Eimeria bovis infection modulates endothelial host cell cholesterol metabolism for successful ...

17 Pages·2015·2.21 MB·English

by  Penny H. Hamid

Hamidetal.VeterinaryResearch (2015) 46:100
DOI10.1186/s13567-015-0230-z VETERINARY RESEARCH
RESEARCH ARTICLE Open Access
Eimeria bovis
infection modulates
endothelial host cell cholesterol
metabolism for successful replication
Penny H. Hamid1*, Joerg Hirzmann1, Katharina Kerner2, Gerald Gimpl3, Guenter Lochnit4, Carlos R. Hermosilla1
and Anja Taubert1
Abstract
During first merogonyEimeria bovis forms large macromeronts in endothelial host cellscontaining >120 000
merozoites I. During multiplication, large amounts of cholesterol are indispensable for theenormous offspring
membrane production. Cholesterol auxotrophy was proven for other apicomplexanparasites. Consequently they
scavenge cholesterol from their host cell apparently in a parasite-specific manner. We here analyzed the influence
ofE. bovis infectionon endothelial host cell cholesterol metabolism and found considerable differences to other
coccidian parasites.Overall, free cholesterol significantly accumulated inE. bovis infected host cells. Furthermore, a
striking increaseof lipid droplet formation was observed within immature macromeronts.Artificial host cell lipid
droplet enrichment significantly improved E.bovis merozoite I production confirming the key role oflipid droplet
contents for optimal parasite proliferation. The transcription of several genes being involved in both, cholesterol de
novo biosynthesisand low density lipoprotein-(LDL) mediateduptake, was significantly up-regulated ata time in
infectedcellssuggestingasimultaneousexploitationofthesetwocholesterolacquisitionpathways.E.bovisscavenges
LDL-derivedcholesterolapparentlythroughsignificantlyincreasedlevelsofsurfaceLDLreceptorabundanceandLDL
binding to infected cells. Consequently, LDL supplementation significantly improved parasite replication. The
up-regulation of the oxidized LDL receptor 1 furthermore identified this scavenger receptor as a key molecule
in parasite-triggered LDL uptake. Moreover, cellular cholesterol processing was altered in infected cells as
indicated by up-regulation of cholesterol-25-hydroxylase and sterol O-acyltransferase. Overall, these results
showthatE.bovisconsiderablyexploitsthehostcellcholesterolmetabolismtoguaranteeitsmassiveintracellular
growthandreplication.
Introduction offspring membranebiosynthesis, large amountsofcholes-
Eimeria bovis represents one of the most pathogenic terolareindispensableforasuccessfulreplicationprocess.
Eimeria species causing cattle coccidiosis [1]. During its Coccidian parasites have been described as auxotrophic
long-lasting intracellular first merogony (14–18 days of in their capability to synthesize cholesterol by themselves
duration) E. bovis forms large macromeronts of up to [3–9]. Thus, cholesterol auxotrophy was reported for
400 μm in size containing ≥120 000 merozoites I within Toxoplasma gondii and Cryptosporidium parvum [4,7,9].
a parasitophorous vacuole (PV) in host endothelial cells In consequence these parasites scavenge cholesterol from
[2]. Given that the invading sporozoite stage alone their host cell thereby exploiting different cellular path-
cannot provide all components necessary for this nutri- ways.Interestingly,differentcholesterolauxotrophicpara-
ent and energy demanding process, the parasite needs to sites appear to follow different strategies of cholesterol
scavenge molecules from the host cell. Especially for the scavengesuggestingthemodulationof hostcellcholesterol
metabolism as a parasite-specific and/or host cell-specific
process. Coppens et al. [4] experimentally proved T. gondii
*Correspondence:[email protected]
asdeficientincholesterolbiosynthesisandshowedthatthis
1InstituteofParasitology,BiomedicalResearchCentre,JustusLiebig
UniversityGiessen,Schubertstr.81,D-35392Giessen,Germany parasite scavenges cholesterol from its host cell. However,
Fulllistofauthorinformationisavailableattheendofthearticle
©2015Hamidetal.OpenAccessThisarticleisdistributedunderthetermsoftheCreativeCommonsAttribution4.0
InternationalLicense(http://creativecommons.org/licenses/by/4.0/),whichpermitsunrestricteduse,distribution,and
reproductioninanymedium,providedyougiveappropriatecredittotheoriginalauthor(s)andthesource,providealinkto
theCreativeCommonslicense,andindicateifchangesweremade.TheCreativeCommonsPublicDomainDedicationwaiver
(http://creativecommons.org/publicdomain/zero/1.0/)appliestothedatamadeavailableinthisarticle,unlessotherwisestated.
Hamidetal.VeterinaryResearch (2015) 46:100 Page2of17
different strategies were described in different T. gondii-in- role of the host cellular cholesterol de novo synthesis for
fected host cell types. Thus, in contrast to macrophages parasite replication since treatments of E. bovis-infected
[10],T. gondii exclusively utilized cholesterol derived from cellswithinhibitorsofthemevalonatepathwaysignificantly
internalized LDL particles in CHO cells [4] whilst tran- blocked parasite proliferation [26]. However, detailed ana-
scriptomic data on infected fibroblasts indicated an lyses on this topic are lacking so far. Therefore we here
up-regulation of molecules being involved in the mevalo- conducted analyses on E. bovis-induced alterations of the
nate pathway [11]. The pivotal role of cholesterol was also mevalonate pathway, on lipid droplet formation and on
proven by exogenously supplied cholesterol which im- LDL-mediated cholesterol internalization and showed that
proved T. gondii replication [4]. Cholesterol is inserted in apparently this parasiteapplies comparable but also dif-
the parasite plasma membrane, the parasitophorous vacu- ferent strategies compared to other coccidian species to
olar membrane (PVM), sequestered in cholesterol-rich meet its needs for cholesterol for successful macromer-
organelles in T. gondii-infected host cells and is further- ont formation.
more esterified for lipid droplet deposition [4,12–14].
Accordingly, host and parasite esterification activity was Materials and methods
showntobeessentialforT.gondiiintracellulargrowth[15]. Parasite
Correspondingly, T. gondii infection leads to enhanced The E. bovis strain H used in the present study was ini-
cytoplasmic lipid droplet formation in skeletal muscle cell tially isolated from the field in Northern Germany [27]
cultures[16]. and maintained by passages in parasite-free male
By far less data on cholesterol scavenge is available from HolsteinFriesian calves [28].All animal procedures were
other coccidian parasites. Cryptosporidium parvum mainly performed according to the Justus Liebig University
acquires cholesterol from LDL particles and from micelles Animal Care Committee guidelines, approved by the
beinginternalizedbytheinfectedenterocytesbutonlytoa Ethic Commission for Experimental Animal Studies of
minor degree from host cellular de novo-synthesis [7]. The the State of Hesse (Regierungspräsidium Giessen, GI 18/
non-coccidianbutapicomplexanparasitePlasmodiumyoe- 10 No A37/2011, JLU-No 494) and in accordance to the
lii in principle salvages cholesterol in infected hepatocytes current GermanAnimalProtectionLaws.
from both host cellular pathways, [6,17] although host Foroocystsproduction,calveswereinfectedorallyatthe
cellular cholesterol acquisition does not appear to be age of 10 weeks with 3×105 sporulated E. bovis oocysts.
essential for its optimal proliferation [6]. The authors The oocysts were isolated from the faeces beginning 18
interpret these results by a moderate parasitic need of dayspostinfection(pi)accordingtothemethodofJackson
sterolsandbyanadaptivereactiontocholesterol-restricted [29].Thesporulationofoocystswasachievedbyincubation
conditions in terms of alternative source utilization. in a 2% (w/v) potassium dichromate (Merck) solution at
Abundant lipid droplet formation was also reported for room temperature (RT). Sporulated oocysts were stored in
P. berghei- or P. falciparum-infected host cells [18,19], 2% (w/v) potassium dichromate solution at 4 °C until fur-
but no cholesteryl ester formation was detected in Plas- ther use. Sporozoites were excysted from sporulated oo-
modium-infected cells, implying a lack of lipid storage cysts as previously described [30]. Free sporozoites were
activity [19–22] which may argue for a continuous washed three times in phosphate buffered-solution (PBS)
cholesterol acquisition from the host cell as hypothe- andcountedinaNeubauerchamber.
sized by Coppens [9].
To date, no detailed analyses on cholesterol acquisi- HostcellsandEimeriabovishostcellinfections
tion exist for any Eimeria species. All farm animals kept Primary bovine umbilical vein endothelial cells (BUVEC)
under conventional farming conditions unavoidably are were isolated according to Jaffe et al. [31]. Umbilical
exposed to Eimeria spp. infections worldwide [1,23] and cords were collected under aseptic conditions from ani-
infection-induced impaired animal performance, mortal- mals born by sectio caesaria and kept at 4 °C in 0.9%
ity and anticoccidial treatment costs generally result in HBSS-HEPES buffer (pH 7.4, Gibco) supplemented with
considerable economic losses [1,24]. As an obligate intra- 1% penicillin (500 U/mL, Sigma-Aldrich) and strepto-
cellular protozoa residing within a PV, Eimeria spp. mycin (50 μg/mL, Sigma-Aldrich) until use. For the
requirecholesterolnotonlyforPVestablishmentandhost isolation of endothelial cells, 0.025% collagenase type II
cell(membrane)enlargement(especiallyinmacromeront- (Worthington Biochemical Corporation) suspended in
forming species) but in particular for massive offspring Pucks solution (Gibco) was infused into the lumen of
production (>120 000 merozoites I in case of E. bovis). the ligated umbilical vein and incubated for 20 min at
Consequently, global transcriptomic approaches on in- 37 °C in 5% CO atmosphere. After gently massaging
2
fectedendothelialhostcellshaveindicatedthatE.bovisis the umbilical vein, the cell suspension was collected
in need for cholesterol for its successful replication [25]. and supplemented with 1 mL fetal calf serum (FCS,
In addition, recent inhibitor analyses indicated a pivotal Gibco) in order to inactivate the collagenase. After two
Hamidetal.VeterinaryResearch (2015) 46:100 Page3of17
washings (400×g, 10 min, 4 °C), cells were resus- Hexane:isopropanol (3:2, v/v) was added to the cell
pended in complete endothelial cell growth medium pellet. Cells were disrupted for 10 min in aTissue Lyser
(ECGM, PromoCell), plated in 25 cm2 tissue plastic (Qiagen, Hilden, Germany) using stainless steel beads.
culture flasks (Greiner) and kept at 37 °C in 5% CO The samples were centrifuged (8000×g, 1 min) and the
2
atmosphere. BUVEC were cultured in modified ECGM supernatants were collected. The extraction was repeated
medium (EGCM, PromoCell, diluted 0.3× in M199 once for each sample. The supernatants were then
medium, Sigma-Aldrich) with medium changes every combinedanddriedmanuallyundergentleliquidnitrogen
2–3 days. BUVEC cell layers were used for infection stream. The total lipid extracts were reconstituted in
after 1–2 passages in vitro. 500μLisopropanol:NP40(9:1,v/v)followedbysonication
BUVEC layers in 24-well or 25 cm2-flask formats were in a waterbath (RT, 30 min). 5 μL of each sample
infectedat80–90%confluencywith2×104or1.5×106E. were pre-treated with catalase [(5 μL of 0.5 mg/mL)
bovissporozoites,respectively.Culturemediumwaschan- in 40 μL of 1X reaction buffer (37 °C, 15 min)] in
ged24hafterparasiteinfectionandthereaftereverythird 96-well black clear-bottom plates (Greiner Bio-One)
day. Merozoites I were collected from cell culture super- to reduce background fluorescence of peroxides in
natants from days 17–20 pi onwards and washed three the solvents [34] before the enzyme cocktail of the
timesinPBS(600×g,15min)beforefurtheruse. Amplex-red kit (Life Technologies) was added. Chol-
esterol standards (Sigma-Aldrich; 10, 5, 2.5, 1.25,
Stainingofcholesterolandlipiddroplets 0.625 and 0.325 μM) and blanks (solvent only) were in-
Forstainingofintracellularstages(1,8,14and17dayspi), cludedineachexperiment.Fiftymicrolitersofenzymemix-
BUVEC were grown on cover slips and infected, whereas ture (0.1 M potassium phosphate buffer, pH 7.4; 0.25 M
invasivestages(sporozoitesandmerozoitesI)weredirectly NaCl, 5 mM cholic acid, 0.1% Triton X-100, 0.3 U/mL
dropped onto poly-L-lysine coated coverslips. Specimens cholesterol oxidase, cholesterol esterase, 1.3 U/mL HRP,
were washed with PBS, fixed in 4% paraformaldehyde and 0.4 mM ADHP) were added and incubated (37 °C, 15
(10 min), washed three times in PBS and incubated in min). Resorufin formation was measured by fluorescence
1% glycine PBS (10 min) to quench non-specific intensities (excitation wavelength of 530 nm, emission
signals, followed by three washings in PBS. To detect wavelength of 580 nm) in the Varioskan Flash Multimode
free cholesterol, the samples were stained by filipin Reader (Thermo Scientific). Total cholesterol of the sam-
(0.05 mg/mL in PBS containing 10% FCS, Sigma- pleswasextrapolatedtothevaluesofthecholesterolstand-
Aldrich, 2 h, in the dark, RT). For neutral lipid/lipid ard. The total cholesterol content of each sample was
droplet visualization the cells were stained in Nile Red normalizedtoitstotalcellnumbercounts.
(1:1000, Cayman Chemical, 15 min, RT, in the dark) or
with Bodipy 493/503 (1 μg/mL, Life Technologies; 10
Quantitativeanalysisoflipiddropletaccumulationin
min, RT, in the dark). All samples were washed in PBS,
infectedBUVEC
mounted in Prolong antifading mounting medium (Life
E. bovis-infected and control BUVEC (n=3) were trypsi-
Technologies) and analyzed using an inverted fluores-
nized at days 8, 17 and 21 pi and pelleted in PBS
cence microscope or confocal microscope applying the
(400×g, 3 min, 4 °C). The resuspended cells were
UVfilter set for filipin (340–380 nm excitation, 430 nm
stained with Bodipy 493/503 (10 min, on ice) and
pass filter) or FITC filter settings for Nile red and
washed twice with 1 ml PBS (400×g, 3 min, 4 °C). The
Bodipy493/503.ForanalternativeLDstaining,osmium
cells were transferred to 5-mL FACS tubes containing
tetroxide staining [32] was performed with modifica-
200 μL of PBS and were processed in a FACS Calibur
tion. Therefore, cells were washed four times in PBS,
flow cytometer (BD Biosciences, Heidelberg, Germany)
fixed (2% paraformaldehyde containing 0.1% glutaralde-
bylaser excitationat488nm (FL1-Hchannel). Flowcy-
hyde, EMgrade,Sigma-Aldrich,RT,30min)andosmium
tometry data were acquired by the BD CellQuest Pro
tetroxide-stained (0.1%, Sigma-Aldrich, RT, 30 min). The
software.
sampleswerewashedthreetimesinPBS,mountedinPBS
andanalyzedunderbrightfieldconditions.
Cholesterol,LDLandlipiddropletenrichment
Totalcholesterolmeasurement Forcholesterolenrichment,both,cholesterolanddesmos-
Total lipid extractions from E. bovis-infected (4, 8 and terol (both Sigma-Aldrich)dissolved in ethanol were con-
17 days pi) and control BUVEC (n=7) were performed tinuously added to BUVEC cultures (n=5) at 5 μM final
in hexane:isopropanol according to Hara and Radin concentration.Althoughnotbeingphysiologicaltheadmin-
[33]. The cells were washed twice in ice-cold PBS, tryp- istration of cholesterol at low concentration (in ethanol)
sinized and washed again (400×g, 10 min). The total accordingtoXuetal.[35]waschosentoreduceitstoxicity
cell numbers were counted using a Neubauer chamber. in long-term application. Supplementation of cholesterol
Hamidetal.VeterinaryResearch (2015) 46:100 Page4of17
complexedtocyclodextrinwasnotapplicabletolong-term Total RNA isolation was performed using the RNeasy
cultureinourhandsowingtoitshighcytotoxicity. kit (Qiagen) according to manufacturer’s protocol.
For LDL enrichment, LDL (Sigma-Aldrich, 10 mg/mL Therefore BUVEC were lysed within the cell culture
finalconcentration)wassupplementedtoE.bovis-infected flasks with RLT lysis buffer (600 μL/25 cm2 flask) and
BUVEC(n=5)from10dayspionwards.Toartificiallyen- processedasproposedbythemanufacturer.Anon-column
hance lipid droplet formation in host cells, oleic acid DNase treatment (Qiagen) according to manufacturer’s
(Sigma-Aldrich) was supplemented in BSA formulation instructionwasincludedinthetotalRNAisolationproced-
complexes [36] to the cell culture medium. Direct conju- ure. Total RNAs were stored at −20 °C until further use.
gation was performed by mixing oleic acid-free BSA The quality of total RNA samples was controlled via
(fraction V, Roth) with oleic acid at the molar ratio of 6:1 Agilent 2100 bioanalyzer (Agilent Technologies, USA). In
(oleic acid:BSA). BUVEC (n=3) were treated with 5 μM ordertoremoveanyDNAleftover,asecondgenomicDNA
oleic acid/BSA complexes for an induction period of 1 h, digestionstepwasperformed.Therefore,1μgoftotalRNA
and thereafter continuously with 2.5 μM to prevent tox- wastreatedwith10UDNaseIin1xDNasereactionbuffer
icity. Treatments were repeated every second day from (all Thermo Scientific, 37 °C, 1 h). DNase was inactivated
8 days pi onwards. by heating the sample (65 °C, 10 min). The efficiency of
genomic DNA digestion was controlled by including no-
Lowdensitylipoprotein(LDL)bindingassay RT-controlsineachreal-timePCRexperiment.
The binding of LDL to receptors on the surface of in- cDNA synthesis was performed using the SuperScript
fected cells and non-infected controls was estimated III First-Strand Synthesis System according to manufac-
usingBodipy-labelledLDL(LifeTechnologies).Therefore, turer’s protocol with slight modifications.1 μg of DNase-
E. bovis-infected BUVEC (15 days pi) were cultivated in treated total RNA was added to 1 μL of 50 μM oligo
FCS-free endothelial cell basal medium (PromoCell) d(T), 1 μL of 50 ng/μL random hexamer primer, 1 μL of
supplemented with 10% lipoprotein deficient-serum 10 mM dNTP mix and DEPC-treated water was adjusted
(Sigma-Aldrich) for 36–48 h prior to medium supple- to10μLtotalvolume.Thesamplewasincubatedat65°C
mentation with Bodipy-labelled LDL (10 μg/mL). The for 5 min and then immediately cooled on ice. For first
cells were incubated for 1 h at 4 °C followed by 4 h at strand cDNA synthesis, 2 μL of 10x RT buffer, 1 μL 25
37 °C and also 3 h, 5 h for fluorescence microscopy. mMMgCl 1μL0.1MDTT,1μLRNaseOUT(40U/μL)
2,
For qualitative analyses the cells were washed in PBS, and 1 μL SuperScript III enzyme (200 U/μL) were added
fixed (4% paraformaldehyde, 10 min) and mounted in and the sample was incubated at 50 °C for 60 min
Prolong antifading mounting medium prior to fluores- followedbya85°C-inactivationstepfor15min.
cence microscopy. For quantitative analyses, BUVEC Real-time PCR was performed in duplicates in a 10 μL
were treated with 3% NaN (5 min, RT) to inhibit total volume containing 400 nM forward and reverse
3
receptor recycling and washed with ice-cold PBS. Mono- primers,200nMprobe,10ngcDNAand5μL2×PerfeCTa
layers were detached by Accutase (Sigma-Aldrich) treat- qPCR FastMix (Quanta Biosciences, USA). The reaction
ment (5 min, 37 °C), washed in PBS (400×g, 5 min) and conditionsforallsystemswereasfollows:95°Cfor10min,
transferred to 5-mL FACS tubes containing 200 μL of 40cyclesat95°Cfor10s,60°Cfor15sand72°Cfor30s.
PBS.ThecellswereprocessedinaFACSCaliburflowcyt- PCRs were performed on a Rotor-GeneQ cycler (Qiagen,
ometerusingtheFL1-Hchannel. Hilden,Germany).No-templatecontrols(NTC)andno-RT
reactionswereincludedineachexperiment.Asareference
Real-timequantitativePCRassayforthedetectionof gene we chose with GAPDH a gene that was previously
cholesterolmetabolism-associatedmolecules used in other publications reporting on E. bovis-infected
Primers and probes (Biomers, Ulm, Germany) were BUVEC[24,38].ToprovethattheGAPDHgeneisasuit-
designed using Beacon Designer 7 (Premier Biosoft) and able reference gene in this experimental set-up, we have
Primer 3 (NCBI) software. In silico analyses were per- previously performed experiments on the stability of
formed to access primers and probes specificity [37]. GAPDH gene transcription in E. bovis-infected BUVEC.
Amplification efficiency of each qPCR assay was deter- Therefore, four different BUVEC isolates (=4 biological
mined usinglinearized plasmids containingthe respective replicates) were infected with E. bovis and tested for
amplicon in pDrive (Qiagen). Only systems showing effi- GAPDH gene transcription (in duplicates) throughout
ciency values >0.9 were used. The sequences of primers infection (at days 4, 8, 12, 14 and 17 pi). Considering all
andprobesandtheefficienciesofeachsystemarelistedin samplesofallisolatesatC level weshowedthatGAPDH
t
Table1. gene transcription was not significantly influenced by the
E. bovis-infected and control BUVEC (n=3) were infection(mean±standarddeviationoftheCsofallsam-
t
processedfortotalRNAisolationatdifferenttimepoints ples: 21.31±0.84) but proved stabile within the kinetics,
of macromeront maturation (days 12, 14, 17 and 20 pi). since the variation of the data accounted to less than 4%.
H
a
m
id
e
t
a
l.
V
e
te
rin
a
ry
R
e
se
a
rc
h
(2
0
1
Table1Sequencesofprimersandprobesusedinreal-timeqPCR 5) 4
Symbol Name Accession PCR Amplicon Forward(5’→3’) Reverse(5’→3’) Probe(reporter5’-3’quencher) 6:1
0
number efficiency length 0

ACAT1 Acetyl-CoAacetyltransferase1 NM_001046075.1 0.95 102 TCATATGGGCAACTGTGCTGA CTGCTTTACTTCTGGTATAG FAM-AGCATAAGTATCCTGTTCCTCTCGTG-BHQ1
ACAT2 Acetyl-CoAacetyltransferase2 NM_001075549.1 1.08 194 AGCAGTGGTTCTTATGAA AGGCTTCATTGATTTCAAA FAM-ATCAACATCCTCCAGCGACCA-BHQ1
HMGCS1 3-hydroxy-3-methylglutaryl-CoA NM_001206578 0.93 197 CTACCTCAGTGCATTAGA CTCTGTTCTGGTCATTAAG HEX-AAGTCATTCAGCAACATCCGAGC-BHQ1
synthase1
HMGCR 3-hydroxy-3-methylglutaryl-CoA NM_001105613.1 0.94 109 GCCATCAACTGGATAGAG CCTCAATCATAGCCTCTG FAM-TCTCTGACAACCTTGGCTGGAAT-BHQ1
reductase
SQLE Squaleneepoxidase NM_001098061.1 0.93 132 CCCTTCTTCACCAGTAAA CCCTTCAGCAATTTTCTC HEX-AACAACAGTCATTCCTCCACCAGTA-BHQ1
CH25H Cholesterol25-hydroxylase NM_001075243.1 1.00 87 TTGGGTGTCTTTGACATG CAGCCAGATGTTGACAAC FAM-CGTCTTGCTGCTCCAGTGTC-BHQ1
SOAT1 SterolO-acyltransferase1 NM_001034206.2 0.93 99 GCCCTCCTCATTCTCTTC CCCAAAAGCATAAGACATGAG FAM-AGCACCAGCCTTCCTTCATCA-BHQ1
(SOAT1)
LDLR Lowdensitylipoproteinreceptor NM_001166530.1 1.00 96 CGCCTACCTCTTCTTTAC ACCACGTTCTTAAGGTTG FAM-TCGCTTCGGTCCAGAGTCATC-BHQ1
OLR1 Oxidizedlowdensity NM_174132.2 0.97 102 CAAGCTGGATGAGAAATC GGACAAGGACCTGAATAG TET-ACTTCACCGCCAGAACCTGA-BHQ1
lipoprotein/(lectin-like)receptor1
GAPDH Glyceraldehyde-3-phosphate AF022183 0.98 82 GCGACACTCACTCTTCTACCTTCGA TCGTACCAGGAAATGAGCTTGAC FAM-CTGGCATTGCCCTCAACGACCACTT–BHQ1
dehydrogenase
P
a
g
e
5
o
f
1
7
Hamidetal.VeterinaryResearch (2015) 46:100 Page6of17
Analyses of the qPCR data used the comparative C (Figures 1B, J, L). In addition, an intense staining was
t
method(ΔΔC method)andreportedasn-folddifferences observed in the cytoplasm of sporozoites (Figure 1B).
T
comparing E. bovis-infected BUVEC with non-infected These reactions may origin from intraparasitic organelle
ones after normalizing the samples with the GAPDH membranes. Sporozoites and merozoites I of E. bovis also
reference gene. showed an intense staining by Nile red (Figures 1G and
H) and Bodipy 493/503 (Figures 1D, N, P), indicating a
MerozoitesIquantificationviaEimeriabovismicroneme high content of neutral lipids/lipid droplets within these
protein4(EbMIC4)-basedreal-timePCR stages. However, using Nile red we failed to demon-
For merozoites I quantification we used a real-timePCR strate structurally defined lipid droplet-like structures
system based on the detection of the single copy gene of within the cytoplasm of these stages, whilst Bodipy
E. bovis microneme protein 4 (EbMIC4, [39]) applying 493/503 staining resulted in strong fluorescent globu-
the following primers and probe: forward primer: lar lipid body-likestructures(Figures1DandP).Inmero-
5’-CACAGAAAGCAAAAGACA-3’, reverse primer: zoitesIandsporozoiteslipiddropletsweresituatedinthe
5’-GACCATTCTCCAAATTCC-3’ and probe: 5’-FAM- cytoplasm anddifferedinnumbersperspecimen.Overall,
CGCAGTCAGTCTTCTCCTTCC-BHQ1-3’ [26]. There- up to 8 lipid droplet-like structures were detected per in-
fore, cell culture supernatants containing merozoites I vasive stage. The overall strongest reactions upon Nile
were collected at indicated time points pi. At the end red or Bodipy 493/503 staining were found in the
of the culture period the cells were trypsinized and refractile bodies of the sporozoite stages (Figures 1D,
collected together with the supernatant followed by G, H, merozoites I do not contain any refractile bodies)
centrifugation(600×g,15min).The cellpelletwastreated indicating the storage of neutral lipids within these spe-
with 200 μL of cell lysis buffer containing 0.32 M Sucrose, cific apicomplexan organelles.
1% Triton X-100, 0.01MTris-HCl (pH7.5),5mMMgCl
2
and incubated in 100 μL 1X PCR buffer (Quanta, USA) CholesterolandlipiddropletsaccumulateinE.bovis-infected
containing 20 μL proteinase K (20 mg/mL; Qiagen) at cellsduringmacromerontformation
56 °C for 1 h. Proteinase K was heat-inactivated (95 °C, One day after host cell infection, filipin-positive signals
10 min) and the DNA-containing samples were frozen accumulated very close to the parasites intracellular pos-
at−20 °C until further use. All samples were processed ition within the PV (Figure 2A). Compared to non-
as triplicates. infected control cells directly adjacent to infected host
Real-time PCR was performed in a total volume of cells, the cholesterol abundance was also significantly en-
20 μL containing 5 μl DNA of merozoites I samples, hanced in immature and mature meronts I (Figure 2C).
400 nM of each primer, 200 nM probe and 10 μL Owingtothemassiveenlargementofthehostcellleading
PerfeCTaMasterMix (Quanta,USA)at95°Cfor10min; to a close position of the PV and host cell membrane, it
40 cycles at 95 °C for 10 s, 60 °C for 15 s and 72 °C cannotbe concluded whether the signals originate merely
for 30 s. In each PCR experiment serial dilutions of fromtheparasiteanditsPVMorfromthehostcellmem-
merozoites I covering 6 magnitude orders of 10-fold braneorboth.Totalcholesterolquantificationinlipidex-
(106-10) were included allowing for absolute quantifi- tracts revealed a significant increase of cholesterol
cation of merozoites I counts in the samples. abundance in E. bovis-infected host cells over time when
comparedtonon-infectedcontrols(Figure2E;4,8and17
Statistics dayspivs.controls:allp<0.01).Giventhatthecholesterol
Real-timePCRdataanalysiswasperformedbytheΔΔC content of sporozoites (here the individual infection
T
method, normalized to GAPDH and expressed as rela- dose of 5×105 sporozoites was analyzed, Figure 2E)
tive fold change compared to control [40,41]. For statis- was rather low, the changes of host cellular cholesterol
tics data were analyzed by Student’s t-tests comparing content could not be attributed to invading stages but to
control and treated groups. GraphPad Prism 6.02 was infection-triggeredalterationofthecholesterolmetabolism.
usedtovisualizegraphs. Based on Bodipy 493/503 staining, a considerable
enhancement of lipid droplet formation was observed
Results with ongoing macromeront development (Figure 3).
Freecholesterolandneutrallipid/lipiddroplet The most significant accumulation of distinct lipid
distributioninE.bovisinvasivestages droplet-like structures occurred in immature macro-
E. bovis sporozoites and merozoites I both were inten- meronts (15-17 days pi, Figures 3A and 3C). The Bod-
sively stained by filipin (Figures 1B, J, L). The strongest ipy 493/503 staining was cross-checked with Nile red
reactions were detected at the apical part and in the staining(datanotshown)whichshowedthesamefeature.
plasma membrane of these stages indicating high free Alongside with macromeront maturation and merozoite I
cholesterolcontentsintheapicalcomplexandthepellicula formation,thefluorescencepatternchangedfromaspotty
Hamidetal.VeterinaryResearch (2015) 46:100 Page7of17
Figure1Cholesterolandneutrallipid/lipiddropletlocalizationinfreeE.bovisstages.FreshlyexcystedE.bovissporozoiteswerestainedby
filipin(A=phasecontrast)andBodipy493/405(C=phasecontrast).Notethebrightfilipinsignalintheapicalpart(*)andpellicula(B)andthe
strongBodipy493/405stainingoftherefractilebodies(rb)andcytosoliclipiddroplets(ld)(D).Refractilebodiesbutnolipiddropletswerestainedin
sporozoitesbyNilered(G,H=close-up,E/F=phasecontrast).MerozoitesIshowedstrongfilipin-inducedsignalsinthepellicula(Jarrows,I=phase
contrast)andattheapicaltips(L*,K=phasecontrast).Bodipy493/405stainingrevealedcytosoliclipiddropletsinmerozoitesI(N,Parrows;M,O=phase
contrast).Scalebarsrepresent5μm.
appearance illustrating single lipid droplets to a rather merozoite I formation (Figure 3C). In order to better
cloudy and diffuse reaction indicating that lipid droplet define lipid droplet position, structure and size within E.
contents were almost totally exhausted or consumed for bovis-infected cells, confocal microscopic analyses were
Hamidetal.VeterinaryResearch (2015) 46:100 Page8of17
small(<1μm),someofthemrevealedasizeofmorethan
5μmindiameter.
Given that the fixation mode may alter lipid droplet
integrity leading to dimmed LD appearance [42], we
additionally used osmium tetroxide staining which is
known tobetterpreservelipid body structures.However,
osmium tetroxide treatments led to similar results to
those of Bodipy 493/503 staining thus confirming the
significant increase of lipid droplet abundance (visible as
small black dots) in E. bovis macromeront-carrying host
cells (Figure 3F).
ApplyingFACStechnologyweadditionallyquantifiedthe
changes of total lipid droplet contents in infected BUVEC
and control cells. FACS analyses revealed a significant
increase (2.8- and 6.6-fold at 17 and 21 days pi, respect-
ively) of total lipid droplet abundance of E. bovis-infected
BUVEC in times of macromeront formation resulting in
highlysignificantvaluesfordays17and21picomparedto
non-infected controls (both p≤0.0001, Figure 4). These
data confirmed the microscopic observations described
above and underlined the relevance of lipid droplet forma-
tionduringE.bovismacromerontdevelopment.
Extracellularsterolenrichmentandenhancedcellular
lipiddropletdisposabilityboostparasitereplication
Toassesstheeffectsofexogenouslysuppliedcholesterolon
E.bovismacromerontdevelopment,freesterols(cholesterol
and desmosterol) were administered to cell cultures.
Desmosterol is a cholesterol intermediate precursor
and can replace cholesterol function in sustaining cell
proliferation [43]. Owing to long term cytotoxicity we
couldnotsupplycholesterolinthecyclodextrin-complexed
form and chose the very simple approach of supplementa-
Figure2Cholesteroldistributionandcholesterolcontentin tion in ethanol which had previously been shown to work
E.bovisinfectedhostendothelialcells.Bovineumbilicalvein inT.gondiicultures[4]andaccordingtoXuetal.[35].To
endothelialcells(BUVEC)wereinfectedwithE.bovissporozoitesand
avoid intracellular crystallization and cytotoxicity [35], low
stainedwithfilipinatoneday(A;B=phasecontrast,arrowsindicate
concentrations (5 μM) of these substituents were applied.
sporozoites)and17days(C;D=phasecontrast)pi.Notethebright
filipinstainingadjacenttointracellularsporozoites(A)andthestrong We observed a significant beneficial effect on merozoite I
reactionsinamerontI-carryingcell(C)comparedtonon-infectedcells production leading to enhanced offspring generation in
intheneighborhood.Forthequantificationofthetotalcholesterol both, cholesterol- and desmosterol-treated host cells when
contents(E),infected(blackbars)andnon-infected(greybars)BUVEC
compared to non-treated E. bovis-infected cultures
(n=7)wereharvestedatdifferenttimepointsafterinfection(4,8,17
(Figure 5B, p≤0.05). However, the infection rates and
dayspi),processedfortotallipidextractionandtotalcholesterol
measurementusingtheAmplexRed®kit.Puresporozoites(processed macromeront sizes were not significantly altered by
numberscorrespondtotheinfectiondose)wereusedascontrols. cholesterolordesmosterolsupplementation(Figure5A).
Scalebarsrepresent10μm. Given that lipid droplets may play a pivotal role in E.
bovis in vitro development, we assessed the effects of an
also applied for Bodipy 493/503-stained samples. Detailed artificially enhanced abundance of lipid droplets in
analyses of E. bovis-infected host cells 17 days pi revealed BUVEC. Therefore, BUVEC were treated with oleic acid,
the presence of bright fluorescent lipid droplets through- awell-knowninduceroflipiddropletsformationinseveral
out the macromeront corpus as demonstrated by the types of mammalian cells [36]. The microscopic control of
detection in each layer (Z-stack) of the specimens (single oleic acid-treated, infected BUVEC confirmed the lipid
layer: Figure 3E, all layers see Additional file 1). Lipid droplet-boosting function of oleic acid treatments since
droplets showed classical globular shapes but were of manymorelipiddropletswerefoundwithinthecytoplasm
differing sizes. Whilst most lipid droplets were rather of treated cells when compared to non-treated ones
Hamidetal.VeterinaryResearch (2015) 46:100 Page9of17
Figure3Lipiddropletdistributionindevelopingmeronts.Bovineumbilicalveinendothelialcells(BUVEC)wereinfectedwithE.bovis
sporozoites.Fortheillustrationoflipiddroplets,thecells(17dayspi)wereeitherstainedwithBodipy493/503andanalyzedbyconventional
fluorescencemicroscopy(A+C:Bodipy493/503(green),B+D:respectivephasecontrastillustrations)orconfocalmicroscopy(E:Bodipy493/503
(green),DNAstainingviaDAPI(blue);illustrationin(E)wasprojectedfrom25slicesofZ-stackconfocalanalysiswhichisgiveninAdditionalfile1)
orsubjectedtoosmiumtetroxidestaining(Dincludingclose-up).Notemassiveabundanceoflipiddroplets(green(Bodipystaining)orblack(osmium
tetroxide)dots)withinimmaturemacromeronts(A,C,F)andthelargesizesoflipiddroplets(=ld,E).Notealsothatthecytoplasmofinfectedhost
cellsisfreeoflipiddroplets(A,C).Scalebarsrepresent20μm.nuc=nucleusofthehostcell,cyt=cytoplasmofthehostcell,PV=parasitophorous
vacuole,mac=macromeront-derivedplasmamembrane,imm=immaturemacromeront,mat=maturemacromeront,ld=lipiddroplet.
(Figure 6B, compare to Figures 3A and 3C). Kinetic ana- been starved in LDL-free medium. LDL binding was
lysesofmerozoiteIinvitroproductioninoleicacid-treated quantified using FACS technology. A significant increase
andnon-treated infected cells confirmed the key role of of Bodipy-LDL binding was detected in infected cells
lipid droplets in optimal parasite proliferation. Thus, versus non-infected controls (p<0.0001, Figures 7A and
significant beneficial effects of oleic acid treatments on 7B). Overall, a 37.5-fold enhancement was measured in
merozoite I production wereobserved at all time points E.bovis-infectedcells.
of merozoite I quantification (Figure 6A; p≤0.01 for To estimate whether the increase in LDL-binding
days 23; p≤0.05 for days 26, 29, 30 pi). Referring to the originated from enhanced surface LDL receptor (LDLR)
total merozoite I production, a 4.7±2.9 fold increase of abundance, a flow cytometry-based assay using an
offspring production was estimated. LDLR-specific antibody was established and tested on
E. bovis-infected BUVEC at 17 dayspi. Overall,thedata
E.bovisinfectionenhancessurfaceLDLreceptor revealed a significant infection-induced increase of LDLR
abundanceoninfectedcellsandexogenouslysupplied surface expression (1.92 fold) in macromeront-carrying
LDLimprovesmerozoiteIproduction host cells (infected vs. non-infected cells: p<0.0001;
To assess whether LDL binding to the cell surface is Figures 7C and 7D). These data are in agreement with
altered in infected host cells, Bodipy-labelled LDL was transcriptional profiles of LDLR in E. bovis-infected
supplemented to in vitro cultures that had previously cells, as described later (Figure 9).
Hamidetal.VeterinaryResearch (2015) 46:100 Page10of17
Figure4LipiddropletabundanceinE.bovis-infectedendothelialhostcells.Bovineumbilicalveinendothelialcells(BUVEC,n=3)were
infectedwithE.bovissporozoites.ThecellswerestainedwithBodipy493/503totracelipiddropletsandsubjectedtoflowcytometryanalysesat
8,17and21dayspi.Infectedcellswereassignedaccordingtotheirsizeandgranularity.AexemplaryillustrationsofhistogramsofBodipy493/
503-positiveinfected(blackhistogram)andnon-infected(whitehistogram)BUVECondays8,17and21pi;(B)meanandstandarddeviationsof
lipiddropletcontentsininfectedhostcellsat0,8,17and21dayspi.
Given that LDL binding and LDLR surface expression E.bovisinfectioninducesup-regulationofthegene
is enhanced in E. bovis-infected host cells, we then transcriptionofmoleculesinvolvedinthemevalonate
investigated whether exogenous LDL supplementation pathwayandincholesterolhydroxylationandesterification
would be of benefit for E. bovis macromeront develop- Hostcelldenovobiosynthesisofcholesterolisamultistep
ment in vitro. Indeed, excess LDL stimulated E. bovis metabolic pathway involving more than 30 enzymatic
merozoite I production. Although, macromeront sizes reactions. In these experiments transcriptional profiles of
and rates increased only slightly(Figure 8A),weobserved several relevant molecules were analyzed during E. bovis
a significant increase of the total merozoite I production macromeront formation in vitro. For the formation of
after LDL supplementation (p<0.01, Figure 8B) resulting acetoacetyl-CoArepresentingthesubstrateofthemevalo-
ina1.54-foldenhancementofoffspringsynthesis. nate pathway, ACAT1/ACAT2 activities are needed [44].