Table Of Content1
DNase I Footprinting
Keith R. Fox
1. Introduction
Footprmtmg provides a simple, quick, and reasonably mexpensive method
for assessing the sequence specific mteraction of ligands with DNA. Although
the techmque was developed in 1978 for studying the mteraction of DNA-
binding proteins with then target sites (I), it has proved invaluable for deter-
mining the sequence specificity of many small hgands
1.1. Footprinting ,
Footprmting is essentially a protection assay, m which cleavage of DNA is
inhibited at discrete locations by the sequence specific binding of a hgand or
protein. In this technique, a DNA fragment of known sequence and length (typi-
cally a restriction fragment of 100-200 bp), which has been selectively radiola-
beled at one end of one strand, IS lightly dtgested by a suitable endonucleolytic
probe m the presence and absence of the drug under investigation The cleav-
age agent is prevented from cutting around the drug-binding sites so that, when
the products of reaction are separated on a denaturing polyacrylamide gel and
exposed to autoradiography, the position of the ligand can be seen as a gap m
the otherwise continuous ladder of bands (see Fig. 1). In this figure, cleavage
at position “a” will produce, after denaturing the DNA, one long fragment (9
bases) corresponding to the left hand strand, and two short fragments (7 bases
and 2 bases) from cleavage of the right hand strand. Since the bands are located
by autoradiography, only the shortest of these species bearing the radioactive
label will be visualized. The condittons of the cleavage reaction are adjusted so
that, on average, each DNA fragment is cut no more than once. As a result,
each of the bands on the autoradiograph is produced by a single cleavage event,
i.e., single-hit kmetics. If an excessive amount of cleavage agent is used, then
From Methods m Molecular Biology, Vol 90 Drug-DNA Interactron Protocols
Edited by K R Fox Humana Press Inc , Totowa. NJ
1
Fox
gel eleotrophoresis
Fig 1 Schemattc representation of the footprtntmg experiment The DNA is labeled
(*) at the 3’ end of the right-hand strand
labeled products can arose from more than one cleavage event, biasing the dls-
tribution of fragments toward short products. In general, the extent of cleavage
1sa djusted so that between 60 and 90% of the radtolabeled DNA remains uncut,
though longer fragments require greater amounts of digestion to produce suit-
able band intensities.
DNase I footprmtmg has been successfully employed for mdentrfymg or
conlirmmg the preferred DNA binding sites for several hgands mcludmg acti-
nomycm (2-4), mtthramycin (5), quinoxalme antrbrotrcs (6,7), daunomycm
(8,9), nogalamycin (1/J), vartous minor groove binding agents (2,3,12), and
triplex binding ohgonucleottdes (12,13). Various other cleavage agents, both
enzymrc and chemical, have also been used as footprinting probes for drug-
DNA interactions including micrococcal nuclease (24), DNase II (6,15), cop-
per phenanthrolme (16,17), methtdiumpropyl-EDTA.Fe(II) (MPE) (18-21),
uranyl photocleavage (22,23), and hydroxyl radicals (24-26). Each of these
has a different cleavage mechanism, revealmg different aspects of drug-DNA
interactions.
An ideal footprmtmg agent should be sequence neutral and generate an even
ladder of DNA cleavage products in the absence of the hgand This property is
almost achieved by certain chemical probes, such as MPE and hydroxyl radi-
cals. However, the most commonly used cleavage agent (because of its cost
and ease of use) 1s the enzyme DNase I, which produces an uneven cleavage
pattern that varies according DNA sequence and local structure (see Subhead-
ing 1.2.). Cleavage at mdrvtdual phosphodiester bonds can vary by over an order
DNase I Foo tprinting 3
of magnitude m a manner determined by both local and global DNA structure
(27,28). In addltlon, drugs that modrfy DNA structure can induce enhanced
DNase I activity m regions surroundmg their binding sites if they alter the
DNA structure so as to render it more suscepttble to cleavage (3,6,15,29,30).
This IS most frequently seen m regions that are particularly refractory to cleav-
age m the drug-free controls.
1.2. DNase I
DNase I 1sa monomeric glycoprotem of mol wt 30,400. It IS a double strand-
specific endonuclease, which introduces single strand nicks m the phosphodiester
backbone, cleaving the 03’-P bond. Single stranded DNA is degraded at least
four orders of magmtude more slowly (32,32). The enzyme requires divalent
cations and shows opttmal actlvlty m the presence of calcmm and magnesium
(33). Although it cuts all phosphodiester bonds, and it does not possess any
simple sequence dependency, its cleavage pattern 1sv ery uneven and 1st hought
to reflect variations m DNA structure (27,34). In particular, A, * T, tracts and
GC-rich regions are poor substrates for the enzyme. The most important fac-
tors affecting Its cleavage are thought to be mmor groove width (27,28) and
DNA flexibility (35,36).
Several crystal structures have been determined for both the enzyme and its
complex with oligonucleotides (37-42). These show that DNase I bmds by
inserting an exposed loop mto the DNA minor groove, Interacting with the
phosphate backbone, as well as the walls of the groove. This explains why
cleavage is poor in regions, such as A,, * T, tracts on account of their narrow
minor groove, to which the enzyme cannot bind. An additional feature of these
crystal structures 1st hat the DNA 1sa lways bent by about 2 lo toward the major
groove, away from the enzyme. If this bendmg 1s a necessary feature of the
catalytic reaction, then rigid regions, such as GC-rich sequences,m ay be refrac-
tory to cleavage. However, these factors do not explain the very different cutting
rates that are often observed at adjacent dinucleotide steps.I t 1sp ossible that this
is determined by precise orientation of the sclssile phosphodlester bond, How-
ever, the crystal structures show that there may be other specific interactions
between the exposed loop and DNA bases removed from the cutting site. In
particular, tyrosme-76 mteracts with the base 2 posItIons to the 5’ side of the
cutting site and arginme-4 1 binds to the base at position -3. This latter mterac-
tion 1s sterically hindered by a GC base pair in thts position. By examining the
characteristics of several good DNase I cleavage sites, Herrera and Chaires
(43) suggested that the best cleavage site was WYWIWVN (where W = A or T,
Y = C or T, and V = any base except T).
The DNA-binding surface of DNase I covers about 10 bp, i.e., one complete
turn the DNA helix. This has tmportant consequences for interpreting
4 Fox
A
B
Fig 2. Schemattc representatron of the 3’staggered cleavage produced by DNase I
The DNA helix has been opened out and IS viewed along the minor groove The
hatched box represents DNase I. the tilled box represents a DNA-binding ligand
footprmtmg results and explams the observatton that the enzyme overesttmates
drug-binding site sizes Although DNA bases he perpendtcular to the hellcal
axis, they are mclmed relative to the phosphodtester backbone. As a result, clos-
est phosphates, postttoned across the minor groove, are not attached to a single
base pan, but are staggered by about 2-3 bases m the 3’ direction. This is illus-
trated m Fig. 2A, m which the DNA has been drawn lookmg along the minor
groove, showmg the inclmatton of the DNA base pans. Since DNase I (hatched
box) binds across this groove, its bmdmg sate on the top strand 1s located 2 bases
to the 3’ side of that on the lower strand. When a DNA-binding hgand is added
(filled box in Fig. 2B), it can be seen that the closest approach of the enzyme is
not the same on each strand. DNase I can approach closer to the enzyme on the
lower strand; the region of the upper strand protected extends by about 2 bases
beyond the actual ligand-bmdmg sate. As a result, DNase I footprmts are stag-
gered by about 2-3 bases m the 3’ direction across the two strands
2. Materials
2.1. DNase I
For most footprintmg experiments the DNase I does not need to be espe-
cially pure. There 1s ltttle advantage m purchasmg HPLC-pure, RNase-free
enzymes. Currently purchased 1s the type IV enzyme, from bovme pancreas,
from Sigma (St. Louis, MO). This should be dtssolved m 0.15 MNaCl contam-
ing 1 mMMgC1, at a concentratton of 7200 Kumtz U/mL. Thts can be stored at
-20°C, and is stable to frequent freezing and thawing. The enzyme 1sd iluted to
workmg concentrattons immedtately before use; the remainder of the diluted
enzyme should be discarded
DNase I Footprinting 5
Table 1
Sequence of the tyrT DNA Fragment
AATTCCGGTTACCTTTAATCCGTTACGGATGAAAATTACGC~CCAGTTCATTTTTCTC~CGT~CAC
0 10 20 30 40 50 60
3'-AAGGCCAATGGAAATTAGGCAATGCCTACTACTTTT~TGCGTTGGTC~GT~GAGTTGCATTGTG
TTTACAGCGGCGCGTCATTTGATATGATGCGCCCCGCTTCCCGAT~GGGAGCAGGCCAGT~GCATT
70 80 90 100 110 120 130
AAATGTCGCCGCGCAGTAAACTATACTACGCGGGGCGAAG
ACCCCGTGGTGGGGGTTCCC
140 150
TGGGGCACCACCCCCAAGGGCT-5'
The fragment ISo btained by cutting with EcoRI andA vuI a-32P-dATPIS u sedto labetl he 3’ endo f
the lower strand,w hereasa -32P-dCTPIS usedt o labelt he uppers trand
2.2. Choice of DNA Fragment
2.2.1. Natural DNA Fragments
For footprinting experiments, the length of fragment used depends on both
convenience (how easily a specific fragment can be generated) and the resolu-
tion limit of the polyacrylamide gels. The chosen fragment length is typically
between 50 and 200 bp. Although different laboratories have adopted different
natural fragments as standard substratesf or footprmtmg experiments, a few have
been used more widely Among these are the 160 bp tyrT fragment (sequence
shown m Table 1) t&8)), the EcoRI-PvuII fragments from PBS (Stratagene)
(4&M), and several fragments from pBR322 (HindIII-HueIII, HindIII-AM,
or EcoRI-RsaI). The plasmids from which these can be prepared are available
from commercial sources or from the author’s laboratory. In many ways it
would be convenient if a few fragments did become recognized standards, since
this would facilitate direct comparison of the relattve specrfictttes of hgands
prepared in different laboratories. Since many sequence selective small mol-
ecules have recognition sites of between 2 and 4 bp, there is a reasonable prob-
ability that their preferred sites will be present in a lOO- to 200-bp restriction
fragment. However, it should be noted that there are 2 different bp, 10 different
dmucleotides, 32 trmucleotides, 136 tetranucleotides, 5 12 pentanucleotides,
and 2080 hexanucleotides. It can therefore be seen that the chance of finding a
particular binding site within a given DNA fragment becomes more remote the
greater the selectivity of the ligand. A further complicatmg factor is that,
although many ltgands spectfically recognize only a dmucleotlde step, their
binding affinity is often influenced by the nature of the surrounding bases,
6 Fox
which alter the local DNA structure (47-49). It IS therefore possible that using
a natural fragment may fail to detect the optimum bmdmg sites for the most
selective hgands. This becomes especially relevant since many novel synthetic
ligands possess enhanced sequence recogmtton properties, with binding sites
of eight or more base pairs.
2.2.2. Synthetic Oligonucleotides
As explamed, although footprmtmg experiments with natural DNA frag-
ments provide a reasonable estimate of a ligand’s preferred bmdmg sites, these
are complicated by the limited number of sequences studied, together with
ambiguities over the exact bmdmg site within a larger footprmt. The next step
m confirmmg the sequence preference may be to prepare a synthetic DNA
fragment containing the putative binding site and to use this as a substrate for
footprmting experiments (50,51). In addition, for compounds that have been
produced as the result of rational design, one may be able to predict their pre-
ferred bmdmg site. Synthesis of suitable length ohgonucleotides (50 bases or
longer) IS now routine. However, the results obtained with short oligonucle-
otides need to be interpreted with caution and rigorously controlled for several
reasons. First, binding sites located close to the ends of short ohgonucleotides
may not adopt the same configuration as when located within longer sequences
because of “end effects.” Second, smce the synthetic fragments will contam
only one or two binding sites, it is necessary to ensure that other sequences
with equal or greater affinity have not been excluded. This can be investigated
by comparing the mteraction with other closely related sequences, m which
one or two bases m or around the cognate sequence are altered m turn. Analy-
sis is simphfied further if the variant sites are contamed withm the same DNA
fragment.
2.2.3. Synthetic Fragments
A frequent variant on the above is to clone the synthetic oligonucleottdes
mto longer DNA fragments. This removes the problems associated with end
effects and provides other common flanking sequences to which ligand bind-
ing can be compared. An added advantage is that, once it has been cloned, the
sequence can be readily isolated from bacteria. The authors usually clone syn-
thetic ohgonucleotides mto the BamHI site of pUC plasmids. They have pre-
pared a wide range of such cloned inserts, containing central GC, CG, or (A/T),,
sites (11,15,29,30), which are available from the authors’ laboratory on request.
DNA fragments contammg the synthetic inserts can be prepared and radiola-
beled at either end (see Subheading 3.2.) by isolatmg the modified polylmker.
Once again a proper analysis will requtre fragments contammg both cognate
and closely related noncognate sequences.
DNase I Footprinting 7
2.3. Buffers
2.3.1. Solutrons for Plasmid Preparation
1 Resuspenston solution 50 mM Trts-HCl. pH 7 5, contammg 10 mM EDTA.
2. Lysis solution. 0.1% SDS, 0.1 MNaOH.
3 Neutralization solutton 3 M potassium acetate, 2 A4 acettc acid
2.3.2. Genera/ Buffers
1 10 mA4Tris-HCl, pH 7 5, contannng 0 1 mA4EDTA This is used for dtssolvmg DNA.
2. 10 mM Trts-HCl, pH 7.5, containing 10 mA4 NaCl. This is used for preparing
drug solutions
3 DNase I buffer 20 mMNaC1,2 mM MgCl*, 2 mM MnC&
2.3.3. Reagents for Electrophoresis
1. TBE electrophorests buffer This should be made up as a 5X stock solutton con-
taining 108 g Tns, 55 g Boric acid, and 9.4 g EDTA made up to 2 L with water
2 Acrylamide solutions Polyacrylamide sequencing gels are made from a mixture
containing acrylamtde*btsacrylamtde in the ratio 19.1. Because of the toxic nature
of these compounds. acrylamide solution are best purchased from a commerctal
supplier (National Diagnostics [Atlanta, GA], Anachem [Luton, Beds, UK]) and
should be used according to the manufacturers mstructions
3 DNase I stop solution. Formamide containing 10 mM EDTA and 0 1% (w/v)
bromophenol blue
3. Methods
3.1. Plasmid Preparation
Several methods are available for preparing plasmid DNA, which IS suitable
for restriction digestion and radiolabeling, including several commerctal kits
(including Qiagen or Wizard) and caesium chloride density gradient centrifu-
gation. It 1sb eyond the scope of this article to review the relative merits of each
procedure, except to note that in many instances it is not necessary to generate
high purity plasmid preparations. Since the radtolabeled restrtction fragments
are eventually isolated and purified by gel electrophoresis, prior purification of
the plasmids may not be necessary, so long as the preparations do not contain
nucleases or any agents that inhibit restriction enzymes or polymerases. As a
result, plasmtds are usually prepared by standard alkaline lysts procedures, fol-
lowed by extraction with phenol/chloroform. A very brief protocol for extract-
mg pUC plasmids 1sd escribed as follows:
1 Grow 50 mL bacteria overnight.
2 Spin culture at 3000g (I e., 5000 rpm m a Beckman JA20 rotor) for 5 mm m
Oakridge tube.
8 Fox
3 Resuspend the bacterial pellet m 5 mL cell resuspension solution (50 mM Tns-HCl,
pH 7.5, containing 10 mM EDTA)
4. Add 5 mL cell lysis solution (0 1% SDS, 0 1 MNaOH) and mix gently until the
solution becomes clear
Add 5 mL neutralization solution (3 M potassium acetate, 2 M acetic acid)
Spin at 17,000g (12,000 rpm) for 15 mm
Remove the supernatant and add 0 6 vol of lsopropanol.
Spin at 17,OOOg (12,000 rpm) for 15 mm
Remove the supernatant and wash the crude DNA pellet with 5-10 mL 70% etha-
nol Transfer the pellet to an Eppendorf tube and dry
10 Redissolve pellet m 0 5 mL 10 mA4 Tns-HCl, pH 7 5, containing 0.1 mM EDTA
and 100 pg/mL RNase Leave at 37°C to dissolve for at least 30 mm
11 Extract twice with 0 5 mL phenol/chloroform (phenol forms the bottom layer and
should be discarded) The interface will probably be very messy, leave the Junk
behind
12. Remove any dissolved phenol by extracting twice with 0 5 mL ether (which forms
the top layer and should be discarded) Allow excess ether to evaporate by stand-
ing at 37°C for a few minutes
13 Precipitate with ethanol, dry and dissolve m 100-l 50 JJL Tns-HCI, pH 7 5, con-
taining 0.1 mM EDTA
3.2. Radiolabeling the DNA
DNA fragments can be efficiently labeled at either the 5’ end (using poly-
nucleotlde kmase) or 3’ end using a DNA polymerase. However, the results of
DNase I digestion are easiest to interpret for 3’-end-labeled fragments. Smce
DNase I cuts the 03’-P bond, the products of dlgestlon possess a 3’-hydroxyl and
5’-phosphate group. In contrast, Maxam-Gilbert sequencing reactions, which are
used as markers in footprmtmg gels (see Subheading 3.3.), leave phosphate
groups on both sides of the cleavage pomt (52). As a result, the radlolabeled
products of DNase I cleavage and Maxam-Gilbert sequencmg reactions will be
identical if the DNA 1s labeled at the 3’ end (i.e., both possess a phosphate at the
5’ end). However, if the DNA 1s labeled at the 5’ end then the labeled DNase I
products will possess an extra phosphate group and so run slightly faster than the
correspondmg Maxam-Gllbert products. Although this difference 1s often over-
looked in footprmtmg gels, it becomes significant for short fragments for which
the difference m mobility may be as great as 2-3 bands. For enzymes that cut the
O-5’ bond, such as DNase II and mtcrococcal nuclease, 5’-end-labeled fragments
comlgrate with the Maxam-Gilbert marker lanes.
3.2.1. 3’-End Labeling with Reverse Transcriptase
The production of 3’-end-labeled DNA fragments can be achieved by cut-
ting with a restrlction enzyme that generates sticky ends with 3’-overhanging
DNase I Footprmting 9
ends, followed by filling m with a polymerase using a suitable [a-32P]-dNTP.
The fragment of interest IS then released from the remamder of the plasmid by
cleaving with a second enzyme that cuts the other side of the region of interest.
The two restriction enzymes usually cut at single locatlons in the plasmid,
though this 1sn ot necessary so long as the various radiolabeled fragments can
be separated from each other. The most commonly used polymerase is the
Klenow fragment. However, it is found that the most efficient labeling is
achieved using AMV reverse transcriptase, even though this 1s actually an
RNA-dependent DNA polymerase. However, not all commercially sources of
this enzyme are equally reltable; consistent results are obtained with reverse
transcrlptase from Promega or Pharmacia
3 2 1 .l RESTRICTION DIGESTION AND a’-END LABELING
Using the aforementioned procedure for DNA isolation, the followmg 1s
used for generating radlolabeled Hindlll-EcoRl polylmker fragments from
pUC plasmids.
1. Mix 30 pL plasmld (about 50 pg DNA) with 10 pL of 10X restrlctlon enzyme
buffer (as supplied by the manufacturer), 45 PL water.
2 Add 3 pL HzndIII (A/AGCTT) and incubate at 37°C for 2 h
3. Add 1 PL [a-32P]-dATP (3000 Wmmol, Amersham)t ogether with 1 PL reverse
transcriptase and Incubate for a further 1 h
4 The reverse transcriptase IS then Inactivated (to prevent further mcorporatlon of
radiolabel at the 3’ end of the second restrlctlon site) by heatmg at 65°C for 5 mm
5 After cooling to 37”C, 3 pL EcoRI (G/AATTC) is added and the mixture mcu-
bated for a further 1-2 h In this case, the DNA can be labeled on the opposite
strand by reversing the order of addition of EcoRI and HzndIII
If the second enzyme produces blunt ends or sticky ends with 5’ overhangs,
or if the 3’ overhangs sites can not be filled m with dATP, then all the enzymes
can be added simultaneously. Examples of such combinations for pUC
polylinker fragments are HzndlII-SacI, and EcoRI-&I. The @rT fragment can
be prepared by simultaneous digestion with EcoRl and Aval. In this instance
the EcoRl end is labeled with [a-32P]-dATP, whereas the Aval end can be
labeled with [a-32P]dCTP. Although various enzymes are supplied with dlffer-
ent reaction buffers, it 1s found that there IS usually no need to change buffers
between the first and second enzymes.
6 The mixture of radlolabeled fragments is preclpltated by addmg 10 PL of 3 M
sodium acetate and 300 pL ethanol, followed by centrlfugatlon m a suitable
microfuge, at top speed The pellet 1s washed with 70% ethanol, dried and dls-
solved m 15-20 FL Tris-HCl containing 0 1 mA4 EDTA. Then 4 PL of loading
dye (20% F~oll, 10 mA4EDTA, 4 1% [w/v] bromophenol blue) is added before
10 Fox
loading onto a polyacrylamide gel (typically 6-8%). The gel should be run cold,
so as not to denature the DNA, it is usually run 0 3-mm-thick, 40-cm-long gels in
1X TBE at 800 V Samples are loaded into slots 10 mm wide by 15 mm deep
After the bromophenol blue has reached the bottom of the gel (about 2 h), the
plates are separated and the gel covered with Saran wrap Scanning the gel with a
hand-held Geiger counter should give a reading off scale (1 e , at least 3000 cps)
over the radiolabeled bands The precise location of the radiolabeled bands is
determined by short (2-10 min) autoradiography This autoradlograph IS placed
under the glass plates and used to locate the band of Interest, which IS cut out
using a sharp razor blade
3.2.1.2 EXTRACTION OF RADIOLABELED DNA FRAGMENTS
The simplest, cheapest, and most efficient method for extracting radio-
labeled DNA fragments from polyacrylamlde gel slices IS by diffusion Place a
small glass wool plug m the bottom of a 1 mL (PlOOO) pipet tip and seal the
bottom end with parafilm. Add the gel slice containing the radiolabeled DNA
and cover this with 10 mA4 Tris-HCl, pH 7 5, containing 10 mM EDTA (about
300 pL is sufficient). Cover the top of the pipet tip with parafilm and incubate
at 37°C with gentle agitation. This is usually incubated overmght, though most
of the DNA elutes after 2 h. Remove the parafilm from the top and bottom of
the tip and expel the buffer mto an Eppendorf tube using a pipet and/or low-
speed centrifugation (15OOg m an Eppendorf centrifuge). The gel slice should
be retamed in the pipet tip by the plug of glass wool, though a small amount of
polyacrylamide does occasionally come through This can be removed by cen-
trifugation. For fragments shorter than 200 bp, this procedure recovers about
95% of the radiolabel m the gel slice, though the efficiency decreases for longer
fragments. The DNA should then be precipitated with ethanol and redissolved m
Tris-HCI containing 0.1 mA4 EDTA so as to generate at least 10 cps per pL on
a hand-held counter. For most footprintmg experiments it is not necessary to
know the absolute DNA concentration, since this is vamshmgly small. The
important factor is concentration of the radiolabel, which should be sufficient
to produce an autoradiograph within l-2 d exposure.
3.3. Maxam-Gilbert Marker Lanes
Bands in the DNase I digestion patterns are identified by comparison with
suitable marker lanes. Since each DNA fragment produces a characteristic sequence
dependent digestion pattern, it is sometimes possible to identify the bonds by
comparison with a previous (published) pattern.
3.3.1. G-Tracks
The simplest and most commonly used marker lane is the dimethylsulfate-
piperidme marker specific for guanine (52). Since the procedure is more time-