases require reducing agent to sustain their functional activ
2005). Human trypsin-like serine proteases are an appealing 25 ity (Nunn et al., J. Mol. Biol. 350:145-55, 2005; Birch et al.,
target for engineering With the goal to tailor proteases to Protein Expression and Puri?cation 6:609-18, 1995). Thus,
recogniZe a speci?c, prede?ned primary sequence Within a there is a need for engineered plant viral proteases that remain
target protein that is normally not recognized, resulting in active in the absence of exogenous reducing agents.
speci?c spatial and temporal modulation of target activity.
Trypsin-like serine proteases are also valuable research tools 30 SUMMARY OF INVENTION
in molecular biology.
Manufacturing of trypsin-like serine proteases poses chal One aspect of the invention is an isolated polypeptide
lenges due to their structural complexity related to the encoding a NIa protease variant, Wherein the variant is resis
required appropriate disul?de bond formation and proper tant to oxidation and retains activity.
processing of the native globular polypeptide chain for activ 35 Another aspect of the invention is an isolated polypeptide
ity. Furthermore, trypsin-like serine proteases often have a comprising a polypeptide having the sequence shoWn in SEQ
constricted recognition sequence limiting the absolute speci ID NO: 1 having amino acid substitutions selected from the
?city that can be engineered into the molecules. (Gosalia et group consisting of:
al., Mol. Cell. Proteomics, 4:626-36, 2005, US Pat.Appl. No. a. cysteine at position 19 is substituted for serine or valine;
US20040072276A1). An alternative to human trypsin-like 40 b. cysteine at position 110 is substituted for serine;
serine proteases, intracellular plant viral proteases that are c. cysteine at position 151 is substituted for serine or ala
easier to manufacture could be used as a starting point to nine.
develop therapeutics as Well as neW research tools. d. cysteine at position 181 is substituted for serine; and
Potyviruses are a class of plant viruses transmitted mainly e. cysteine at position 211 is substituted for serine.
by aphids, causing signi?cant losses in pasture, agricultural, 45 Another aspect of the invention is an isolated polypeptide
horticultural and ornamental crops annually. Typical repre comprising a polypeptide having the sequence shoWn in SEQ
sentatives of potyviruses are Potato virus A (PVA), tobacco ID NO: 28.
etch virus (TEV) and tobacco vein mottling virus (TVMV). Another aspect of the invention is isolated polynucleotides
Potyvirus monopartite genome contains (+) stranded RNA, encoding the polypeptides of the invention.
covalently linked to a viral encoded protein (V Pg) at the 50 Another aspect of the invention is a vector comprising an
5'-end and polyadenylated at the 3'-end (Dougherty et al., The isolated polynucleotide encoding a polypeptide of the inven
EMBO J. 7:1281-1287, 1988). The genome serves as an tion.
mRNA and a template for the synthesis of a complementary Another aspect of the invention is an isolated host cell
(—) stranded RNA by a polymerase translated from the viral comprising the vector of the invention.
genome. Upon entry into the cell, the virus RNA binds to 55 Another aspect of the invention is a method for expressing
endogenous ribosomes and the genome is translated as a the polypeptides of the invention.
single polypeptide chain. The large single polyprotein is sub
sequently processed into mature proteins by three virus-en DETAILED DESCRIPTION OF THE INVENTION
coded proteases (Verchot et al., Virology, 190:298-306,
1992), the ?rst protein (P1), the helper component (HC), and All publications, including but not limited to patents and
the nuclear inclusion protein (NIa) proteases. The NIa pro patent applications, cited in this speci?cation are herein
tease is responsible for the majority of the polyprotein pro incorporated by reference as though fully set forth.
cessing, including the generation of mature RNA replication As used herein and in the claims, the singular forms “a,”
associated proteins and capsid proteins (Verchot et al., “and,” and “the” include plural reference unless the context
Virology, 190:298-306, 1992). 65 clearly dictates otherWise. Thus, for example, reference to “a
The NIa proteases belong to the family of picomavirus 3C polypeptide” is a reference to one or more polypeptides and
cysteine proteases (Parks et al., Virology, 210:194-201, includes equivalents thereof knoWn to those skilled in the art.
US 8,426,186 B2
3 4
Unless de?ned otherwise, all technical and scienti?c terms glutamate); (2) basic (lysine, arginine histidine), (3) aliphatic
used herein have the same meaning as commonly understood (glycine, alanine, valine, leucine, isoleucine, serine, threo
by one of ordinary skill in the art to Which an invention nine), With serine and threonine optionally be grouped sepa
belongs. Although any compositions and methods similar or rately as aliphatic-hydroxyl; (4) aromatic (phenylalanine,
equivalent to those described herein can be used in the prac tyrosine, tryptophan); (5) amide (asparagine, glutamine); and
tice or testing of the invention, exemplary compositions and (6) sulfur-containing (cysteine and methionine) (Stryer (ed.),
methods are described herein. Biochemistry, 2nd ed, WH Freeman and Co ., 1981). Whether
The term “Nla protease” as used herein refers to the potato a change in the amino acid sequence of a polypeptide or
virus A (PVA) Nla protease encoded by amino acids 2032 fragment thereof encoded by a variant polynucleotide results
2264 of the virus proprotein shoWn in GenBank Acc. No. in a functional homolog can be readily determined by assess
CAB58238. The polypeptide sequence of the Nla protease is ing the ability of the modi?ed polypeptide or fragment to
shoWn in SEQ ID NO: 1. produce a response in a fashion similar to the unmodi?ed
The term “polypeptide” as used herein refers to a molecule polypeptide or fragment using the assays described herein.
that comprises at least tWo amino acid residues linked by a Peptides, polypeptides or proteins in Which more than one
peptide bond to form a polypeptide. Small polypeptides of replacement has taken place can readily be tested in the same
less than 50 amino acids may be referred to as “peptides”. manner.
Polypeptides may also be referred as “proteins.” The term “Wild type” or “WT” refers to a polypeptide or a
The term “polynucleotide” as used herein refers to a mol polynucleotide that has the characteristics of that polypeptide
ecule comprising a chain of nucleotides covalently linked by or polynucleotide When isolated from a naturally occurring
a sugar-phosphate backbone or other equivalent covalent 20 source. An exemplary Wild type polynucleotide is a poly
chemistry. Double and single stranded DNAs and RNAs are nucleotide encoding a gene that is most frequently observed
typical examples of polynucleotides. in a population and is thus arbitrarily designated the “normal”
The term “complementary sequence” means a second iso or “reference” or “Wild type” form.
lated polynucleotide sequence that is antiparallel to a ?rst The term “activity” or “active” as used herein refers to an
isolated polynucleotide sequence and that comprises nucle 25 active Nla protease, e.g., a Nla protease capable of cleaving
otides complementary to the nucleotides in the ?rst poly its substrate. Exemplary substrates are synthetic peptides cor
nucleotide sequence. Typically, such “complementary responding to identi?ed recognition sequences, for example
sequences” are capable of forming a double-stranded poly SEVVLFQASS (SEQ ID NO: 70), SEAVYTQGSS (SEQ ID
nucleotide molecule such as double-stranded DNA or NO: 71), or SENVTFQGSS (SEQ ID NO: 72), as described in
double-stranded RNA When combined under appropriate 30 Table 5. and in Mertis et al., (Mertis et al., J. Gen. Virol.
conditions With the ?rst isolated polynucleotide sequence. 83: 121 1-1221, 2002). Partial cleavage of the substrate is suf
The term “varian ” as used herein refers to a polypeptide or ?cient for effective biological activity of the protease, for
a polynucleotide that differs from a reference “Wild type” example cleavage of 50%, 60%, 70%, 80%, 90%, 95%, or
polypeptide or a polynucleotide and may or may not retain 99% of a substrate. Thus, biological activity does not require
essential properties. Generally, differences in sequences of 35 complete cleavage of the substrate. “Partially active” refers to
the Wild type and the variant are closely similar overall and, in a Nla protease that partially cleaves its substrate.
many regions, identical. A variant may differ from the Wild The term “resistant to oxidation” or “oxidation resistant”
type in its sequence by one or more modi?cations for as used herein means that the Nla protease variant is active
example, substitutions, insertions or deletions of nucleotides and functionally stable in the absence of a reducing agent that
or amino acids. Substitutions or insertions may result in con 40 is required for functional stability of the Wild type Nla pro
servative or non-conservative amino acid substitutions, or in tease. The reducing agent required for the activity of the Wild
the generation of a stop codon. A variant of a polynucleotide type Nla protease can be dithiotreitol (DTT), 2-mercaptoet
may be naturally occurring, and may have 70%, 75%, 80%, hanol or tris carboxyethylphosphate (TCEP), typically in the
85%, 90%, 95%, 96%, 97%, 98%, or 99% identity With the range of 01-10 mM.
Wild type polynucleotide. 45 “Heterologous amino acid sequence” as used herein refers
It is possible to modify the structure or function of the to an amino acid sequence not naturally fused to the Nla
polypeptides encoded by variant polynucleotide sequences protease polypeptide. Heterologous amino acid sequences
for such purposes as enhancing activity, speci?city, stability, can be attached to either the N- or C-terminus of the Nla
solubility, and the like. A replacement of a codon encoding protease polypeptide using standard methods. The heterolo
leucine With codons encoding isoleucine or valine, a codon 50 gous sequences can be used to provide a tag for fusion protein
encoding an aspartate With a codon encoding glutamate, a puri?cation, such as attachment of polyhistidine or glutamine
codon encoding threonine With a codon encoding serine, or a S-transferase tags, or to increase half life of the Nla protease,
similar replacement of codons encoding structurally related such as attachment of a constant domain of an immunoglo
amino acids (i.e., conservative mutations) Will, in some bulin or albumin, or fragments thereof. Heterologous amino
instances but not all, not have a major effect on the biological 55 acid sequences can be fused to the polypeptide using Well
activity of the resulting molecule. Conservative replacements knoWn methods, for example chemical coupling, or via an
are those that take place Within a family of amino acids that amide bond. An immunoblogulin hinge or a fragment thereof,
share chemically related side chains. Naturally occurring a fragment of a variable region of an immunoglobulin, or a
amino acids can be divided into four families based on their linker can also be fused to the Nla protease polypeptide.
side chains: (1) acidic (aspartate, glutamate); (2) basic 60 The term “vector” means a polynucleotide capable of
(lysine, arginine, histidine); (3) nonpolar (alanine, valine, being duplicated Within a biological system or that can be
leucine, isoleucine, proline, phenylalanine, methionine, tryp moved betWeen such systems. Vector polynucleotides typi
tophan); and (4) uncharged polar (glycine, asparagine, cally contain elements, such as origins of replication, poly
glutamine, cysteine, serine, threonine, tyrosine). Phenylala adenylation signal or selection markers, that function to
nine, tryptophan, and tyrosine are sometimes classi?ed 65 facilitate the duplication or maintenance of these polynucle
jointly as aromatic amino acids. Alternatively, naturally otides in a biological system. Examples of such biological
occurring amino acids can be grouped as (1) acidic (aspartate, systems may include a cell, virus, bacteria, animal, plant, and
US 8,426,186 B2
5 6
reconstituted biological systems utilizing biological compo Another embodiment of the invention is an isolated
nents capable of duplicating a vector. The polynucleotides polypeptide comprising a polypeptide having the sequence
comprising a vector may be DNA or RNA molecules or shoWn in SEQ ID NO: 1 having substitutions selected from
hybrids of these. the group consisting of:
The term “expression vector” means a vector that can be a. cysteine at position 19 is substituted for serine or valine;
utiliZed in a biological system or a reconstituted biological b. cysteine at position 110 is substituted for serine;
system to direct the translation of a polypeptide encoded by a c. cysteine at position 151 is substituted for serine or ala
polynucleotide sequence present in the expression vector. nine.
The present invention provides NIa protease variants that d. cysteine at position 181 is substituted for serine; and
are resistant to oxidation, polynucleotides encoding the vari e. cysteine at position 211 is substituted for serine.
ants, vectors comprising these polynucleotides, isolated host The polypeptides of the invention may comprise fusion
cells, methods for expressing the polypeptides of the inven polypeptides comprising a polypeptide of the invention fused
tion, and methods of using the polynucleotides and polypep With a heterologous polypeptide. Such heterologous polypep
tides of the invention. The variants of the invention are useful tides may be leader or secretory signal sequences, a pre- or
as research tools, and can be used, e.g., to cleave fusion pro- or prepro-protein sequence, a Histidine tag (His-tag)
proteins to remove tags. (GentZ et al., Proc. Natl. Acad. Sci. (USA) 861821-284,
One embodiment of the invention is an isolated polypep 1989), the HA peptide tag (Wilson et al., Cell 371767-778,
tide encoding a NIa protease variant, Wherein the variant is 1984), glutathione-S-transferase, ?uorescent tags such as
resistant to oxidation and retains its activity. In oxidiZing green ?uorescent protein (GFP), and the like. Exemplary NIa
20
conditions, i.e., in the absence of a reductant, the Wild type protease variantiHis-tag fusion proteins have amino acid
NIa aggregates and becomes inactive (Example 1). sequences shoWn in SEQ ID NOs1 37, 38 or 39. In one aspect,
In another embodiment, the NIa protease variant resistant the NIa protease variant polypeptide is fused to an immuno
to oxidation and retaining its activity has at least one cysteine globulin constant domain or a fragment thereof. Such con
residue substituted. Other variants may have 2, 3, 4 or 5 25 structs are Well knoWn and are described in eg US. Pat. Nos.
cysteine residues substituted. The Wild type NIa protease 5,116,964, 5,709,859, 6,018,026; WO 04/002417; WO
shoWn in SEQ ID NO: 1 has a total of ?ve cysteines1 one 04/002424; WO 05/081687; and WO 05/032460. Immuno
active site cysteine at position 151, and four cysteines at globulin constant domain may be a CH1, CH2, or a CH3
positions 19, 1 10, 181 and 21 1 Which, based on crystal struc domain, or a hinge region, and can be derived from IgG1,
ture predictions are on the surface of the protease and thus 30 IgG2, IgG3, IgG4, IgA, IgM, or IgA. The NIa protease variant
susceptible to oxidation. Exemplary substitutions are substi polypeptide can be fused to an immunoglobulin constant
tutions for serine, valine or alanine. Sequences of exemplary domain or a fragment thereof via a linker, for example a
NIa protease variants are shoWn in Table 2. glycine-rich linker, or via a fragment of an immunoglobulin
Variants of the invention can be made by Well knoWn variable region. Such linkers and variable region fragments
35
methods, for example site-directed or random mutagenesis are described in eg WO08/011,446 and US. Pat. No. 5,908,
(Kunkel, Proc. Natl. Acad. Sci. USA, 821488-492, 1985; 626. Exemplary fusion proteins can be formed by conjugating
Weiner et al., Gene, 1511119-123, 1994; Ishii et al., Methods together a NIa protease variant having an amino acid
EnZymol., 293153-71, 1988), or by chemical synthesis (US. sequence shoWn in SEQ ID NO: 28 and one or more domains
Pat. Nos. 6,670,127, 6,521,427). Rational design can be 40 derived from or similar to an immunoglobulin domain, such
employed to design variants anticipated to have speci?c effect as CH1, CH2, and CH3 domain.
on structure or activity of the Wild type protease. Whether a Another embodiment of an invention is an isolated
change in the amino acid sequence of a polypeptide or frag polypeptide comprising a polypeptide having the sequence
ment thereof results in a functional homolog can be readily shoWn in SEQ ID NO: 28.
determined by assessing the ability of the variant polypeptide 45 In another embodiment, the invention provides for an iso
or fragment to produce a response in a fashion similar to the lated polypeptide comprising a polypeptide having the
Wild type polypeptide or fragment using the assays described sequence shoWn in SEQ ID NO: 28.
herein. Peptides, polypeptides or proteins in Which more than The polypeptides of the invention can be lyophiliZed for
one replacement has taken place can readily be tested in the storage and reconstituted in a suitable carrier prior to use. An
same manner. Exemplary assays assessing protease activity 50 exemplary carrier is phosphate buffered saline. This tech
nique has been shoWn to be effective With conventional pro
measure ?uorescence released by a ?uorophore/quencher
tein preparations. LyophiliZation and reconstitution tech
substrate peptide such as 4-(4-dimethylaminophenylaZo)
benZoyl (DABCYL)-YGENVTFQGSK-5-[(2-aminoethyl) niques are Well knoWn in the art, see e.g., Rey and May, Drugs
and the Pharmaceutical Sciences Vol. 137, 1999; Wang, Int. J.
amino]naphthalene-l-sulfonic acid (EDANS) (SEQ ID NO:
55 Pharm. 20311-60, 2000. These techniques alloW for the devel
73) upon proteolysis, or evaluate cleavage of a peptide sub
opment of protein formulations With increased long term
strate on SDS-PAGE after protease cleavage.
stability, including storage at room temperature, as Well as
The polypeptides of the invention may be produced by
easier geographical distribution. This process also affords the
chemical synthesis, such as solid phase peptide synthesis on protein to be used at higher concentrations by adjusting the
an automated peptide synthesiZer. Alternatively, the polypep 60 reconstitution procedure.
tides of the invention can be obtained from polynucleotides Another aspect of the invention is isolated polynucleotides
encoding these polypeptides by the use of cell-free expres encoding any of the polypeptides of the invention or their
sion systems such as reticulocyte lysate based expression complement. Certain exemplary polynucleotides are dis
systems or by expression and isolation from cells harboring a closed herein, hoWever, other polynucleotides Which, given
nucleic acid sequence of the invention by Well knoWn tech 65 the degeneracy of the genetic code or codon preferences in a
niques, such as recombinant expression of easily isolated given expression system, encode the NIa protease variants of
a?inity labeled polypeptides. the invention are also Within the scope of the invention.
US 8,426,186 B2
7 8
Exemplary polynucleotides are polynucleotides comprising 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring
the nucleic acid sequence shown in SEQ ID NOs: 41-43 and Harbor, N.Y., 2001). These methods include calcium phos
46-48. phate transfection, DEAE-Dextran mediated transfection,
The polynucleotides of the invention may be produced by microinjection, cationic lipid-mediated transfection, elec
chemical synthesis such as solid phase polynucleotide syn troporation, transduction, scrape loading, ballistic introduc
thesis on an automated polynucleotide synthesizer. Alterna tion and infection.
tively, the polynucleotides of the invention may be produced Another embodiment of the invention is a method for
by other techniques such a PCR based duplication, vector expressing a polypeptide comprising the steps of providing a
based duplication, or restriction enZyme based DNA manipu host cell of the invention and culturing the host cell under
lation techniques. Techniques for producing or obtaining conditions su?icient for the expression of at least one
polynucleotides of a given knoWn sequence are Well knoWn in polypeptide of the invention. The polypeptides of the inven
the art. tion comprise polypeptides having an amino acid sequence
The polynucleotides of the invention may also comprise at shoWn in SEQ ID NOs: 2-34 and 37-39.
least one non-coding sequence, such as transcribed but not Host cells can be cultured under any conditions suitable for
translated sequences, termination signals, ribosome binding maintaining or propagating a given type of host cell and
sites, mRNA stabiliZing sequences, introns and polyadenyla suf?cient for expressing a polypeptide. Culture conditions,
tion signals. media, and related methods su?icient for the expression of
Another embodiment of the invention is a vector compris polypeptides are Well knoWn in the art. For example, many
ing an isolated polynucleotide encoding polypeptides of the mammalian cell types can be aerobically cultured at 370 C.
invention. 20 using appropriately buffered DMEM media While bacterial,
Another embodiment of the invention is a vector compris yeast and other cell types may be cultured at 370 C. under
ing an isolated polynucleotide having a sequence shoWn in appropriate atmospheric conditions in LB media.
SEQ ID NO: 42 or 47. The vectors of the invention are useful In the methods of the invention the expression of a
for maintaining polynucleotides, duplicating polynucle polypeptide can be con?rmed using a variety of different
otides, or driving expression of a polypeptide encoded by a 25 techniques Well knoWn in the art. For example, expression of
vector of the invention in a biological system, including a polypeptide can be con?rmed using SDS page, detection
reconstituted biological systems. Vectors may be chromo reagents, such as antibodies or receptor ligands speci?c for an
somal-, episomal- and virus-derived such as vectors derived expressed polypeptide, or using for example FACS or immu
from bacterial plasmids, bacteriophages, transposons, yeast no?uorescent techniques.
episomes, insertion elements, yeast chromosomal elements, 30 Other features of the invention Will become apparent in the
baculoviruses, papova viruses such as SV40, vaccinia course of the folloWing descriptions of exemplary embodi
viruses, adenoviruses, fowl pox viruses, pseudorabies ments Which are given for illustration of the invention and are
viruses, picornaviruses and retroviruses and vectors derived not intended to be limiting thereof.
from combinations thereof, such as cosmids and phagemids.
The vectors of the invention can be formulated in micro 35 Example 1
particles, With adjuvants, lipid, buffer or other excipients as
appropriate for a particular application. Generation and Characterization of NIa Variants
In one embodiment of the invention the vector is an expres
sion vector. Expression vectors typically comprise nucleic Cloning and Mutagenesis
acid sequence elements that can control, regulate, cause or 40 The amino acid sequence of potato virus A NIa protease
permit expression of a polypeptide encoded by such a vector. (Genbank Acc. No. CAB58238, amino acids residues 2032
Such elements may comprise transcriptional enhancer bind 2263), shoWn in SEQ ID NO: 1, including an N-terminal
ing sites, RNA polymerase initiation sites, ribosome binding poly-histidine tag for af?nity puri?cation Was back translated
sites, and other sites that facilitate the expression of encoded into a cDNA sequence optimiZing codon usage. The full
polypeptides in a given expression system. Such expression 45 length cDNA Was generated by parsing the sequence into
systems may be cell-based, or cell-free systems Well knoWn smaller fragments and synthesiZing these as oligonucleotides
in the art. Nucleic acid sequence elements and parent vector using GENEWRITERTM technology and puri?ed by RP
sequences suitable for use in the expression of encoded HPLC (Dionex, Germany). The puri?ed oligonucleotides
polypeptides are also Well knoWn in the art. Were then assembled into a full-length, double stranded
Another embodiment of the invention is an isolated host 50 cDNA fragment as described in US. Pat. No. 6,670,127 and
cell comprising a vector of the invention. Representative host US. Pat. No. 6,521,427.
cell examples include Archaea cells; bacterial cells such as The cDNA from the gene assembly process Was cloned
Streptococci, Staphylococci, Enterococci, E. coli, Streptomy into the pET9d vector (Novagen, Madison, Wis.) into NcoI/
ces, cyanobacteria, B. sublilis and S. aureus; fungal cells such XhoI sites using standard protocols. Mutagenesis targeting
as Kluveromyces, Saccharomyces, Basidomycete, Candida 55 active site cysteine and surface sulfydryl changes Was done
albicans or Aspergillus; insect cells such as Drosophila S2 using the QuikChange site-directed mutatgenesis kit (Strat
and Spodoplera Sf9; animal cells such as CHO, COS, HeLa, agene, La Jolla, Calif.) using oligonucleotides shoWn in Table
C127, 3T3, BHK, 293, CV-1, BoWes melanoma and 1. Protein sequence alignments and the solved crystal struc
myeloma; and plant cells, such as gymnosperrn or tures of TEV NIa protease ((Allison et al., Virology 154:9-20,
angiosperm cells. The host cells in the methods of the inven 60 1986; Phan et al., J. Biol. Chem. 277:50564-72, 2002) Were
tion may be provided as individual cells, or populations of used to estimate Whether the unpaired cysteine residues in
cells. NIa protease Were surface exposed. As they all appeared to be
Introduction of a polynucleotide, such as a vector, into a surface exposed, all Were targeted for point mutations. As a
host cell can be effected by methods Well knoWn to those ?rst pass, all except the active site cysteine Were changed to
skilled in the art (Davis et al., Basic Methods in Molecular 65 serine residues.
Biology, 2'” ed., Appleton & Lange, NorWalk, Conn., 1994; The cysteine residue at position 19 did not tolerate the
Sambrook et al., Molecular Cloning: A Laboratory Manual, serine substitution, as indicated by a lack of protein expres
US 8,426,186 B2
9 1 0
sion (see below). Consequently, position 19 Was randomized TABLE 2-continued
using an NNK oligo in a QuikChange site-directed mutagen
esis reaction using standard protocols. Variants With tolerated Nla Variant SEQ 113 N01 DNA
substitutions at residue 19 Were identi?ed by'prote1n expres- clgwcl 10S/C181S/C211S 20
s1on (see below). C151S active site substitutions Were mtro- 5 C19L/C110S/C181S/C211S 21
duced into these variants as described above, to assess the C19M/C110S/C181S/C211S 22
differences in catalytic activity. Generated variants and their C19N/C110S/C181S/C211S 23
. .d h . T M 2 E 1 C19P/C1108/C1818/C2118 24
ammo ac1 sequences are s own in' a e . xemp ary C19Q/C110S/C181S/C211S 25
cDNA sequences are shoWn for the Wild type NIa (SEQ ID C191Uc110s/c131s/c211s 26
NO: 40) and for the following NIa variants: C151S (SEQ ID 10 C19T/C110S/C181S/C211S 27
NO: 41), C19V/C110S/C181S/C211S (SEQ ID NO: 42), Six/2111100221 1881158222111; 3289* 42
WT (WEQ ID NO: 44), WT-H1s6 (SEQ ID NO: 45), C151'S- C110S/C151S/C181S/C211S 31
His6 (SEQ ID NO: 46), C19V/C110S/C181S/C211S-H1s6 Cling/C2115 32
(SEQ ID NO: 47), and C19V/C110S/C151S/C181S/C211S- 15 C19v/C1108/C1518/C1818/C2118 33 43
His6 (SEQ ID NO: 48).
TABLE 2
Oligo Sequence SEQ ID NO:
PVAH6 - 51 CTAACCATGGGCTCTACCTCTATGTTCCGTGGTGTTCGTGACTACAA 4 9
PVAH6 - 3 1 GTTACTCGAGTTATTAATGGTGATGGTGATGGTGGGTAACCAGTTTAACGG 5 o
c151s- 51 CTACCAAAGACGGTCAGAGCGGTTCTCCGATCGTTTC 51
c151s-31 GAAACGATCGGAGAACCGCTCTGACCGTCTTTGGTAG 52
c151A- 51 CTCTACCAAAGAAGGTCACGCCGGTTCTCCGATCGTTTC 53
c151A- 3 1 GAAACGATCGGAGAACCGGCGTGACCTTCTTTGGTAGAG 54
c195 - 5 1 CCCGATCTCTTCTGTTATCAGCCAGCTGGAAAACGAATCTGAAGG 5 5
c195 -3 1 CCTTCAGATTCGTTTTCCAGCTGGCTGATAACAGAAGAGATCGGG 56
CllOS- 51 CGACCCACTCTGAAAAAGTTAGCCTGATCCTGACCAACTTCCAG 57
c11os-31 CTGGAAGTTGGTCAGGATCAGGCTAACTTTTTCAGAGTGGGTCG 5s
Cl8lS- 51 CACCTCTAACTACTTCGCGAGCTTCCCGAAAGGTTTCACCG 59
C1815 - 3 1 CGGTGAAACCTTTCGGGAAGCTCGCGAAGTAGTTAGAGGTG 6 o
c211s- 51 CAACGCGTCTAACGTTAGCTGGGGTTCTTTCCACCTG 6 1
c211s- 3 1 CAGGTGGAAAGAACCCCAGCTAACGTTAGACGCGTTG 62
c19NNK-51 ACCCGATCTCTTCTGTTATCN'NKCAGCTGGAAAACGAATCTGAAG 63
Cl9NNK- 3 1 CTTCAGATTCGTTTTCCAGCTGMNNGATAACAGAAGAGATCGGGT 6 4
TABLE 2 TABLE 2-continued
NIa variant SEQ ID NO: DNA 50 NIa variant SEQ ID NO: DNA
WT 1 40 C151A 34
C1518 2 41 His6-WT 35 44
C1108 3 WT-His6 36 45
C1818 4 C151S-His6 37 46
C2118 5 55 C19V/C110S/C181S/C211S-His6 38 47
C198/C1108/C1818 6 C19V/C110S/C151S/C181S/C211S-His6 39 48
C198/C1108/C2118 7
Cl9S/Cl81S/C211S 8 *NIa variant has an amino acid sequence ofresidues 1-233 of SEQ ID NO: 38
C198/C1108/C1818/C2118 9
C1108/C1818 10 Protein Expression
CUOS/ C2115 11 60 Plasmids encoding cDNAs for the NIa protease variants in
CC11190NSC/1C1108S1/SC/1C8211S1/SC 211S 1132 Table 1 Were transformed i. n BL21 cells and si. ngle colon1. es
C19D/C1108/C1818/C2118 14 from the transformants cultured in LB media With 100 ug/ml
i2 kanamycin at +37° C. overnight. Induction took place When
C110S/C181S/C211S 17 the cultures reached OD600 of~0.6-0.~8 With 1 IPTQ, or
C19H/C1 log/clglg/cgllg 1g 65 by culturmg the cells in TB auto-induction med1a (Overnight
C19I/C1108/C1818/C2118 19 Express Autoinduction Media, EMD Biosciences, Gibb
stoWn, N.J.). The cells Were further cultured overnight at 25°
US 8,426,186 B2
11 12
C. or 180 C., centrifuged and stored at —80° C. All Nla conditions does the C151A variant With 4 free surface sulf
protease variants With a Wild-type C19 residue expressed very hydryls collapse to a predominantly single, monomeric spe
Well in all surface sulfhydryl change combinations explored
cies. HoWever, the proteases With all surface sulfhydryls
(Table 3).
changes behave as monomeric proteins in the complete
For the NNK library, the constructs Were screened for
absence of reducing agent. This suggests that these changes
soluble protein expression in TB auto induction media, as
provide a clear physical bene?t While retaining catalytic
described above. A Western blot Was run to analyZe the
expression of the NNK variants. activity (see beloW).
TABLE 3
Substitutions Plasmid
Variant C19 C110 C181 C211 C151 Number Expression Activity
Hiss-WT pDR1706 + +
WT pDR2090 + +
C1518 8 pDR2092 + +
C151A A pDR2091 +
C1108 8 pDK3385 +
C1818 8 pDK3388 +
C2118 8 pDK3390 +
C198/C1108/C1818 8 8 8 pDK3384 —
C198/C1108/C2118 8 8 8 pDK3383 —
C198/C1818/C2118 8 8 8 pDK3382 —
C198/C1108/C1818/C2118 8 8 8 8 pDR2371 —
C1108/C1818 8 8 pDK3386 +
C1108/C2118 pDK3387 +
C1108/C1818/C2118 8 8 8 pDK3202 + +
C1108/C1518/C1818/C2118 8 8 8 8 pDK3467 + +
C1818/C2118 8 8 pDK3389 +
C19V/C1108/C1818/C2118 V 8 8 8 pDK3217 + +
C19V/C1108/C1518/C1818/C2118 V 8 8 8 8 pDK3466 + +
30
Although several of the position 19 NNK variants Were Substrate and Activity Determination
detectable at loW levels (variants l, K, L, M, R, S, T, W, Y, F, A Wild-card recognition sequence, EXVXXQX (SEQ ID
G and H substitutions) (1 -2% of the Wild-type Nla), the NO: 74), Was used to search the polyprotein sequence of PVA
variant C19V Was expressed at signi?cantly higher level than to determine a consensus recognition sequence for the Nla
35 protease. This Was done independently of published Work
any other variant, and at a level equivalent to the Wild type
identifying the processing junction points Within the PVA
Nla. Based on the information, the folloWing variants Were
polyprotein (Mertis et al., J. General Virol., 83:1211-1221,
selected for further studies: WT, C1518, C110S/C181S/
2002). Published and potential recognition sequences, as Well
C2118, C110S/C151S/C181S/C211S, C19V/C110S/C1818/
as the consensus sequence determined in this study listed in
C2118 and C19V/C110S/C151S/C181S/C211S. 40 Table 4. Synthetic peptides corresponding to select recogni
Protein Puri?cation tion sequences Were synthesiZed using solid-phase peptide
Protein puri?cation Was done using standard methods in chemistry (Anaspec, San Jose, Calif.) and tested for cleavage
the presence of a reducing agent, 2 mM TCEP. Brie?y, cell by the Wild type Nla protease. Reactions Were performed in
pellets Were resuspended in Buffer A (20 mM tris-HCl, pH 20mM tris-HCl, pH 8.0, 150mM NaCl and 1mM dithiothrei
7.5, 500 mM NaCl, 2 mM TCEP) supplemented With 0.1 45 tol (DTT) containing 5 uM PVA Nla protease and 500 uM
U/ml benZonase and 0.3 mg/ml lysoZyme, soincated on ice, peptide and Were analyZed by reverse-phase HPLC and LC
?ltered, and the cleared lysates Were loaded onto a 5 ml M8.
HisTrap HP (GE Biosciences, PiscataWay, N.J.) column pre EnZyme activity Was also determined for each variant
equilibrated With buffer A using an AKTA Explorer puri?ca using a fusion substrate protein containing the Nla protease
tion system (GE Lifesciences, PiscataWay, N.J.). Proteins 50 consensus recognition sequence, ENVTFQG (SEQ ID
Were eluted using an imidaZole step gradient of 50-500 mM NO:65). The consensus sequence Was engineered into a
imidaZole in buffer A. Fractions Were analyZed by SDS fusion protein and used as a substrate to assess the enZymatic
PAGE and the fractions containing the protein of interest Were activity for all PVA Nla protease variants. Since the sequence
pooled and concentrated and ?ltered, folloWed by further contained a consensus site for N-linked glycosylation (NV T),
puri?cation by siZe exclusion chromatography (SEC). Con 55 another sequence Was explored, EAVTFQG (SEQ ID NO:
centrated and clari?ed samples Were loaded directly onto a 66), With equal success. These fusion proteins contained an
Superdex75 SEC matrix (GE Lifesciences, PiscataWay, N.J.) N-terminal poly-histidine tag to facilitate puri?cation, the
pre-equilibrated With bufferA and separated isocratically at a PNla protease consensus recognition sequence, an S-tag for
How rate of 1 ml/min. Fractions Were analyZed by SDS-PAGE sensitive detection of proteolytic cleavage and a highly
and the fractions containing protein Were pooled and tested 60 soluble “?ller” protein to facilitate soluble expression of the
for enZymatic activity. All puri?ed variants expressed Well fusion substrate protein. This cassette Was generated by
and Were puri?ed to over 95% purity. amplifying the region betWeen the 3' end of the thrombin
Some of the variants (C151A, C19V/C110S/C181S/ cleavage site and the Xhol site in pET41 (Novagen), adding
C2118 and C19V/C110S/C151S/C1818/C211S) Were also the recognition sequence and Ndel cloning site in the 5'
puri?ed in the absence of the reducing agent, 2 mM TCEP, in 65 primer and inserting into the Ndel and Xhol restriction sites
order to evaluate the effect of oxidiZing environment to pro of pET28 (Novagen). The “?ller” proteins could then be
tein expression, stability, and activity. Only under reducing inserted into the multiple cloning site pulled over from
US 8,426,186 B2
13 1 4
pET41. Polypeptide sequence of the fusion proteins With the The NIa protease active site variants (C15 1 S, C110S/C151S/
ENVTFQG and the EAVTFQG consensus recognition C181S/C211S, C19V/C110S/C151S/C181S/C211S) also
sequences are shoWn in SEQ ID NO: s 67 and 68, respectively. cleaved the substrate, albeit With less e?iciency (1 -5% of
As fusion substrate controls, analogous constructs Were substrate cleaved) When compared to the Wild type NIa (data
generated With both TEV (Dougher‘ty et al., Virology, 171: not shoWn).
356-364, 1989) and TVMV NIa protease recognition Enzyme Kinetics
sequences (Nallamsetty et al., Protein Expr. and Puri?c. Wild-type NIa protease and active site and surface cysteine
38:108-1 15, 2004) (Table 4). Analogous to human rhinovirus variants Were tested for activity against the ?uorophore/
3C(HRV3C) recognition sequence, a fusion protein With a P2' quencher substrate peptide 4-(4 -dimethylaminophenylaZo)
benZoyl (DABCYL)-YGENVTFQGSK-5-[(2-aminoethyl)
proline Was also generated for the consensus sequence and
tested as a substrate (Table 4). All recognition sequences Were amino]naphthalene-1-sulfonic acid (EDANS) (Anaspec, San
inserted into the fusion substrate protein, described above, Jose, Calif.). Kinetic measurements Were performed on a
including the published recognition sequences for TEV and Spectramax M2 microplate reader (Molecular Devices) using
TVMV proteases listed. Reactions Were performed in 20 mM an excitation Wavelength of 340 nm and emission Wavelength
Tris-HCl, pH 8.0, 150 mM NaCl and 1 mM DTT and alloWed of 490 nm. The reactions Were performed in 50 mM Tris-HCl,
to run overnight at 370 C. pH 8.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT With 2 mM
Although it has been shoWn that the substrate speci?city of enZyme and 01-300 uM substrate and folloWed for 30 min
3C-like proteases is very high (ToZer et al., The FEBS J. utes at 370 C. EnZyme concentrations Were determined from
272:514-523, 2004), NIa Wild type protease Was able to the calculated theoretical extinction coe?icient. Initial veloci
cleave the fusion substrate With the TVMV NIa protease 20 ties Were determined for each and are shoWn in Table 5.
recognition sequence, although at a much loWer rate than the
PVA NIa protease consensus sequence. HoWever, the NIa TABLE 5
Wild type protease Was unable to cleave either the TEV NIa
protease recognition sequence or the PVA NIa protease con
Plasmid (RFU/ Km Relative °
sensus sequence With a P2' proline residue in this format, the 25 Variant Number DTT min) (uM) Kan/Km
latter suggesting some level of P2' speci?city (Table 4).
WT pDR2090 + 78466 177.6 100
C151S pDR2092 + 3236 164.9 4.3
TABLE 4
C110S/C181S/C211S pDK3202 + 51110 251.5 45.9
C110S/C151S/C181S/ pDK3467 + 2346 71.8 7.6
Cleaved
C211S
Recognition S EQ ID Synthetic S EQ ID by
C19V/C110S/C181S/ pDK3217 + 75184 275.4 59.5
Junction* Sequence NO: Peptide* * NO: NIa
C211S
C19V/C110S/C151S/ pDK3466 + 1888 39.6 10.8
P3/ 6K1 EVVLFQAA 75 SEVVLFQASS 70 Yes
C181S/C211S
C19V/C110S/C181S/ pDK3217 — 53847 175.4 69.1
35 C211S
VPg/Pro ESVEFES 79 C19V/C110S/C151S/ pDK3466 — 1358 43.1 7.1
C181S/C211S
NIa/NIb EAVYTQGA 80 SEAVYTQGSS 71 Yes
NIb/ cap DMVYFQA 81
NA ENVTKQLA 82 SENVTKQLSS 87 No The substitutions to the surface exposed cysteine residues
NA EMVTNQSA 83 SEMVTNQS S S 8 8 No
had a minor effect on catalytic activity of NIa protease,
Consensus ENVTFQG 65 SENVTFQGSS 72 Yes 40
ENVTFQGP 84 No Whereas substitutions at the active site cysteine (C151)
TEV ENLYGQGS 85 No reduced activity signi?cantly. This can be explained by the
TVMV ETVRFQGS 86 Yes inability of the substituted serine to donate its hydroxyl pro
ton required for catalysis in the micro-environment Within the
*As determined in Mertis et. al., 2002.
active site, Whereas deprotonation of cysteine readily occurs
ASequences that met the EXVXXQX search criteria and from Which the consensus sequence 45
peptide Was generated at physiological pH.
*Synthetic peptide used in the assays
HoWever, to determine Whether having a reducing agent
The Wild type NIa protease and variants C151S, C110S/ present during the puri?cation process as Well as during activ
C181S/C211S, C110S/C151S/C181S/C211S, C19V/C110S/ ity measurements impacted only molecules With an active site
C181S/C211S and C19V/C1 10S/C151S/C181S/C21 1S Were cysteine; tWo PVA NIa protease variants (C19V/C110S/
50
screened for activity against the fusion substrate protein With C181S/C211S and C19V/C110S/C151S/C181S/C211S)
the ENVTFQG (SEQ ID NO: 66) consensus recognition site. Were puri?ed and assayed in the absence of reductant. The
Reaction conditions Were identical to those described above. absence of reductant had little effect on the activity of either
Proteolytic cleavage of the substrate Was monitored by SDS variant (Table 5). This suggests that the active site cysteine in
PAGE. Each NIa protease With an active site cysteine residue these proteins may not be overly sensitive to an oxidiZing
environment and liability is predominantly due to the non
cleaved the substrate to completion under these conditions. active site cysteine residues.
SEQUENCE LISTING
<l60> NUMBER OF SEQ ID NOS: 88
<2lO> SEQ ID NO 1
<2ll> LENGTH: 233
<2l2> TYPE: PRT
US 8,426,186 B2
15 16
—cont inued
<2l3> ORGANISM: Potato Virus
<220> FEATURE:
<223> OTHER INFORMATION: NIa protease
<400> SEQUENCE: 1
Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser
1 5 15
Val Ile Cys Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu
25 30
Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn His Leu Phe
35 45
Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe
50 55 60
Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg
65 80
Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln
95
Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile
105 11O
Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr
115 120 125
Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile
130 135 140
Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp
145 150 155 160
Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser
165 170 175
Asn Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala
180 185 190
Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser
195 200 205
Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys
210 215 220
Glu Phe Lys Thr Val Lys Leu Val Thr
225 230
SEQ ID NO 2
LENGTH: 233
TYPE: PRT
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Potato virus C151S Mutant
<400> SEQUENCE: 2
Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser
1 5 15
Val Ile Cys Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu
25 30
Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn His Leu Phe
35 45
Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe
50 55 60
Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg
65
Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln
95
Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile
US 8,426,186 B2
17 18
—cont inued
100 105 110
Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr
115 120 125
Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile
130 135 140
Ser Thr Lys Glu Gly His Ser Gly Ser Pro Ile Val Ser Thr Thr Asp
145 150 155 160
Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser
165 170 175
Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala
180 185 190
Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser
195 200 205
Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys
210 215 220
Glu Phe Lys Thr Val Lys Leu Val Thr
225 230
SEQ ID NO 3
LENGTH: 233
TYPE: PRT
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Potato Virus C11OS Mutant
<400> SEQUENCE: 3
Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser
1 5 15
Val Ile Cys Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu
25 30
Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn His Leu Phe
35 45
Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe
50 55 60
Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg
65 80
Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln
95
Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile
105 110
Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr
115 120 125
Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile
130 135 140
Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp
145 150 155 160
Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser
165 170 175
Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala
180 185 190
Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser
195 200 205
Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys
210 215 220
Glu Phe Lys Thr Val Lys Leu Val Thr
225 230
Description:particles, With adjuvants, lipid, buffer or other excipients as appropriate for a particular . ammo ac1 sequences are s own in' a e . xemp ary.