Table Of ContentUUnniivveerrssiittyy ooff NNeebbrraasskkaa -- LLiinnccoollnn
DDiiggiittaallCCoommmmoonnss@@UUnniivveerrssiittyy ooff NNeebbrraasskkaa -- LLiinnccoollnn
Roman L. Hruska U.S. Meat Animal Research U.S. Department of Agriculture: Agricultural
Center Research Service, Lincoln, Nebraska
4-2014
DDyyssttrroopphhiinn iinnssuuffifficciieennccyy ccaauusseess sseelleeccttiivvee mmuussccllee hhiissttooppaatthhoollooggyy
aanndd lloossss ooff ddyyssttrroopphhiinn--ggllyyccoopprrootteeiinn ccoommpplleexx aasssseemmbbllyy iinn ppiigg
sskkeelleettaall mmuussccllee
Katrin Hollinger
Iowa State University, [email protected]
Cai X. Yang
Iowa State University
Robyn E. Montz
Iowa State University
Dan Nonneman
U.S. Department of Agriculture, [email protected]
Jason W. Ross
Iowa State University
See next page for additional authors
Follow this and additional works at: https://digitalcommons.unl.edu/hruskareports
Hollinger, Katrin; Yang, Cai X.; Montz, Robyn E.; Nonneman, Dan; Ross, Jason W.; and Selsby, Joshua T.,
"Dystrophin insufficiency causes selective muscle histopathology and loss of dystrophin-glycoprotein
complex assembly in pig skeletal muscle" (2014). Roman L. Hruska U.S. Meat Animal Research Center.
262.
https://digitalcommons.unl.edu/hruskareports/262
This Article is brought to you for free and open access by the U.S. Department of Agriculture: Agricultural Research
Service, Lincoln, Nebraska at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in
Roman L. Hruska U.S. Meat Animal Research Center by an authorized administrator of DigitalCommons@University
of Nebraska - Lincoln.
AAuutthhoorrss
Katrin Hollinger, Cai X. Yang, Robyn E. Montz, Dan Nonneman, Jason W. Ross, and Joshua T. Selsby
This article is available at DigitalCommons@University of Nebraska - Lincoln: https://digitalcommons.unl.edu/
hruskareports/262
The FASEB Journal article fj.13-241141. Published online December 17, 2013.
The FASEB Journal (cid:127) Research Communication
Dystrophin insufficiency causes selective muscle
histopathology and loss of dystrophin-glycoprotein
complex assembly in pig skeletal muscle
Katrin Hollinger,* Cai X. Yang,* Robyn E. Montz,* Dan Nonneman,† Jason W. Ross,*
and Joshua T. Selsby*,1
*Department of Animal Science, Iowa State University, Ames, Iowa, USA; and †U.S. Department
of Agriculture, Agricultural Research Services, U.S. Meat Animal Research Center, Clay Center,
Nebraska, USA
ABSTRACT The purpose of this investigation was to Dystrophinmutationscanresultinsubstantialphys-
determine the extent to which dystrophin insufficiency ical and locomotion deficits, leading to wheelchair
caused histomorphological changes in a novel pig confinementandearlydeathduetorespiratoryand/or
model of Becker muscular dystrophy. In our proce- cardiac failure. The most severe form, Duchenne mus-
dures, we used a combination of biochemical ap- cular dystrophy (DMD), is caused by a lack of dystro-
proaches, including quantitative PCR and Western phin protein. The generally less severe form, Becker
blots, along with a histological analysis using standard muscular dystrophy (BMD), is caused by insufficient
andimmunohistologicalmeasures.Wefoundthat8-wk- dystrophinabundanceand/orexpressionofapartially
old male affected pigs had a 70% reduction in dystro- functional gene product.
phinproteinabundanceinthediaphragm,psoasmajor, Several existing dystrophin-deficient animal models
and longissimus lumborum and a 5-fold increase in are currently used in the study of dystrophinopathies.
serum creatine kinase activity compared with healthy However, despite the many useful features of the dif-
male littermates. Dystrophin insufficiency in the dia- ferent mouse and dog models a few significant draw-
phragm and the longissimus resulted in muscle histo- backsexist.Forexample,thediseasephenotypeexhib-
pathologywithdisorganizedfibrosisthatoftencolocal- ited by mdx mice is much milder than that of human
ized with fatty infiltration but not the psoas. Affected patients with DMD (1, 2) in part due to increased
animalsalsohadan80–85%reductionin(cid:1)-sarcoglycan abundance of utrophin, a dystrophin-like protein (3–
localization in these muscles, indicating compromised 5). To mitigate this potential confounding variable,
assemblyofthedystrophinglycoproteincomplex.Con- mdx/utrophin(cid:1)/(cid:1)miceweredeveloped(5).Whilethe
trolsusedinthisstudywere4healthymalelittermates, disease phenotype is more severe in these mice, the
astheyaremostcloselyrelatedtotheaffectedanimals. double-knockout approach allows for the possibility
We concluded that pigs with insufficient dystrophin that muscle function and metabolism are affected
protein expression have a phenotype consistent with independent of the dystrophin mutation. Additional
humandystrophinopathypatients.Giventhatandtheir dystrophin-deficientmodelswithasecondarymutation
similarity in body size and physiology to humans, we havesincebeendeveloped(5–7).Regardlessofmouse
further conclude that this pig line is an appropriate model, there is a poor correlation between effective-
translational model for dystrophinopathies.—Hol- ness of therapies in mouse models to that observed in
linger, K., Yang, C. X., Montz, R. E., Nonneman, D., human patients (8), as scaling from a mouse to a
Ross,J.W.,Selsby,J.T.Dystrophininsufficiencycauses humanischallengingforavarietyofreasons,including
selectivemusclehistopathologyandlossofdystrophin- expense, safety, and differences in body size.
glycoprotein complex assembly in pig skeletal muscle. In addition to mouse models, a golden retriever
FASEB J. 28, 000–000 (2014). www.fasebj.org muscular dystrophy (GRMD) model has also been
discovered and is the best characterized of identified
dog models (9). GRMD dogs have a phenotype that is
Key Words: Duchenne muscular dystrophy (cid:1) DMD (cid:1) Becker
more similar in severity and in selective muscle injury
muscular dystrophy (cid:1) BMD (cid:1) animal model
compared with human patients than mdx mice (10,
Abbreviations: BMD, Becker muscular dystrophy; DGC, 1Correspondence: Iowa State University, Department of
dystrophinglycoproteincomplex;DMD,Duchennemuscular Animal Science, 2356 Kildee Hall, Ames, IA 50011, USA.
dystrophy; DTNA, (cid:2)-dystrobrevin; GRMD, golden retriever E-mail:[email protected]
muscular dystrophy; H&E, hematoxylin and eosin; IHC, im- doi:10.1096/fj.13-241141
munohistochemistry;MHC,myosinheavychain;NOS1,(neu- This article includes supplemental data. Please visit http://
ronal)nitricoxidesynthase1;SGCA,(cid:2)-sarcoglycan www.fasebj.orgtoobtainthisinformation.
0892-6638/14/0028-0001©FASEB 1
11). However, GRMD dogs have a high degree of longissimus is generally used more frequently and is com-
phenotypic variability (12, 13), and, as in mdx mice, prisedprimarilyoftypeIIfibers.
limited adiposity is observed. Finally, dystrophic dogs
treated with corticosteroids exhibited a greater fre- Plasmacreatinekinaseactivity
quency of calcified necrotic fibers and impairment of
some measures of muscle function (14), which is con- Plasma creatine phosphokinase was measured using a 2-part
reagent system (Pointe Scientific, Canton, MI, USA), follow-
trary to the beneficial effects of steroid use in human
ing the manufacturer’s instructions, in a SpectraMax M5
patients (15). The objective of this project was to
microplate plate reader (Molecular Devices, Sunnyvale, CA,
characterize the skeletal muscle phenotype of a re- USA).Samples(25(cid:5)l)weremeasuredinduplicate,andthe
cently discovered pig line with a spontaneously occur- rate of NADH formation was monitored at 340 nm at 37°C.
ring substitution in exon 41 of the dystrophin gene Sampleshaving(cid:6)2500U/LweredilutedinPBSandassayed
causing an arginine to tryptophan amino acid change. again.
This substitution leads to decreased dystrophin abun-
dance in skeletal and cardiac muscle (16). To develop mRNAquantification
novel therapeutic strategies to treat dystrophinopa-
thies, there must be animal models that accurately Muscle samples were powdered with a dry-ice-chilled mor-
recapitulate the disease. Currently available models tar and pestle. Total RNA was extracted from (cid:4)50 mg of
powdered muscle using Trizol (Invitrogen, Carlsbad, CA,
have been useful; however, their inherent limitations
USA), following the manufacturer’s instructions with mi-
have hindered drug development and approval. The
nor modifications. The RNA was then column purified
anatomy, physiology, and genetics of pigs are more
(RNeasyMiniKit,Qiagen,Valencia,CA,USA)tominimize
similar to those of humans than are those of mice or organic carryover. On the column, and before RNA elu-
dogs. These similarities increase the likelihood of a tion, DNase digestion (RNase free DNase set; Qiagen) was
moreaccuraterecapitulationofthehumandiseaseand used to prevent DNA contamination of the sample. After
alsomitigatechallengesindrugscale-up,aspigsareof quantification using a Nanodrop (Thermo Scientific,
Waltham, MA, USA), 1 (cid:5)g of RNA was reverse-transcribed
human size. Pigs are currently being used widely for
(QuantiTect Reverse Transcription Kit; Qiagen) following
advancements in human health research (reviewed in
the manufacturer’s instructions, with the addition of re-
ref.17),sothissuggestionisnotunprecedented.Inthis
verse transcription primers for 18S ribosomal RNA. The
report, we detail the early muscle response to dystro- 18S rRNA does not contain a poly-A tail, and the addition
phin insufficiency in the diaphragm, psoas major, and of the 18S reverse-transcription primers ensures that the
longissimus lumborum. Our hope is that dystrophin- 18S rRNA can be converted into cDNA. For quantitative
insufficient pigs will aid in the development of thera- PCR, equal amounts of cDNA, corresponding to 10 ng of
reverse-transcribed mRNA, were loaded into each well. To
peutic strategies by supplementing currently available
measure gene expression, primer pairs (Table 1) were
animal models.
mixed together with a QuantiFast SYBR Green PCR kit
(Qiagen) in a reaction volume of 12.5 (cid:5)l, and gene
expression was measured with a Mastercycler EP Realplex
(Eppendorf,Hauppauge,NY,USA).AttheendofthePCR
MATERIALS AND METHODS program, melting curves for all amplicons were inspected
to verify that a single product was amplified with each
primer pair. The pig genome has been sequenced and is
Animaluse well annotated (18), allowing construction of appropriate
primerpairs.Allsamplesweremeasuredintriplicatewells.
All animal procedures were reviewed and approved by the
U.S. Meat Animal Research Center Animal Care and Use Proteinextraction
Committee,andproceduresforhandlingpigscompliedwith
those specified in the Guide for the Care and Use of
About 500 mg of powdered muscle was added into a glass
AgriculturalAnimalsinAgriculturalResearchandTeaching.
TeflonDouncehomogenizerwith0.7mlextractionbuffer
Animals were housed in 6.5- (cid:3) 8-foot nursery pens by litter
(2% SDS and 10 mM phosphate buffer, pH 7). Following
until8wkofage.Affectedpigswereidentifiedbygenotyping (cid:4)20 strokes of the homogenizer, the homogenizer was
with a Sequenome MassArray system (Sequenome, Inc., San
rinsedwith0.3mlofextractionbuffer,whichwascollected
Diego,CA,USA;ref.16).At8wkofage,4maleaffectedpigs
into the homogenized sample for a total dilution of 2:1.
and 4 male healthy littermates were euthanized by electrical
Samples were centrifuged at 1500 g for 15 min at room
stunning, followed by exsanguination, and (cid:4)5-g portions of
temperaturetoremoveinsolublematerial.Proteinconcen-
themedialdiaphragm,psoasmajor,andlongissimuslumbo-
tration was measured with the BCA kit (Pierce, Rockford,
rumatthelastribwerecollectedwithin15minofstunning.
IL, USA) at a 1:10 dilution in triplicate. All samples were
Musclesweresnap-frozeninliquidnitrogenforbiochemical dilutedtoaproteinconcentrationof3.5(cid:5)g/(cid:5)linloading
analyses or frozen in isopentane or fixed in 10% buffered
buffer(62.5mMTris,pH6.8;2%SDS;10%glycerol;2.5%
formalinforhistologicalanalyses.Frozensampleswerestored (cid:7)-mercaptoethanol; and 0.002% bromophenole blue) and
at(cid:1)80°Cuntilanalyzed.Thediaphragmwaschosenbecause
heated to 95°C for 5 min.
itisusedinrespirationandisaprimarycauseofmortalityin
patients with dystrophinopathy and therefore of importance
for disease progression. The psoas and longissimus were Westernblotanalysis
chosen because of their differing uses and composition of
differentfibertypes.Specifically,thepsoasisgenerallylightly Protein (35 (cid:5)g; 10 (cid:5)l) was separated at 60 V for 15 min,
used and is comprised largely of type I fibers, while the followed by 1 h at 120 V in a 4–20% gradient polyacryl-
2 Vol.28 April2014 TheFASEBJournal(cid:1)www.fasebj.org HOLLINGER ET AL.
TABLE 1. Primer sequences used for quantitative PCR
Primer Sequence Accessionnumber Ampliconlength
DMD5=pigFor(exon9) CCTCGGTTCAAGAGCTATGC NM_001012408 128
DMD5=pigRev(exon10) TCCAACAATGAACTGCCAAA
DMD5=ofSNPpigFor(exon37)a AGCAAACTTGATGGCAAACC NM_001012408 121
DMD5=ofSNPpigRev(exon38) AATGGAGGCCTTTCCAGTCT
DMDacrossSNPpigFor(exon40) TCAGTACAAGAGGCAGGCTG NM_001012408 330
DMDacrossSNPpigRev(exon42) GGCATGTCTTCAGTCATCAC
DMD3=ofSNPpigFor(exon41) AATTTGCTCACTTTCGAAGA NM_001012408 185
DMD3=ofSNPpigRev(exon42) GAGGTCAGGAGCATTGAGAA
DMD3=pigFor(exon62/63) CCACGAGACCCAAACAACTT NM_001012408 153
DMD3=pigRev(exon65) AGGCTCAAGAGATCCAAGCA
TNFpigFor GCCCTTCCACCAACGTTTTC NM_214022 158
TNFpigRev TCCCAGGTAGATGGGTTCGT
IL1BpigFor AAGATAACACGCCCACCCTG NM_214055 293
IL1BpigRev TGTCAGCTTCGGGGTTCTTC
IL6pigFor AGATGCCAAAGGTGATGCCA NM_001252429 363
IL6pigRev CTCAGGGTCTGGATCAGTGC
MYOD1pigFor CTACAGCGGTGACTCAGACG NM_001002824 121
MYOD1pigRev GCTGTAATAGGTGCCGTCGT
DTNApigFor ACTACCCACGGCAGTTTTTG XM_003356399 110
DTNApigRev GCGTGTCCAAGAAACCATTT
SGCApigFor AGGTCGAAAGGAAGGCGTAT NM_001144122 131
SGCApigRev CATAGCAGGACAGCAGTGGA
NOS1pigFor GGAAAACAGTCTCCCACCAA XM_003132898 127
NOS1pigRev ATCCTGTTCCCAATGTGCTC
UTRNpigFor GAACGGATCATTGCTGACCT XM_003121163 177
UTRNpigRev CCTGAGGAGTTTGGCTTCTG
18SRTprimer GAGCTGGAATTACCGCGGCT
18SpigFor AAACGGCTACCACATCCAAG NR_046261 141
18SpigRev TCGCGGAAGGATTTAAAGTG
DTNA,(cid:2)-dystrobrevin;For,forward;IL1B,interleukin1(cid:7);IL6,interleukin6;MYOD1,myogenicdifferentiation1;NOS1,(neuronal)nitric
oxidesynthase1;Rev,reverse;SGCA,(cid:2)-sarcoglycan;TNF,tumornecrosisfactor;UTRN,utrophin.aGeneBankdbSNPss410758971.
amide gel (Lonza, Rockland, ME, USA). Following separa- the film was scanned and digitized, and band density was
tion, the protein was transferred to a nitrocellulose mem- measured using Carestream 5.0 molecular imaging soft-
brane (GE Water and Process Technologies, Feasterfille- ware (Carestream Health, New Haven, CT, USA).
Trevose,PA,USA)at90Vfor90mininthecoldroom.For
blots intended to detect dystrophin or utrophin, protein
was separated using 6% gels coupled with a 4% stacking Histologicalstaining
gel.Theseseparationswererunat30Vovernightandthen
continued as described previously, with the exception that Fixed 5-(cid:5)m muscle sections were deparaffinized and rehy-
PVDF membrane (Millipore, Billerica, MA, USA), rather drated by passing slides through 3 Citrisolv (Fisherbrand,
than nitrocellulose membrane, was used. In our hands, King of Prussia, PA, USA) baths and 4 ethanol baths with
PVDF performs better than nitrocellulose for detection of decreasingpercentagesofethanol(100,100,95,and80%).
largeproteins.AllmembraneswerestainedwithPonceauS Hematoxylin and eosin (H&E) staining was performed
to verify equal loading and transfer. Membranes were
according to standard techniques. Briefly, sections were
blocked for 30 min with 5% milk in Tris-buffered saline
incubated in Mayer’s hematoxylin, rinsed with tap water,
with 0.1% Tween 20 (TTBS). Membranes were subse-
counterstained with 1% eosin, and dehydrated, and cover-
quently incubated with primary antibody diluted in 1%
slips were applied. To perform the trichrome stain, rehy-
milk in TTBS at 4°C overnight as follows: dystrophin
drated sections were incubated in Bouin’s solution over-
[1:500; rabbit polyclonal (Abcam, Cambridge, MA, USA);
ab15277; aa 3661–3677], (cid:2)-sarcoglycan (1:1000; NCL-L-a- night at room temperature. The next day, slides were
thoroughly rinsed in tap water and stained with Weigert’s
SARC; Novocastra, Newcastle, UK), and utrophin [1:250;
hematoxylin. Slides were blued with tap water and stained
Developmental Studies Hybridoma Bank (DSHB), Univer-
with Biebrich scarlet. Excess stain was removed with dis-
sityofIowa,IowaCity,IA,USA;MANCHO3(8A4)concen-
tilled water before differentiating sections in a phospho-
tratedevelopedbyG.E.Morris].Thenextday,membranes
were washed 3 times for 10 min in TTBS and incubated in tungstic/phoshomolybdic acid solution. After differentia-
secondary antibody: donkey anti-rabbit IgG horseradish tion slides were stained with aniline blue. Extra stain was
peroxidase linked (1:200; GE Healthcare, Little Chalfont, washed off with distilled water, and sections were differen-
UK) or sheep anti-mouse IgG horseradish peroxidase tiated in 1% acetic acid. Finally, acetic acid was rinsed off
linked (1:2000; GE Healthcare) for 1 h atroom tempera- with distilled water, sections were dehydrated, and cover-
ture, as appropriate. Membranes were again washed 3 slips were applied. To assess muscle damage, slides were
times for10 min with TTBS. After the last wash, ECL coded, and identifying information was removed. In a
(Millipore)wasaddedtothemembranes,andemittedlight blinded fashion, the same trained technician subjectively
wascapturedwithfilm.Toanalyzetheproteinabundance, sorted the slides according to increasing damage.
DYSTROPHIC PIG MUSCLE HAS DISEASE PATHOLOGY 3
Immunohistochemistry(IHC) using fluorescein conjugated goat anti-mouse IgG at 1:100
(Millipore), and laminin was detected as before. Slides were
Dystrophinexpressionandlocalizationweremeasuredusing imaged at (cid:3)100, which resulted in (cid:4)200–750 cells/image.
fixed sections. Muscle sections (5 (cid:5)m) were deparaffinized, Foranalyses,boththetotalnumberofcellsperimageandthe
andantigenretrievalwasperformedbyheatingfor20minat number of positive staining cells per image were counted
95–100°CinTris-EDTAbuffer(10mMTrisbase,1mMEDTA using ImageJ (19). The cell counts from 2 images/section
solution, and 0.05% Tween 20, pH 9.0). After cooling to werepooled,resultingin(cid:4)500–1300cells/section.
roomtemperatureand2washesinPBS,slideswereblocked
with 5% BSA in PBS for 15 min at room temperature. Statistics
Following blocking, slides were incubated overnight at 4°C
withmousemonoclonalanti-dystrophinantibody(D8168;aa Alldataareexpressedasmeans(cid:8)seunlessotherwisenoted.
1400–1505;Sigma,St.Louis,MO,USA)diluted1:300in5%
Datawerecomparedusingttests,andsignificancewassetat
BSA. After 3 washes with 0.05% Tween-20 in PBS, sections P(cid:1)0.05.
wereincubatedwithAlexaFluor488-labeledgoatanti-mouse
IgG(1:100;Invitrogen)for1hatroomtemperatureandthen
washed again. Slides were mounted with Slowfade Gold
Antifade Reagent with DAPI (Invitrogen). Notably, for all RESULTS
IHCtargets,somesectionswereincubatedwithoutaprimary
antibodyorwithoutsecondaryantibodyasnegativecontrols.
For detection of desmin, 10-(cid:5)m frozen muscle sections Dystrophin deficiency in pigs with an arginine to
werewashedinPBSfor10minbeforeblockingwith5%BSA tryptophan (R1958W) substitution
in PBS at room temperature for 15 min. Sections were
incubated overnight at 4°C with rabbit anti-desmin serum Skeletal muscles from 8-wk-old male pigs with a mis-
(1:100; a gift from Dr. Ted Huiatt, Iowa State University, sensemutationinthedystrophingene werecompared
Ames,IA,USA).Thenextday,sectionswerewashed3times
with healthy male littermates. Dystrophin protein ex-
with PBS and incubated with rhodamine-conjugated donkey
pression was decreased by 70% in diaphragm, psoas,
anti-rabbitIgG(1:100;Millipore)for1hatroomtemperature
and longissimus collected from affected animals (tryp-
in the dark. After the secondary incubation, slides were
washed 3 times with PBS, and coverslips were mounted and tophan) compared with healthy littermates (arginine)
sealed as above. To assess dystrophin-glycoprotein complex (Fig. 1A). This decrease was confirmed by 70–90%
(DGC)stabilityinaffectedanimalsandhealthypigs,IHCfor reduction in expression by IHC in the diaphragm and
(cid:2)-sarcoglycan (Novocastra, Newcastle, UK) expression and thelongissimusbutwasnotsignificantlydifferentinthe
localizationwasmeasuredincombinationwithlaminin(Neo-
psoas (Fig. 1B, C). Notably, full-length dystrophin pro-
Markers, Fremont, CA, USA). Sections were treated as de-
tein was present in all muscles, and it was evenly
scribedpreviously,andbothprimaryantibodieswereusedat
localized to the sarcolemma, suggesting that these
aconcentrationof1:100.Secondarygoatanti-mousefluores-
cein-conjugated(Millipore)andgoatanti-rabbitrhodamine- muscles are dystrophin insufficient as opposed to dys-
conjugated IgG (Millipore) were used at a dilution of 1:100 trophin deficient.
for1hatroomtemperatureinthedarktodetect (cid:2)-sarcogly- To better understand the mechanism leading to
canandlaminin,respectively. decreased dystrophin protein accumulation, we mea-
For analysis of protein abundance following IHC, 2 non-
sureddystrophingeneexpression(Fig.1D–FandTable
overlapping (cid:3)200 pictures were randomly taken from each
1). Gene expression was similar at the 5= end of the
sectionwiththeappropriatefilters.Foreachprotein,images
gene,immediatelyupstreamofthesubstitutioninexon
were collected on the same day for each muscle under
identical exposure conditions in random order and in a 41, across the substitution, and immediately down-
blinded procedure by a technician. Digital images were streamofthesubstitutioninthediaphragmandpsoas.
transferred to Openlab (Perkin Elmer, Waltham, MA, USA) In the longissimus, there was a 50% reduction in gene
sothatfluorescenceintensitycouldbemeasured.Thedensity expression at all 4 locations. Transcript abundance
slice function was used to transform the image into a binary
amplifiedbyprimersdesigned3=ofthesubstitutionwas
image such that pixels were identified as either above or
significantlylowerinthediaphragm,psoas,andlongis-
below threshold intensity. Threshold was determined by
simus by 60, 45, and 70%, respectively, indicating
measuring pixel intensity of intracellular and extracellular
areas, as well as at several locations on the sarcolemma in decreased transcript stability.
variousrandomsections.Allimagesweretakenandprocessed
underthesameconditions.TomeasureminimalFeretdiam-
Dystrophin insufficiency is associated with muscle
eter,thelamininimageswereconvertedintobinaryimagesas
histophatology
describedabove.ImageswerethenexportedtotheImagePro
software(MediaCybernetics,Rockville,MD,USA),wherethe
Dystrophin insufficiency was associated with a 5-fold
minimalFeretdiametertoolwasusedtoobtainthemeasure-
ment.ThemeasurementswereexportedtoExcel(Microsoft, increase in serum creatine kinase activity (Fig. 2A),
Redmond,WA,USA),wherethedatawerebinnedandmean whichisconsistentwithotherdystrophinopathymodels
diameterandcoefficientofvariancewerecalculatedforeach and human patients with BMD or DMD patients. In
muscle. addition, affected and healthy animals could be distin-
For determination of fiber type differences in affected
guished from one another during histological evalua-
animals compared with healthy littermates, IHC for slow
tion(evaluatorblindedtothegenotypeoftheanimal)
myosin(A4.951)wasperformedinfrozensectionsincombi-
of the diaphragm and longissimus but not the psoas.
nationwithlaminin.TheA4.651serum(DSHB;developedby
H.M.Blau,StanfordUniversity,Stanford,CA,USA)wasused Dystrophin insufficiency led to necrotic lesions in dia-
undiluted. Type I myosin heavy chain (MHC) was detected phragm and longissimus muscle, apparent in both
4 Vol.28 April2014 TheFASEBJournal(cid:1)www.fasebj.org HOLLINGER ET AL.
Figure 1. Dystrophin protein abundance and
localization.Dystrophinwasassayedinthedia-
phragm, psoas, and longissimus in muscles
takenfromhealthypigsandpigscontainingan
arginine to tryptophan (R1958W) polymor-
phisminexon41ofthedystrophingene,DMD.
A) By Western blot, dystrophin protein abun-
dance was decreased by 70% in muscles from
diseased animals compared with muscles from
healthy animals. B) Representative (cid:3)400 im-
agesresultingfromIHCtargetedtodystrophin.
C) Following fluorescence quantification, dys-
trophin abundance by IHC was significantly
decreased in the diaphragm and longissimus
(P(cid:9)0.05),butfailedtoreachsignificanceinthe
psoas,inpartbecausevariabilityinthecontrol
animals was high and in part because the
magnitude of change in the psoas was not as
substantial as in the diaphragm and longissi-
mus. D) Dystrophin transcript abundance at 5
locations along DMD in the diaphragm. SNP,
single-nucleotidepolymorphism.E)Dystrophin
transcriptabundanceat5locationsalongDMD
in the psoas. F) Dystrophin transcript abun-
dance at 5 locations along DMD in the longis-
simus.*P(cid:1)0.05vs.correspondingcontrol.
H&E and trichrome images (Fig. 2B). Evident in these coefficientoffiberdiameterswasincreasedby(cid:4)20%in
lesions was disorganized fibrosis and fatty infiltration thediaphragmprovidinganobjectivemeasureofmus-
thatgenerallycolocalized.Immunecellinfiltrationwas cle injury (Fig. 2C). Variance coefficient of fiber diam-
onlyoccasionallypresentalongwithimmunecellattack eter in the psoas and longissimus was similar between
of skeletal muscle cells. Gene expression indicating groups.
inflammation, including tumor necrosis factor (TNF),
interleukin 1(cid:7) (IL1B), and interleukin 6 (IL6) was Dystrophin insufficiency alters expression of DGC
similarbetweengroupsinall3muscles(Supplemental members but not other membrane proteins
Table S1). Notably rare in these muscles was the
appearance of centralized nuclei. Related, myogenic In human patients and other animal models, a lack of
differentiation 1 (MYOD1) expression was similar be- dystrophin or insufficient dystrophin expression leads
tweengroups(SupplementalTableS1)forallmuscles, to a collapse of the DGC. Gene expression of (cid:2)-sar-
suggesting that satellite cell activation is not wide- coglycan (SGCA), (cid:2)-dystrobrevin (DTNA), and (neuro-
spread.Whiletherewerenecroticlesionsevidentinthe nal) nitric oxide synthase 1 (NOS1; also known as
longissimus and diaphragm from affected animals, nNOS) was similar in healthy and affected animals for
there were also areas that appeared similar to healthy all 3 muscles (Supplemental Table S1). Proteinexpres-
animals (Supplemental Fig. S1). sion by Western blot, however, demonstrated a 50%
Meanfiberdiameter(minimumFeretdiameter)was reductioninSGCAabundanceinall3muscles(Fig.3A).
similar between healthy and affected pigs across the 3 Such discordant gene and protein expression for
muscles (Supplemental Fig. S2); however, the variance DGC components is consistent with other animal
DYSTROPHIC PIG MUSCLE HAS DISEASE PATHOLOGY 5
Figure 3. Dystrophin insufficiency leads to a reduction in
(cid:2)-sarcoglycan abundance but not utrophin abundance. A)
Representative Western blot of (cid:2)-sarcoglycan indicating an
Figure 2. Dystrophin insufficiency leads to muscle injury. A) (cid:4)50%reduction.B)Representative(cid:3)400imagesforIHCof
Serum creatine kinase activity was increased 4-fold in affected (cid:2)-sarcoglycan.C)Fluorescentintensitywasquantifiedandan
pigscomparedwithhealthylittermates.B)Representative(cid:3)200 80–85% reduction was found in the diaphragm and the
images of slides stained with H&E or trichrome. In a blinded longissimusfromaffectedanimalswhilethepsoaswassimilar
fashion,diaphragmsectionsandlongissimussectionsweresuc- betweengroups.D)RepresentativeWesternblotofutrophin
cessfullyidentifiedaseitherfromhealthyoraffectedpigsbythe and quantification. Utrophin was similar between groups.
appearanceofnecroticlesions,whileaffectedandhealthypsoas *P(cid:1)0.05vs.correspondingcontrol.
muscleswereindistinguishable.C)MinimumFeretdiameterwas
determined on 500–1200 cells/muscle for the diaphragm,
models as well as human patients with DMD (20).
psoas,andlongissimustakenfromhealthyandaffectedpigs,and
SGCA protein abundance was also measured by IHC
thevariancecoefficientwascalculated.Variancecoefficientwas
increased in the diaphragm taken from affected animals com- and found to be decreased by 80–85% in the dia-
pared with healthy animals but was similar in the longissimus phragm and longissimus, while expression was simi-
andpsoas.*P(cid:1)0.05vs.correspondingcontrol. lar in the psoas (Fig. 3B, C).
6 Vol.28 April2014 TheFASEBJournal(cid:1)www.fasebj.org HOLLINGER ET AL.
In addition to SGCA, we also measured abundance
and localization of several other membrane proteins.
Abundance and localization of laminin (Fig. 3 and
Supplemental Fig. S3) and desmin (Supplemental Fig.
S4) were similar between healthy and affected animals
forall3muscles.Notably,wefoundthatutrophingene
expression(SupplementalTableS2),aswellasprotein
expression, was similar between healthy and affected
pigs for all 3 muscles (Fig. 3D). Hence, these muscles
haveasimilarlossofexpressionandorganizationofthe
DGC, as is observed in human patients and other
animal models, without observing compensatory utro-
phin expression, as in the mouse model.
Becauseinotheranimalmodelsandhumanpatients
dystrophinopathyisassociatedwithaprogressivetypeI
shift, we measured type I fiber distribution in these
muscles.Surprisingly,atthisearlytimepointtherewas
a 20% increase in type I fibers in the affected dia-
phragms compared with healthy muscle. Fiber type
distribution in the longissimus and psoas was similar
between groups (Fig. 4).
DISCUSSION
Because of inherent limitations in existing animal
models of dystrophinopathy, there has been great
interest in establishing a novel large animal model of
the disease. A genetic line of pigs was recently discov-
ered that was more susceptible to stress-mediated
death.Agenome-wideassociationidentifiedadefectin
thedystrophingene,whichwasassociatedwithareduc-
tion in dystrophin protein accumulation in skeletal
muscle (16). In this investigation, we evaluated the
expression and abundance of dystrophin and DGC
components in diaphragm, psoas major, and longissi-
muslumborummusclefromhealthyandaffected8-wk-
old male pigs. For pigs, the use of the muscles exam-
ined in this study vary greatly in their function, such Figure 4. Dystrophin insufficiency alters fiber type distribu-
tion.A)Representative(cid:3)200imageofIHCfortypeIMHC.
that the diaphragm is used during respiration; the
B)TypeIMHC-positivecellswereincreased20%inaffected
longissimus is a heavily used antigravity muscle and is
diaphragms compared with diaphragms from healthy ani-
involved in transitioning from laying to standing, dur-
mals, while the psoas and longissimus were similar between
ing standing, in shifting weight from one leg to an- groups.*P(cid:1)0.05vs.correspondingcontrol.
other,andinlyingdown;thepsoas,ahipflexor,isonly
lightly used. We found that in these muscles, dystro-
phin protein accumulation was decreased in affected of a Becker phenotype, not Duchenne. While the
pigs, as was expression of SGCA, a DGC component, Leiden database does not yet have record of a
compared with healthy male littermates. This was asso- BMD-causing missense mutation at this precise loca-
ciated with muscle histopathology consisting of ne- tion, there are numerous documented instances of
crotic lesions, fatty infiltration, fibrosis, and increased missense mutations leading to BMD (21–24). To
fiber-size variability in a muscle specific fashion. Nota- better understand the molecular cause of decreased
bly, expression of utrophin, a protein that can substi- dystrophin protein accumulation, dystrophin gene
tute for the missing dystrophin protein, was similar DMD expression was measured using primers against
between groups. multiple sites along the DMD gene. Gene expression
At 8 wk of age, affected pigs had a 70% reduction inthelongissimuswassignificantlyreducedalongthe
of DMD in the diaphragm, psoas, and longissimus entire gene, while the diaphragm and the psoas only
comparedwithhealthylittermatesthatresultedfrom show a reduction at the 3= end of the gene, suggest-
auniformreductionindystrophinlocalizationtothe ing that the point mutation in the dystrophin gene
sarcolemma.Becauseeachmusclecontainedresidual makes the transcript less stable. This 5=–3= transcript
full-length dystrophin, these pigs are representative imbalance also has been observed in patients with
DYSTROPHIC PIG MUSCLE HAS DISEASE PATHOLOGY 7
BMD (25). How a substitution in the amino acid affectedanimals;however,localizationofDGCcompo-
sequence alters susceptibility to proteolysis is un- nentswassimilar.Hence,thesedatasuggestthatinthe
known.Togainadditionalinformationregardingthe psoas a greater proportion of these proteins are resi-
probability of calpain degradation, using CaMPDB dent at the sarcolemma than in the diaphragm or
(26), we performed in silico digests of aa 1867–2097, longissimus. It is reasonable to suggest then that the
which is inclusive of the amino acid substitution. We similar DGC localization between the psoas from af-
foundthattheaffectedsequencewaspredictedtobe fected and health pigs protects the psoas from injury.
more susceptible to calpain degradation than se- Alternatively, the pattern of use of the psoas in pigs
quence from control animals. Also, the vastly differ- relative to the diaphragm and longissimus may differ
ent amino acid properties of arginine and trypto- resulting in less injury and subsequently allowing dys-
phan likely contribute to aberrant protein folding or trophin accumulation at the sarcolemma. If this were
a resultant conformational change causing reduced the case, it would suggest that increased use, such as
protein stability (22). Alternatively, altered electro- during exercise, could hasten disease progression (35,
static interactions in the rod domain may also destabi- 36). Finally, the psoas is predominantly composed of
lize the dystrophin protein (27). These data suggest typeIfibers,whicharegenerallymorediseaseresistant
that dystrophin insufficiency results from decreased thantypeIIfibers,andmay,therefore,offerprotection
transcriptstabilityand,speculatively,increasedprotein
from disease.
degradation.
The absence or reduction of dystrophin protein
Like in other animal models (11, 28, 29) and
accumulationinhibitsassemblyoftheDGCindystro-
humanpatients(30),failuretoaccumulatesufficient
phic muscle (28–30). In the affected diaphragm,
dystrophin protein leads to a systemic collapse of
longissimus, and psoas, gene expression of SGCA,
muscle stability, resulting in a 4-fold increase in
NOS1, and DTNA was similar to healthy littermates,
serum creatine phosphokinase. H&E and trichrome
which is consistent with other animal models and
staining revealed injury in both the diaphragm and
human patients (20). Dysregulation becomes appar-
longissimus of affected animals, including fatty infil-
ent when evaluating protein accumulation and local-
tration, fibrosis, and necrotic fibers. A progressive
ization of these products. Protein expression and
increase in adiposity is a hallmark of dystrophinopa-
localizationofSGCAwasdecreasedinthediaphragm
thyinhumanpatients(31),althoughitisnotpresent
andlongissimus.Surprisingly,thereductioninSGCA
inthemdxmouseortheGRMDdog(1).Atthisearly
accumulation by Western blot measured in the psoas
time point, and similar to muscle from patients, we
was not well matched with expression measured by
did not see accumulation of adipocytes and fibrosis
IHC. This was consistent, however, with dystrophin
throughout the entire muscle but rather colocalized
measurement by IHC in this muscle. Collectively,
withinfociofnecrosis.Withinthesefoci,fibrosisand
these observations indicate that in the diaphragm
infiltrating adiposity appeared disorganized, in con-
andlongissimus,DGCcomponentproteinsarebeing
trast to the high degree of organization found in
translated(albeitlessthaninhealthymuscle)butare
healthyregionsofmusclesfromaffectedanimalsand
failing to integrate into the membrane. Conversely,
muscles from healthy animals.
in the psoas, translated DGC components appear to
Fiber-size variation is another indicator of muscle
integrate at an abundance that is similar to healthy
injury, and degeneration/regeneration cycles where
muscle. Apparent DGC fidelity is consistent with
larger variance coefficients are indicative of disease
muscleinjury,suchthat,at8wkofage,muscleinjury
in other animal models and patients with dystrophi-
in the diaphragm and longissimus was apparent;
nopathy (32). Consistent with our subjective histo-
however, the psoas was not distinguishable between
logical evaluation, the objectively measured variance
diseased and healthy animals.
coefficients in fiber-size distribution were signifi-
In addition, expression and localization of laminin
cantly increased in diaphragm from affected pigs
compared with healthy littermates. Finally, dystro- and desmin were similar between groups, indicating
phic muscle undergoes a progressive type I shift as that there is not a wholesale collapse of membrane
this fiber type is generally less susceptible to disease- structure. Also, utrophin expression was similar be-
relatedinjury(33,34).Whileunexpectedatthisearly tween groups for all muscles, eliminating one of the
time point, the frequency of type I fibers was in- compensatory mechanisms and, hence, limitations
creased in diaphragms from affected animals com- noted in other animal models.
pared with healthy animals. In total, these data indicate that these pigs have
Despite being dystrophin insufficient like the dia- musclehistopathologyconsistentwithadystrophinopa-
phragm and longissimus, the psoas did not show signs thy. That full-length dystrophin is present at the mem-
of increased muscle histopathology, as assessed brane further implicates these pigs as a novel large
through subjective histological evaluation or, more animal model of BMD. Given the genetic, anatomical,
objectively,byfiberdiametervariance.Themechanism andphysiologicalsimilaritiesbetweenpigsandhumans
leading to preservation of the psoas is of potential andthefactthatthesepigsrecapitulatemanyhallmarks
therapeutic interest. Like in the other muscles investi- of disease, there is the promise that the BMD pig will
gated, DGC abundance was decreased in psoas from resultinatranslationaldiseasemodelcapableoffilling
8 Vol.28 April2014 TheFASEBJournal(cid:1)www.fasebj.org HOLLINGER ET AL.
Description:secondary antibody: donkey anti-rabbit IgG horseradish peroxidase linked .. longissimus is a heavily used antigravity muscle and is involved in