DTIC ADA520026: Capsule Depolymerase Overexpression Reduces Bacillus anthracis Virulence

0.29 MB·English

by  Defense Technical Information Center

Microbiology(2010),156,1459–1467 DOI10.1099/mic.0.035857-0
Capsule depolymerase overexpression reduces
Bacillus anthracis virulence
Angelo Scorpio,3 Donald J. Chabot, William A. Day,4 Timothy A. Hoover
and Arthur M. Friedlander
Correspondence UnitedStatesArmyMedicalResearchInstituteofInfectiousDiseases,Frederick,MD21702,USA
AngeloScorpio
[email protected]
ArthurFriedlander Capsuledepolymerase (CapD)is a c-glutamyltranspeptidase anda productof theBacillus
[email protected] anthraciscapsulebiosynthesisoperon.Inthisstudy,weexaminedtheeffectofmodulatingcapD
expressiononB.anthraciscapsulephenotype,interactionwithphagocyticcellsandvirulencein
guineapigs.TranscriptionalfusionsofcapDweremadetothegenesencodingheat-shockprotein
60(hsp60) andelongation factor Tu (EFTu),and tocapA, a B.anthracis capsulebiosynthesis
gene. Translation signals werealtered toimprove expression of capD,including replacing the
putative ribosome-binding site witha consensus sequence andthe TTGstartcodon withATG.
CapDwasnotdetectedbyimmunoblottinginlysatesfromwild-typeB.anthracisAmesbutwas
detected instrainsengineered witha consensus ribosome-binding site for capD.Strains
overexpressing capDatamounts detected by immunoblotting werefound tohave less surface-
associated capsuleandreleased primarily lower-molecular-mass capsule intoculture
supernatants.OverexpressionofcapDincreasedsusceptibilitytoneutrophilphagocytickillingand
Received 26October2009 adherence to macrophagesandresulted inreduced fitness inaguinea pig modelofinfection.
Revised 4January2010 These data suggest thatB.anthracis may have evolved weak capD expression resultingin
Accepted 27January2010 optimized capsule-mediated virulence.
INTRODUCTION transferring glutamate to a water molecule (hydrolysis)
or an amino acid (transpeptidation). This mechanism
Bacillus anthracis is the causative agent of anthrax and is
results in release of low-molecular-mass capsule and
considered one of the most important biological warfare
attachment of the capsule to the peptidoglycan layer
threats.ThevirulenceofB.anthracisisprimarilyattributed
(Candela&Fouet,2005;Makinoetal.,2002;Uchidaetal.,
to genes located on pathogenicity islands of pX01 and
1993),specifically, totheside-chain amino groupof meso-
pX02. A tripartite toxin composed of protective antigen,
diaminopimelic acid (Richter et al., 2009). We previously
lethal factor and oedema factor is encoded on pX01, while
demonstrated that the capsule-degrading activity of
genes for the synthesis of an antiphagocytic, poly-c-D-
recombinantCapDcanbeexploitedtoenzymicallyremove
glutamicacidcapsulearecarriedonpX02(Mock&Fouet,
the capsule from the surface of bacilli, resulting in
2001). The capsule operon is composed of five genes,
enhanced phagocytic killing by human neutrophils and
capB,C,A,D and E. Capsule depolymerase, encoded by
protection in mouse models of anthrax infection (Scorpio
capD, is a c-glutamyl transpeptidase (GGT)-family protein
et al., 2007, 2008).
that autocatalytically forms a heterodimer consisting of
35 kDa and 15 kDa subunits. CapD shares 32% identity We observed by proteomic analysis that CapD, like CapB,
with the Bacillus subtilis GGT and 35% identity with a CandA,isassociatedwiththemembraneduringgrowthin
recently reported Francisella CapD homologue (Su et al., laboratory media and in vivo (Scorpio et al., 2005). An
2007). Despite this amino acid sequence similarity, the interesting finding from this study was that while CapB, C
B. subtilis GGT is reported to be secreted (Kimura et al., and A were detected in similar amounts, CapD was only
2004), while B. anthracis CapD is membrane associated weakly detected in whole-cell and membrane-enriched
(Candela&Fouet,2005).TheindividualsubunitsofCapD preparations from laboratory-grown bacilli and was
associate to form a functional enzyme that cleaves the detected in amounts ,1% that of CapB, C and A in
c-linked peptide bond of the polyglutamate capsule, bacilli isolated from infected guinea pigs. Nevertheless, a
functional CapD has been shown to be required for
3Presentaddress:BattelleNationalBiodefenseInstitute,Frederick,MD virulenceinmiceandguineapigs(Candela&Fouet,2005;
21702,USA.
Makino et al., 2002; Richter et al., 2009). These observa-
4Presentaddress:VentanaMedicalSystems,Tucson,AZ85755,USA. tions led us to hypothesize that increased expression of
Abbreviation:GGTc-glutamyltranspeptidase. capD may result in more capsule being released from the
035857 PrintedinGreatBritain 1459
Report Documentation Page Form Approved
OMB No. 0704-0188
Public reporting burden for the collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering and
maintaining the data needed, and completing and reviewing the collection of information. Send comments regarding this burden estimate or any other aspect of this collection of information,
including suggestions for reducing this burden, to Washington Headquarters Services, Directorate for Information Operations and Reports, 1215 Jefferson Davis Highway, Suite 1204, Arlington
VA 22202-4302. Respondents should be aware that notwithstanding any other provision of law, no person shall be subject to a penalty for failing to comply with a collection of information if it

does not display a currently valid OMB control number.
1. REPORT DATE 2. REPORT TYPE 3. DATES COVERED
27 JAN 2010 N/A -
4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER
Capsule depolymerase overexpression reduces Bacillus anthracis
5b. GRANT NUMBER
virulence
5c. PROGRAM ELEMENT NUMBER
6. AUTHOR(S) 5d. PROJECT NUMBER
Scorpio, A Chabot, DJ Day, WA Hoover, TA Friedlander, AM
5e. TASK NUMBER
5f. WORK UNIT NUMBER
7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION
United States Army Medical Research Institute of Infectious Diseases, REPORT NUMBER
TR-09-117
Fort Detrick, MD
9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S)
11. SPONSOR/MONITOR’S REPORT
NUMBER(S)
12. DISTRIBUTION/AVAILABILITY STATEMENT
Approved for public release, distribution unlimited
13. SUPPLEMENTARY NOTES
14. ABSTRACT
Capsule depolymerase (CapD) is a c-glutamyl transpeptidase and a product of the Bacillus anthracis
capsule biosynthesis operon. In this study, we examined the effect of modulating capD expression on B.
anthracis capsule phenotype, interaction with phagocytic cells and virulence in guinea pigs.
Transcriptional fusions of capD were made to the genes encoding heat-shock protein 60 (hsp60) and
elongation factor Tu (EFTu), and to capA, a B. anthracis capsule biosynthesis gene. Translation signals
were altered to improve expression of capD, including replacing the putative ribosome-binding site with a
consensus sequence and the TTG start codon with ATG. CapD was not detected by immunoblotting in
lysates from wild-type B. anthracis Ames but was detected in strains engineered with a consensus
ribosome-binding site for capD. Strains overexpressing capD at amounts detected by immunoblotting were
found to have less surfaceassociated capsule and released primarily lower-molecular-mass capsule into
culture supernatants. Overexpression of capD increased susceptibility to neutrophil phagocytic killing and
adherence to macrophages and resulted in reduced fitness in a guinea pig model of infection. These data
suggest that B. anthracis may have evolved weak capD expression resulting in optimized capsule-mediated
virulence.
15. SUBJECT TERMS
Bacillus anthracis, anthrax, capsule depolymerase, overexpression, virulence
16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF 18. NUMBER 19a. NAME OF
ABSTRACT OF PAGES RESPONSIBLE PERSON

a. REPORT b. ABSTRACT c. THIS PAGE SAR 9
unclassified unclassified unclassified
A.Scorpioandothers
surfaceofbacilli,potentiallyallowingthebacillitobemore CTATGTGGGTGCTGGTG-39 and reverse primer 59-TCCCCCG-
readily phagocytosed. To investigate this, in the present GGTCAACCGCAAGGGGGTGAGAGGCACTCACTC-39.Thedown-
stream flank was made by PCR with a 39 KpnI site with forward
studyweupregulatedcapDexpressionusingtranscriptional
primer 59-TCCCCCCGGGGCAGAAGAAATGGAACTTGGAAATC-
fusions to various promoters and modifications to
AAATAAATAGGAGG-39 and reverse primer 59-GGGGTACCCC-
translation signals. Strains with higher capD expression
AGTAATTAAGACACCGTCAAATCCGTTCTAC-39.
had less surface-associated capsule, increased susceptibility
to phagocytic killing, and reduced virulence in guinea FlankswerecutwiththeappropriateenzymeplusXmaIandligated
simultaneously into pE03 after digestion with KpnI and NotI. The
pigs compared with strains with wild-type levels of
aphA-3nonpolarmutagenesiscassettefrompUC18kwasthencloned
capD expression. We propose that B. anthracis may have
into the XmaI site. Selection for homologous recombination was
evolved weak capD expression signals resulting in wild-
performed as described previously (Mendelson et al., 2004). Stable
type amounts of cell-associated capsule and a ratio of knockoutswereselectedforbylossoferythromycinresistance(5mg
low- to high-molecular-mass capsule that is optimal for ml21 in LB broth) and were confirmed by PCR with internal and
virulence. externalprimers.Coloniesappearedhypermucoid,comparedtowild-
type,whengrownonNBYbicarbonateplatesat37uCwith5%CO .
2
Construction of capD fusion strains. Transcriptional fusions of
METHODS
capDwerecreatedbycloninganapproximately300bpPCRproduct
encodingthe39endofhsp60(BA0267),EFTu(BA0108)orcapAinto
Bacterial strains and animals. Strains and plasmids used in this
study are listed in Table 1. B. anthracis Ames (pX01+ pX02+) and the shuttle plasmid pASD2 (Day et al., 2007) as an XmaI–XhoI
DANR(pX012 pX022) were cultured inbrain heart infusion (BHI) fragment. The ORF of capD including 29bp upstream from the
brothwith0.8%sodiumbicarbonateand5%carbondioxideoron putativestartcodonwascloned39totheabovefragmentsasanXhoI–
NBY bicarbonate agar plates at 37uC with 5% carbon dioxide KpnIfragment.ThereverseprimerusedtogeneratecapDforfusion
(Chabotetal.,2004).EscherichiacolistrainsDH5aandGM2163were tocapAwasdesignedtoannealatthe39endofcapE.AdditionalPCR
usedforcloningandstrainconstruction.Antibioticswereusedatthe productsweregeneratedthatincludedthecapDORFandcontaineda
following concentrations: kanamycin, 50mg ml21 for E. coli strains consensusribosome-bindingsite(RBS),AGGAGGT,andaTTGstart
and20mgml21forB.anthracis;andspectinomycin,200mgml21for codon with the forward primer 59-GCGGCGCTCGAGAGGAGGT-
B.anthracis.B.anthracissporeswerepreparedaspreviouslydescribed CAACAACTTGAATTCCTTTAAATGGGGAAAGA-39 and the above
(Chabot et al., 2004). Female Hartley guinea pigs, 350–400g, were capD reverse primers. Additional capD ORFs were generated that
obtained from Charles River Laboratories. Female Swiss Webster containedaconsensusRBSandanATGstartcodonorthewild-type
mice, 6–8 weeks old, were obtained from the National Cancer RBS and a TTG start codon. Primers employed to generate the
Institute. amplicons are listed in Table 2. The pASD2 plasmid constructs
were passaged through E. coli GM2163 before electroporation into
ConstructionofacapDknockoutstrainofB.anthracisAmes. B. anthracis strains. B. anthracis DANR (pX012 pX022) was
All but the first 180 and last 105 bases of capD were deleted by transformed with the plasmids containing capD fused to hsp60 or
homologous recombination with plasmid pE03 (Mendelson et al., EFTu,andkanamycin/spectinomycin-resistantcolonieswereisolated
2004) containing the promoterless aphA-3 cassette from pUC18k onLuria–Bertani(LB)agarcontainingantibiotics.Theplasmidswere
(Menardetal.,1993)flankedbyregionsupstreamanddownstreamof integratedatthe39endofhsp60orEFTuaspreviouslydescribed(Day
capD.TheupstreamflankwasmadebyPCRwitha59NotIsiteusing etal.,2007)andthelinkagestransferredtofullyvirulentB.anthracis
forward primer 59-ATAAGAATGCGGCCGCGAAGCTGATCTTGA- AmesbyCP-51phagetransduction(Greenetal.,1985).Thisresulted
Table1. Bacterial strainsandplasmids used inthisstudy
Strainorplasmid Relevantcharacteristics Source
B.anthracis
Ames Wild-type Labcollection
DANR pXO12pXO22 Labcollection
E.coli
DH5a NewEnglandBiolabs
GM2163 damdcm NewEnglandBiolabs
Plasmids
pE03 Integrativeplasmid Mendelsonetal.(2004)
pASD2 Integrativeplasmid Dayetal.(2007)
pASD2hsp60capD Fusionofthe39endofhsp60tocapDORF Thiswork
pASD2hsp60capDRBS Fusionofthe39endofhsp60tocapDORFwithengineeredRBSforcapD Thiswork
pASD2EFTucapDRBS Fusionofthe39endofEFTutocapDORFwithengineeredRBSforcapD Thiswork
pASD2capAcapDRBSATG Fusionofthe39endofcapAtocapDORFwithengineeredRBSandATGcapDstartcodon Thiswork
pASD2capAcapDTTG Fusionofthe39endofcapAtocapDORFwithengineeredTTGcapDstartcodon Thiswork
pASD2capAcapDRBSTTG Fusionofthe39endofcapAtocapDORFwithengineeredRBSandTTGstartcodon Thiswork
pASD2capAcapDATG Fusionofthe39endofcapAtocapDORFwithengineeredATGcapDstartcodon Thiswork
pASD2capAcapD Fusionofthe39endofcapAtocapDORF Thiswork
1460 Microbiology156
Anthraxcapsuledepolymeraseoverexpression
Table2. Oligonucleotides usedtocreate ampliconsfor construction ofcapD fusionstrains
F,Forwardprimer;R,reverseprimer.
PCRproduct Primersequences
hsp6039end F:59-GCGGCGCCCGGGTAGAAGAGCCAGTTC GTCAAATCGCAATCA
R:59-GCGGCGCTCGAGTTACATCATTCCGCCCATACCGCCCATGCC
EFTu39end F:59-GCGGCGCCCGGGCGTATTATCTAAAGAAGAAGGTGGACG
R:59-GCGGCGCTCGAGTTACTCAACGATAGTAGCAACTACACC
capA39end F:59-GCGGCGCCCGGGAGTGCACTTGTGCAATATCATTTACGTGAT
R:59-GCGGCGCTCGAGTCAAGTTGTTGTCTCCACTGATACTTGATT
capDORF F:59-GCGGCGCTCGAGGAAAATCAAGTATCAGTG GAGACAACAACTTGA
R:59-GCGGCGGGTACCCTATTTATTTGATTTCCAAGTTCCATT
R:59-GCGGCGGGTACCTTAGGGGTTAGCCTGTAGATAATCACTAAT*
*ReverseprimerusedtogeneratecapDORFforfusiontocapA.
in two copies of capD in the hsp60 and EFTu fusions, one on the Wright–Giemsa. Bacilli adherent to macrophages were counted
chromosome and one on pX02. The fusions of capD to capA were visually from at least 10 fields of view (at least 100 macrophages)
madebyintegratingthefusionplasmidsatthe39endofcapAinthe on duplicate coverslips and the mean number of bacilli per
B.anthracisAmescapDmutant.Geneticlinkageswereconfirmedby macrophage (±SEM) determined as previously described (Scorpio
dyeterminatorSangersequencing. etal.,2007).
AnalysisofCapDandcapsuleexpression.Strainsoverexpressing CapD antibody production. Mice were vaccinated subcutaneously
capD and wild-type Ames were grown in BHI/bicarbonate broth at with 10mg recombinant CapD (Scorpio et al., 2007) in 200ml PBS
37uC with shaking. Bacteria were collected by centrifugation and and Ribi R700 adjuvant (Sigma Aldrich), as recommended by the
resuspended in PBS, pH7.4. The cells were disrupted by sonication manufacturer. Mice were boosted at 4weeks and bled from the
andtheresultinglysatesaddedtoanequalvolumeof26SDSprotein periorbital sinusat 7weeks. Bloodwascollected inserum separator
sample buffer. Samples were heated at 100uC for 10min and tubesandserawerewithdrawnaftermicrocentrifugationfor20min
centrifugedfor2min.TheextractedproteinswereseparatedbySDS- at11000r.p.m.
PAGE and stained with Gel Code Blue (Pierce Biotechnology).
Expression of capD was examined by immunoblotting (Invitrogen) Virulence determination. Spores for all challenge experiments
and probed with mouse polyclonal anti-CapD antiserum at 1:1000 were heat-shocked for 40 min at 65 uC, resuspended in water for
dilution. Capsule in culture supernatants from capD-overexpressing injection and administered by intramuscular injection in 200 ml.
strainswasvisualizedbyelectrophoresisin1%agarosegelsfollowed Competitive indices were determined by infecting guinea pigs
bystainingwith0.3%methylenebluein20%ethanolanddestaining with a mixture containing equal numbers of spores derived from
with water. In one experiment 9ml of the culture supernatant from wild-type B. anthracis Ames and a capD-overexpressing strain.
EFTucapDRBS containing low-molecular-mass capsule was treated Guinea pigs were monitored for signs of infection, and when
with 1ml (0.3mg) recombinant CapD (prepared as described moribund (40–48 h after infection) were euthanized and the
previously: Scorpio et al., 2007) and 1.1ml 1M serine. Mixtures spleens removed. The spleens were disrupted by mashing with a
with and without CapD were incubated at 37uC for 2h. Capsule 10 ml syringe plunger in a 70 mm filter basket placed in a 50 ml
degradationbyCapDwasvisualizedbyelectrophoresisin2%agarose centrifugetube.Spleencellswerewashedthroughthebasketwith
gelsfollowedbystainingwithmethyleneblue,asdescribedabove. coldPBS.Relativenumbersofthewild-typeAmesandthecapD-
overexpressing strain were determined by plating serial dilu-
Neutrophil killing and macrophage adhesion assays. tions on LB agar containing orlacking antibiotics. Virulencewas
Neutrophilswereisolatedandkillingassaysperformedaspreviously also determined in guinea pigs by challenge with an intramus-
described (Scorpio et al., 2007). Briefly, heat-shocked spores were cular injection of 2000 spores derived from either wild-type
germinated (26107 ml21) in BHI containing 0.8% sodium Ames or a capD-overexpressing strain and comparing mean
bicarbonate for 90–120min until capsule was readily visible by time-to-death.
Indiainkstain.EncapsulatedbacilliwereresuspendedinDulbecco’s
ModifiedEagle’smediumcontaining10%heat-inactivated fetalcalf Statistics.Neutrophilkillingandmacrophageadherencecompar-
serum(DF10)and10%typeABhumanserum(SigmaAldrich)asa isonswereevaluatedbyanalysisofvariance(ANOVA)withTukey’s
sourceofcomplement.Purifiedhumanneutrophilsweremixedwith post hoc tests. Differences in virulence were evaluated with
bacilliinduplicateataneffector:targetratioof50:1androtatedfor Student’st-testforcompetitiveindexandlogranktestforsurvival
5h. Bacterial viability was measured by serial dilution in water and curve.
plating on LB agar. Results are given as the mean±SEM of the
duplicatesamples.MurineRAW264.7macrophagesweregrownand
used in an adhesion assay as previously described (Scorpio et al.,
RESULTS
2007). Briefly, macrophages were allowed to adhere to circular
coverslips overnight or until growth to confluence. Spores were
germinatedinBHI/bicarbonate,thebacilliresuspendedinDF10ata Translational signalling affects capD expression
concentrationof16108ml21andlayeredontothemacrophagesina
volume of200ml induplicate. After 30min ofincubation at 37uC, To examine the effect of transcriptional and translational
the coverslips were washed extensively with PBS and stained with signalling on capD expression, the capD ORF and
http://mic.sgmjournals.org 1461
A.Scorpioandothers
translation initiation site were cloned into pASD2 down- wild-type linkage of capD to capA. This strain behaved
stream of the 39 end of hsp60, EFTu or capA and the identically to wild-type Ames in all experiments. Addi-
resulting plasmids integrated via homologous recombina- tionally, CapD was not detected in capAcapDRBSTTG,
tion at the respective genes in B. anthracis Ames. Two capAcapDTTG or capAcapDATG (Fig. 1a), suggesting that
transcriptional fusions of capD were made to hsp60, one both a consensus RBS and an ATG start codon were
carryingthewild-typecapDRBSandonewithaconsensus necessary for detectable capD expression for capAcapD
RBS(AGGAGGT).Onetranscriptionalfusionwasmadeto fusions.Interestingly,foralllysatepreparationstested,only
EFTu with a consensus RBS for capD translation. Five the large subunit of CapD reacted with the polyclonal
transcriptional fusions of capD were made to capA con- antibody, suggesting that the small subunit was poorly
sistingofcombinationsofanATGorTTGstartcodonwith immunogenic, consistent with a previous report (Candela
the wild-type or consensus RBS. According to the most & Fouet, 2005).
recent B. anthracis genome annotation (Ames ancestor),
the stop codon of capA overlaps with the TTG start codon
capD expression affects B. anthracis phenotype
of capD (http://www.ncbi.nlm.gov/nuccore/NC_007323).
ConstructionofthecapAcapDfusionscarryingaconsensus The effect of capD overexpression on the phenotype of
RBS resulted in a 20 bp separation between the capA stop B. anthracis was examined by germinating spores in BHI
codon and the capD start codon. The capAcapD fusion broth containing 0.8% bicarbonate under 5% CO and
2
strains constructed to have TTG or ATG start codons and growing them for 5 h or overnight at 37 uC. Bacilli were
wild-type RBS had two possible translation start sites visualized by India ink staining and phase-contrast
separated by 36 bp. The capAcapD fusions included capE, microscopy. When grown in BHI broth, fusions of capD
whichhasbeenshowntobenecessaryforcapsulesynthesis to hsp60 and EFTu in which a consensus RBS was present
(Candela et al., 2005), whereas capE was not included in appeared significantly less encapsulated than the parent
capDfusionstohsp60andEFTu,whichweremadeinAmes wild-typeAmesstrain,whilethecapAcapDRBSATGfusion
carryingafunctionalcapEonpXO2.Geneticlinkagesofthe appeareddevoidofcapsule(Fig.2).Bycontrast,capAcapD,
capAcapDfusionstrainsaredetailedinTable3. capAcapDTTG and capAcapDATG bacilli were encapsu-
lated and appearedsimilar to wild-typeAmes by India ink
Expression of capD was examined by immunoblotting of
staining, while capAcapDRBSTTG was slightly less encap-
whole-cell lysates from strains grown for 5 h or overnight
sulated (data not shown).
(18 h) at 37 uC in BHI/bicarbonate broth. Consistent with
our observations that CapD is poorly detected by Agarose gel electrophoresis of BHI/bicarbonate culture
proteomics analysis, we were unable to detect CapD in supernatants revealed that high-molecular-mass capsule
lysatesofeithertheparentwild-typeAmesstrainoracapD was readily visible in the supernatant from the parent
mutantat18 h(Fig.1a)or5 h(Fig.1c).Bycontrast,CapD wild-type Ames strain and from capAcapD but was
was readily detected in lysates of hsp60capDRBS and not visible in any of the capD-overexpressing strains,
EFTucapDRBS, in which the predicted capD RBS was capAcapDRBSATG, EFTucapDRBS and hsp60capDRBS
replaced with a consensus RBS sequence. CapD was also (Fig. 1b). Intermediate-sized capsule was observed in
detected at 5 h and 18 h in capAcapDRBSATG, which culture supernatants from hsp60capD, while almost
contains both a consensus RBS and an ATG start codon entirely low-molecular-mass capsule was observed from
(Fig. 1a, c). CapD was notdetectedin capAcapD, inwhich capAcapDRBSATG, EFTucapDRBS and hsp60capDRBS.
the pASD2 capAcapDRBSATG plasmid integrated at capD Strain capAcapDTTG appeared to produce capsule of
directlyaftertheengineeredATGstartcodonandformeda a slightly higher molecular mass than wild-type Ames,
Table3. Nucleotide linkages ofcapAcapDfusion strains
RBSsareunderlinedandthecapDstartcodonandcapAstopcodonareunderlinedandinbold.
Strain capAcapDlinkage
Wild-type TATCAGTGGAGACAACAACTTGAATTCCTTTAAA
capAcapDRBSATG TATCAGTGGAGACAACAACTTGACTCGAGAGGAGGTCAA
CAACATGAATTCCTTTAAA
capAcapDRBSTTG TATCAGTGGAGACAACAACTTGACTCGAGAGGAGGTCAA
CAACTTGAATTCCTTTAAA
capAcapDATG TATCAGTGGAGACAACAACTTGACTCGAGGAAAATCAAG
TATCAGTGGAGACAACAACATGAATTCCTTTAAA
capAcapDTTG TATCAGTGGAGACAACAACTTGACTCGAGGAAAATCAAG
TATCAGTGGAGACAACAACTTGAATTCCTTTAAA
1462 Microbiology156
Anthraxcapsuledepolymeraseoverexpression
Fig.1. EffectofcapDlinkageoncapDexpressionandcapsulephenotype.(a)Whole-celllysatesweremadeforeachstrain.
Anequalamountofproteinforeachsamplewasseparatedbyelectrophoresisina4–12%SDS-TricinegelandCapDwas
detectedbyimmunoblottingusingapolyclonalmouseanti-CapDserum.(b)StrainsweregrowninBHI/bicarbonatebrothand
capsuleinthesupernatantwasexaminedbyagarosegelelectrophoresisandstainingwithmethyleneblue.Laneidentitiesare
identical to (a). (c) Temporal expression of capD determined by immunoblotting of whole-cell lysates 5 or 18h after
germination.
suggesting a lower level of capD expression, while capsule was confirmed by reacting it with recombinant
unexpectedly, capAcapDRBSTTG appeared to produce CapD and observing degradation on agarose gels (Fig. 3)
less total capsule than wild-type Ames (Fig. 1b). The as described previously for high-molecular-mass capsule
poly-D-glutamic acid nature of the low-molecular-mass (Scorpio et al., 2007).
http://mic.sgmjournals.org 1463
A.Scorpioandothers
Fig. 2. India ink stain of bacilli from B.
anthracis Ames and capAcapDRBSATG
grownovernightinBHI/bicarbonateandexam-
ined by phase microscopy (magnification
(cid:2)700).
Overexpression of capD reduces B. anthracis vacuoles while bacilli from wild-type Ames were almost
virulence entirely extracellular (data not shown).
TheeffectofoverexpressingcapDonB.anthracisvirulence Virulence in guinea pigs was measured by intramuscular
was examined in cell culture and in a guinea pig infection injection ofwild-type AmesandcapAcapDRBSATG spores
model. Bacilli from two strains which overexpressed capD, in a 1:1 ratio (1000 spores of each strain). Animals were
capAcapDRBSATG and EFTucapDRBS, strongly adhered euthanized when moribund and the amount of each
to RAW264.7 murine macrophages, while wild-type strain was measured by plating serial dilutions of spleen
Ames failed to adhere (Table 4, P,0.001, ANOVA with homogenate onto LB agar with and without antibiotics.
Tukey’s post hoc tests). In addition, bacilli from strains Differencesinthemeanc.f.u.pergspleenbetweenthetwo
capAcapDRBSATG and EFTucapDRBS were susceptible strains revealed that capAcapDRBSATG was significantly
to neutrophil killing, with .99% reduction in viability under-represented relative to wild-type Ames (Fig. 4a,
compared to wild-type Ames bacilli, which were resistant, P50.011,Student’st-test,n54).Toexaminevirulenceina
showing slight growth during the incubation (Table 4, non-mixed infection, guinea pigs were infected with 2000
P,0.001, ANOVA with Tukey’s post hoc tests) as pre- spores of either capAcapD or capAcapDRBSATG and
viously reported (Scorpio et al., 2007).Wet-mount micro- monitored for mortality. Strain capAcapD was chosen for
scopy of bacilli and neutrophil mixtures revealed bacilli comparisonasitcontainsthepASD2plasmidintegratedat
from capD-overexpressing strains engulfed in phagocytic capD but is phenotypically identical to wild-type Ames,
suggesting that the integrated plasmid does not have polar
effects downstream that may inhibit capsule synthesis. All
animalssuccumbedorwereeuthanizedafterinfectionwith
both strains. Infection with capAcapDRBSATG resulted in
ameantimetodeathof54.4±3.6 h(n55)comparedwith
40.5±1.0 h(n54)forcapAcapD,representingasignificant
increase in survival (Fig. 4b, P50.0027, log rank test). By
comparison, previous experiments performed with a 2000
Table 4. Macrophage adherence and neutrophil killing of
capD-overexpressing strains
Bacilli from the different strains were assayed for macrophage
adherenceandneutrophilkillingasdescribedinMethods.
Strain Macrophage Neutrophilkilling
adherence(no.of (%viable,
bacillipercell, mean±SEM)
mean±SEM)
Fig.3. Low-molecular-masscapsulecanbedegradedbyCapD.
EFTucapDRBS supernatant was digested for 2h at 376C with Ames 0.04±0.03 181.3±86
0.3mg CapD in PBS with 0.1M serine (lane 2). Undigested EFTucapDRBS 3.9±1.4* 0.04±0.01*
capsulewastreatedinthe sameway,exceptthatCapD wasnot capAcapDRBSATG 1.9±0.4* 0.01±0.001*
included(lane1).Sampleswereelectrophoresed in2%agarose
andthegelstainedwithmethyleneblue. *P,0.001vswild-typeAmes.
1464 Microbiology156
Anthraxcapsuledepolymeraseoverexpression
surface by excess CapD, exposing the organism to innate
immune defence mechanisms.
Despite the fact that capD resides on a single transcript
with capB,C and A, its expression appears to be
significantly lower than that of the other genes in the
operon (Scorpio et al., 2005). A previous report indicated
that CapD was detected by immunoblots of crude extracts
from B. anthracis RPG1 (Candela & Fouet, 2005).
However, we were unable to detect CapD in B. anthracis
Ames lysates with our polyclonal mouse anti-CapD
antibody.ThemostrecentB.anthracisgenomeannotation
assigns the capD start codon as part of the capA stop
codon, resulting in an overlap of the capD RBS sequence
with the 39 end of capA. Thus, translation of capD may be
coupled with capA by a programmed shift of the ORF
(Oppenheim & Yanofsky, 1980) in which the ribosome,
upon completion ofcapA translation,isshifted backalong
the mRNA to reinitiate translation at the capD RBS
sequence.Themechanism thatsuppresses capDexpression
may involve a combination of factors. For example,
cistron terminal overlap (Shcherbakov & Garber, 2000)
may affect capD translation efficiency due to ribosome
competitionbetweencapAterminationandcapDinitiation
at the overlapping region (Gesteland & Atkins, 1996).
Fig.4. EffectofcapDexpressiononvirulenceinguineapigs.(a) Alternatively, capD expression may be regulated by a
Competitive index of capAcapDRBSATG vs Ames. Guinea pigs
translational coupling mechanism in which the mRNA
werechallengedwithamixturecontainingequalnumbersofheat-
secondary structure inhibits ribosome priming (Rex et al.,
shocked spores derived from Ames or capAcapDRBSATG. The
1994) at the capD translation initiation region. Finally,
numberofc.f.u.g”1fromthespleenswascountedforeachstrain
a weak RBS and TTG start codon may affect capD
by plating on antibiotic-selective medium (P50.011). Data are
expression, although TTG start codons are common in
presented as log c.f.u. per g spleen. (b) Non-mixed infection.
Gram-positive bacteria and are reported to have minimal
Guineapigswereinfectedwith2000sporesofeithercapAcapD
effect on translation efficiency (Ozbudak et al., 2002). We
(&) or capAcapDRBSATG (X) and monitored for mortality.
created genetic fusions of capD to the 39 end of the highly
Analysis of Kaplan–Meier survival curves showed that the
probabilityofsurvivalwassignificantlydifferent(P50.0027). expressed genes hsp60 and EFTu and integrated these into
the chromosome of B. anthracis. Additionally, we created
fusions of capD to the 39 end of capA in which the TTG
spore Ames challenge resulted in a mean time to death of start codon was replaced with ATG and the putative RBS
43.7±3.3 h (unpublished observations). was replaced with the consensus sequence, AGGAGGT.
The recombinant methods used to construct these strains
resulted in a 6 bp separation (the XhoI cloning site)
DISCUSSION betweenthecapAstopcodonandtheengineeredcapDRBS
compared with the parent Ames strain, in which the capD
B. anthracis grows to high numbers in the blood and
RBS overlaps with the 39 end of capA and is separated by
organs of infected animals. This high-density growth is
8 bp from the capD start codon. The engineered sequence
largely a result of resistance to innate immune defence
changes resultedinhigherexpression ofcapDasmeasured
mechanisms conferred in part by the antiphagocytic
by immunoblotting (Fig. 1a). In particular, adding a
polyglutamate capsule. CapD has been demonstrated to
consensus RBS to capD when fused to hps60 resulted in
beaB.anthracisvirulencefactor,contributingtovirulence
detectable CapD compared with no detection observed
by anchoring the capsule to the peptidoglycan (Candela &
with the hsp60capD fusion having the wild-type RBS,
Fouet, 2005) and by releasing low-molecular-mass capsule
suggesting that the RBS significantly affects capD trans-
fragments that may interfere with innate immune func-
lation, similar to the effect of RBS when comparing
tion (Makino et al., 2002). We previously showed that
capAcapDRBSATG with capAcapDATG (Fig. 1a).
exogenous recombinant CapD efficiently degrades the
capsule, resulting in increased susceptibility to phagocytic IncreasedcapDexpressioncorrelatedwithsmalleramounts
killing. Here we demonstrate that overexpression of capD of surface-associated capsule, presumably due to degrada-
in B. anthracis also results in increased susceptibility tion by CapD. Additionally, the culture supernatant
to phagocytic killing and decreased virulence in vivo, capsule from capD-overexpressing strains in which CapD
presumably due to cleavage of capsule from the bacillus was detected by immunoblotting was found to be almost
http://mic.sgmjournals.org 1465
A.Scorpioandothers
entirely of low molecular mass. These phenotypic changes REFERENCES
were associated with increased phagocytosis of bacilli by
human neutrophils and murine macrophages, probably Candela,T.&Fouet,A.(2005).BacillusanthracisCapD,belongingto
due to reduced surface-associated capsule. Overexpression the gamma-glutamyltranspeptidase family, is required for the
covalent anchoring of capsule to peptidoglycan. Mol Microbiol 57,
of capD also reduced virulence in guinea pigs as measured
717–726.
by an increase in the mean survival time in a single-strain
Candela, T., Mock, M. & Fouet, A. (2005). CapE, a 47-amino-acid
challenge and reduced fitness in a competitive index
peptide, is necessary for Bacillus anthracis polyglutamate capsule
experiment comparing the wild-type Ames strain with
synthesis.JBacteriol187,7765–7772.
capAcapDRBSATG. In the single-strain challenge with
Chabot,D.J.,Scorpio,A.,Tobery,S.A.,Little,S.F.,Norris,S.L.&
capAcapDRBSATG, bacilli isolated from the blood and
Friedlander, A. M. (2004). Anthrax capsule vaccine protects against
spleen had a capsule that was not detectable by India ink
experimentalinfection.Vaccine23,43–47.
but was visible by FITC-labelled monoclonal anti-capsule
Day, W. A., Rasmussen, S. L., Carpenter, B. M., Peterson, S. N. &
antibody stain, suggesting that only minimal surface
Friedlander,A.M.(2007).Microarrayanalysisoftransposoninsertion
capsule was required for dissemination from the site of mutationsinBacillusanthracis:globalidentificationofgenesrequired
infection for this strain (data not shown). The dissemina- forsporulationandgermination.JBacteriol189,3296–3301.
tionandresidualvirulenceofthecapAcapDRBSATGstrain Gesteland, R. F. & Atkins, J. F. (1996). Recoding: dynamic
also supports the hypothesis that CapD-generated low- reprogrammingoftranslation.AnnuRevBiochem65,741–768.
molecular-mass capsule contributes to the virulence of Green,B.D.,Battisti,L.,Koehler,T.M.,Thorne,C.B.&Ivins,B.E.
B. anthracis (Makino et al., 2002). The higher amounts of (1985). Demonstration of a capsule plasmid in Bacillus anthracis.
low-molecular-mass capsule released from capD-overex- InfectImmun49,291–297.
pressing strains did not interfere with phagocytosis by Kimura,K.,Tran,L.S.,Uchida,I.&Itoh,Y.(2004).Characterizationof
neutrophils, as efficient killing of capD-overexpressing Bacillussubtilisgamma-glutamyltransferaseanditsinvolvementinthe
strainscouldbeobservedevenata1:1ratioofneutrophils degradation of capsule poly-gamma-glutamate. Microbiology 150,
4115–4123.
to bacilli in which 10% of the assay medium was replaced
Makino, S., Watarai, M., Cheun, H. I., Shirahata, T. & Uchida, I.
by supernatant capsule from the capAcapDRBSATG strain
(2002). Effect of the lower molecular capsule released from the cell
(datanotshown).Thissuggeststhatthecapsuleassociated
surface of Bacillus anthracis on the pathogenesis of anthrax. J Infect
with the bacillus surface is the primary mechanism for
Dis186,227–233.
resistance to phagocytosis. It is possible that low-molecu-
Menard, R., Sansonetti, P. J. & Parsot, C. (1993). Nonpolar
lar-mass capsule may be important for resistance to other
mutagenesis of the ipa genes defines IpaB, IpaC, and IpaD as
innate immune defence mechanisms such as cationic effectorsofShigellaflexnerientryintoepithelialcells.JBacteriol175,
antimicrobial peptides and complement. 5899–5906.
Mendelson,I., Tobery, S.,Scorpio, A., Bozue,J., Shafferman,A. &
These data demonstrate that overexpression of capD
Friedlander, A. M. (2004). The NheA component of the non-
resulted in significant capsule degradation during growth
hemolytic enterotoxin of Bacillus cereus is produced by Bacillus
inBHI/bicarbonatebrothandprobablyinvivo,resultingin
anthracis but is not required for virulence. Microb Pathog 37, 149–
smaller amounts of surface-associated capsule, an increase 154.
in released, low-molecular-mass capsule and reduced Mock,M.&Fouet,A.(2001).Anthrax.AnnuRevMicrobiol55,647–671.
virulence. Taken together, the results suggest that fully
Oppenheim, D. S. & Yanofsky, C. (1980). Translational coupling
virulentB.anthracishasevolvedfinelytunedexpressionof
during expression of the tryptophan operon of Escherichia coli.
capDandthatmaximumvirulencemayrequirebothwild- Genetics95,785–795.
type levels of surface-associated capsule and released low-
Ozbudak,E.M.,Thattai,M.,Kurtser,I.,Grossman,A.D.&Van,O.A.
molecular-mass capsule. (2002). Regulation of noise in the expression of a single gene. Nat
Genet31,69–73.
Rex,G.,Surin,B.,Besse,G.,Schneppe,B.&McCarthy,J.E.(1994).
ACKNOWLEDGEMENTS The mechanism of translational coupling in Escherichia coli. Higher
orderstructureintheatpHAmRNAactsasaconformationalswitch
The research described herein was sponsored by the Medical regulatingtheaccessofdenovoinitiatingribosomes.JBiolChem269,
BiologicalDefenseResearchProgram,USArmyMedicalResearch 18118–18127.
and MaterielCommand, project number A1_X003_04_RD_B. We
Richter, S., Anderson, V. J., Garufi, G., Lu, L., Budzik, J. M.,
thank Sarah Norris for her expert statistical analysis. Opinions,
Joachimiak, A., He, C., Schneewind, O. & Missiakas, D. (2009).
interpretations,conclusionsandrecommendationsarethoseofthe
CapsuleanchoringinBacillusanthracisoccursbyatranspeptidation
authors and are not necessarily endorsed by the US Army.
reactionthatisinhibitedbycapsidin.MolMicrobiol71,404–420.
Research was conducted in compliance with the US Animal
Welfare Act and other federal statutes and regulations relating to Scorpio,A., Wei, J., Ghassemian,M., Su, J., Chen, W., Blank,T. E.,
animals and experiments involving animals and adheres to Richardson,T.H.,Bozue,J.A.,Hoover,T.A.&otherauthors(2005).
principles stated in the Guide for the Care and Use of TheproteomeofBacillusanthracisisolatedfrominfectedanimals.In
LaboratoryAnimals,NationalResearchCouncil,1996.Thefacility Bacillus anthracis, B. cereus, and B. thuringiensis International
Conference,p.20.SantaFe,NewMexico,USA.
where this research was conducted is fully accredited by the
Association for Assessment and Accreditation of Laboratory Scorpio,A.,Chabot,D.J.,Day,W.A.,O’Brien,D.K.,Vietri,N.J.,Itoh,Y.,
Animal Care International. Mohamadzadeh, M. & Friedlander, A. M. (2007). Poly-gamma-
1466 Microbiology156
Anthraxcapsuledepolymeraseoverexpression
glutamate capsule-degrading enzyme treatment enhances phagocy- Su,J.,Yang,J.,Zhao,D.,Kawula,T.H.,Banas,J.A.&Zhang,J.R.
tosisandkillingofencapsulatedBacillusanthracis.AntimicrobAgents (2007).Genome-wideidentificationofFrancisellatularensisvirulence
Chemother51,215–222. determinants.InfectImmun75,3089–3101.
Scorpio, A., Tobery, S. A., Ribot, W. J. & Friedlander, A. M. (2008). Uchida,I.,Makino,S.,Sasakawa,C.,Yoshikawa,M.,Sugimoto,C.&
Treatment of experimental anthrax with recombinant capsule Terakado, N. (1993). Identification of a novel gene, dep, associated
depolymerase.AntimicrobAgentsChemother52,1014–1020. withdepolymerization ofthecapsular polymer in Bacillusanthracis.
Shcherbakov, D. V. & Garber, M. B. (2000). Overlapping genes MolMicrobiol9,487–496.
in bacterial and bacteriophage genomes. Mol Biol (Mosk) 34, 572–
583. Editedby:T.J.Mitchell
http://mic.sgmjournals.org 1467