Table Of Content138 Journalofthe Lepidopterists' Society
JournaloftheLepidopterists'Society
61(3),2007,138-153
DNA BARCODES OF CLOSELY RELATED (BUT MORPHOLOGICALLYAND ECOLOGICALLY
DISTINCT) SPECIES OF SKIPPER BUTTERFLIES (HESPERIIDAE) CAN DIFFER
BY ONLY ONE TO THREE NUCLEOTIDES
John M. Burns
DepartmentofEntomology; National MuseumofNaturalHistory,Smithsonian Institution,P.O. Box37012, MRC 127,room E-515,
Washington,DC20013-7012,USA,email:[email protected]
Daniel H. Janzen
DepartmentofBiology,UniversityofPennsylvania,Philadelphia, PA 19104, USA,email: [email protected]
Mehrdad Hajibabaei
DepartmentofIntegrative Biology,UniversityofGuelph, Guelph,ON,CanadaNIG2W1,email: [email protected]
Winnie Hallwachs
DepartmentofBiology, UniversityofPennsylvania, Philadelphia, PA 19104,USA,email:[email protected]
PaulD. N. Hebert
DepartmentofIntegrativeBiology, UniversityofGuelph,Guelph,ON,CanadaNIG2W1,email:[email protected]
ABSTRACT. UnlikemostspeciesofLepidopterawhose DNAbarcodeshavebeenexamined,closelyrelatedtaxaineachofthreepairsof
hesperiids(PohjctorcletaandP.pohjctor,CobahisvirbiusandC.fidicula,NeoxeniadeshidaandN.pluviasilva Burns,newspecies)seemin-
distinguishablebytheirbarcodes;butthatiswhensomeofthecytochromecoxidaseI (COI)sequencesareshortandsamplesizesaresmall.
Theseskipperbutterfliesareunquestionablydistinctspecies,asevidencedbygenitalicandfaciesdifferencesandbyecologicsegregation,i.e.,
onespeciesofeachpairin diyforest,theotherin adjacentrainforestinAreadeConservationGuanacasteinnorthwesternCostaRica. This
nationalparkisthesourceofthespecimensusedinthisstudy,allofwhichwerereared. Larvalfoodplantsareofnoorproblematicvalueindis-
tinguishingthesespecies. Largesamplesolindividualswhosebarcodesareacceptablylongrevealslightinterspecificdifferentiation(involving
justonetothreenucleotides)inallthreepairsofskippers. Clearly,thechronicpracticeofvarioustaxonomistsofsettingarbitrarylevelsofdif-
ferentiation lordelimitingspeciesisunrealistic.
Additionalkeywords: AreadeConservationGuanacaste,CostaRica,dryforest,rainforest,foodplants,genitalia,Neoxeniadespluviasilva
Bums,n.sp.
A DNA barcode is the base pair (bp) sequence ofa and taxonomic studies at and around the species level
short (-650 bp), standard segment of the genome wellbeforethis epithet appeared, inthe fewyears since
(Hebert et al. 2003). In animals, this is part of the its introduction, barcodes have been used for their
mitochondrial gene cytochrome c oxidase I (COI). specific purpose with notable results and with rapidly
Because the COI gene generally mutates at increasingfrequency.
evolutionarily rapid rates, comparison ofbarcodes in a The rearingofmyriadwild-caughtcaterpillars inArea
sample ofindividuals best reveals differentiation at low de Conservacion Guanacaste (ACG) in northwestern
taxonomic levels. Hence barcodes can be extremely Costa Rica is now approaching its thirtieth year (for
useful in distinguishing and identifying species, information about both site and rearing process, see
Coupling this concept with the idea of always Miller et al. 2006, Janzen & Hallwachs 2006, Burns &
comparing the same short length ofCOI across awide Janzen 2001). DNAbarcodes (ofatotalof4,260reared
—
diversity of taxonomic groups and doing so with adults) havebeenabletodistinguish amongalmost98%
—
demonstrable success is what led to the catchy name of 521 previously known species of the lepidopteran
"DNA barcodes" (Hebert et al. 2003). Even though families Hesperiidae (skipper butterflies), Sphingidae
COI had been used effectively in various evolutionary (sphinx moths), and Saturniidae (wild silk moths)
Volume 61, Number 3 139
(Hajibabaeiet al. 2006, Janzen et al. 2005). Rare cases The Species Pairs in Question
where barcodes failed, which always involved closely Ecologic separation (Figs. 1-3). Each pair
related congeners, are worth examiningin more detail. comprises a dry-forest species and a rainforest species.
In this paper we treat three such pairs of congeneric Parapatryofthis kindis arecurrent distribution pattern
skipperspecies (notedin Hajibabaeietal. 2006:table 1). among closely related lepidopteran species in ACG. In
WpaeirmianpantdheveercyolnoegaircAseCpGa.ratWioen dofoctuhemesnptectiehse isnpeecaicehs ceaocmhespaifirrsot:f thPeolfyocltloorwicnlgetlaist,Evtahnesdrayn-dforPe.stposhpjecctieosr
status of each member of a pair (and describe one as (Prittwitz), Cobalus uirbius (Cramer) and C. fidicula
new) on morphologic grounds. We discuss the various (Hewitson), Neoxeniades luda (Hewitson) and A7
degrees towhich larval diets, although specialized, are pluviasilva Burns (a new species described below)..
unreliable for species discrimination. And we show, by Poli/ctor is a pyrgine genus, and Cobalus and
scrutinizing sequence length and composition, that
Neoxeniades are hesperiine genera.
DNA
barcodes separate the species after all. Despite From ourdistribution data, parapatryin bothpairs of
the immense value ofDNA barcodes and the fact that hesperiine species appears to be complete (Figs. 2, 3)
they have often indicated overlooked species, it is whereas that in the pyrgine pair does not (Fig. 1). Out
important t—o consider characters besides the barcodes of211 rearedindividuals (wild-caughtas caterpillars) of
themselves a point made repeatedlyin the revelation the rainforest species P. polyctor, four came from dry
of 10 cryptic species hiding under the one name forest. The genitaliaofthese apparentstrayshavebeen
Astraptes fulgerator (Walch) in ACG (Hebert et al. KOH-dissected and thoroughly studied to be sure of
2004).
Area de Conservacion Guanacaste - World Heritage Site
B5°50' 85°40' 35"30' 85'20'
*
II?
X - J
PuntaManiaElena
»*«*<.
• Polyctorcleta
I I Polyctorpolyctoi W*w£y
(§) Stations
^ Towns 10°40' S*NKC
-«InternationalAirport
^^/internationalBorder
^A^/I/nRtoeardasmericanHighway
I IProtectedArea
Scale: ™60 Kilometers APrreoadudceedCobnyseWravladcyioMnedGiunaanacaste-2006
Fig. 1. SpatialdistributionofPohjctorcleta andP. pohjctorinandnearACG.
140 Journalofthe Lepidopterists' Society
their specific determination. Because both species of from this group gave no hint ofhybridization.
this essentially parapatric pair ofPohjctor eat the same Morphologic differences (Figs. 4-41; Tables 1, 2).
three species offoodplants (Table 3), and because one In all three pairs, the brown ground color of the adult
of these plants occurs in both rain and dry iorest, a averages palerin the dry-forest species dian itdoes in its
femalewanderingfrom rain forestcan findan attractive rainforest counterpart (Figs. 4—27). This is especially
foodplant in diy forest and oviposit on it. The flight of evident when comparing long series of more or less
these skippersis farstrongerthannecessarytotravelthe recendyreared (thereforeunfaded) specimens.
distance involved. Ofthe four P. pohjctor caterpillars In bothsexesofPohjctor,aspotspanningdiedistalend
found in dry forest, three were eating the species of of the forewingcell is hyaline in P. cleta but opaque in P.
foodplant most often eaten bythis skipperin rain forest •pohjctor. A malesecondarysexcharacterindiesespecies
(andbecausetwo ofdiosewere foundontheveiysame ofPohjctorcomprises atuft oflonghairlike scales arising
plant, they are probably offspring of a single female); near the base ofthe dorsal hindwing costa, as well as an
the fourth caterpillar was eating an exceedingly elongatepatchofpale specializedscales embracedbythe
common,butstrictlydry-forest, speciesdiatisbyfardie swollenbeginningofvein7andasimilarlyswollen,closely
preferred foodplantofP. cleta. adjacent lengdi ofvein 6; in bodi veins, swellingextends
A small number of P. cleta caterpillars found in out to die end ofthe cell; andthe hairlike scales are long
disturbedecotone between dryand rain forest, andless enough to overlie the special patch. These presumably
than 2 km from the latter, were eating the main pheromone-disseminatinghairsaremosdytoentirelydark
foodplant of P. pohjctor. KOH-dissection and inP. cletabutpale (oftenorangish) inP. pohjctor(cf. Figs.
examination oi the genitalia of the four adults reared 4and6).
Area de Conservacion Guanacaste - World Heritage Site
Scale: ^SO Kilometers ProducedbyWaldyMedina
AreadeConservacionGuanacaste-
FlG. 2. SpatialdistributionofCobalusvirbiusandC.fidicula inandnearACG.
Volume 61, Number3 141
Area de Conservacion Guanacaste - World Heritage Site
• Neoxeniadesluda
I I Neoxeniadespluviasilva
(CO Stations
•fa Towns
-+*InternationalAirport
.A/internationalBorder
^A^/i/nRtoeardasmericanHighway
^^
; ProtectedArea
85*20- &5°1V
Scale: 260 Kilometers APrreoadudceedCobnyseWravtadcyioMnedGiunaanacaste-2006
FlG.3. SpatialdistributionofNeoxeniadesluda andA7, pluviasilvainandnearACG.
Though clearly variations on a theme, the male reaches the outer margin, ventrally extends from the
genitalia ofthese two Polijctorspecies differ in striking tornus to vein 6, and looks pure white on both wing
—
ways. Despite substantial individual variation, almost surfaces. Lateral orange scaling broad on the outer
—
every genitalic part differs interspecifically to at least side ofdiepalpus andnarrowbehindthe eve isbright
some extent; but it is the highlyasymmetricvalvae that in C.fidicula but just dully suggested, and only on die
differ most (see Table 1 and cf. Figs. 28-33). Even the palpus, in C. virbius. Cobalusfidicula is a little larger
lesselaboratefemale genitaliaare notablydistinctindie than C. virbius, and its forewing hvaline spots are
two species (Table 2). likewiselarger.
Both species of Cobalus, which are predominantly The male genitalia (which are symmetric) differ in
brown, have a conspicuous white patch both dorsally two obvious respects. The ventral distal division of the
andventrallyon a distal areaofthe hindwing. In ACG valva is longer and dorsally dentate in C. fidicula (cf.
specimens,thispatchisrestrictedto males oiC.fidicula Figs. 35 and 37). The verybroad uncus in dorsal view
but expressed by both sexes of C. virbius (Figs. 8-11, shows apairofprominentlateral swellings in C. cirbius
20-23), except for two females in which it is barely (cf. Figs. 34 and36).
perceptible. Bothspecies expressitmorefullyventrally
than dorsally. In C.fidicula the patch stops before the Neoxeniades pluviasilva Burns, new species
outermargin soastoleave anarrowstripofdarkbrown (Figs. 3, 14, 15, 26, 27, 40, 41, 45, 46; Table 3)
ground color, ventrally the patch extends from mid Etymology. Thespecies name, anouninapposition,
space lc to vein 6, and the white of the patch looks comesfrom the Latinpluvia forrainandsilra forforest.
creamyon the ventral surface. In C. virbius the patch Diagnosis. This is a rainforest species whereas
142 Journalofthe Lepidopterists' Society
Table 1. MajordifferencesbetweenmalegenitaliaofPolyctor Type specimens: Holotype: male (Figs. 14, 26, 45. 46 [see
cleta andP. polyctor. arrow]),vouchercode 06-SRNP-31674 (Janzen & Hallwachs2006),
Sendero Memos, Sector Pitilla, Area de Conservaci6n Guanacaste,
Costa Rica, 740 m, latitudelO.98171, longitude -85.42785.
Polyctorcleta Polyctorpolyctor Deposition: National Museum of Natural History, Smithsonian
Institution (USNM). Labelled (yellow): LEGS AWAY/FOR DNA.
LEFT VALVA: DNA barcode (658 bp) of holotype (coded MHAHH575-06I06-
SRNP-31674lAfeoxenia<iespluviasilva):
Curvedflapextending AACTTTATACTITATTrrrGGAATTTGAGCAGGAATATTAGG
inwardfromdorsal Narroweratbase Wideratbase AACTTCATTAAGTTTATTAATCCGTACAGAATTGGGAAATCCAG
margin GATTiTTAATTGGAAATGATCAAATTTACAATACTATTGTTACAG
Distaldorsaldivision Notexpanded;teeth Expanded;teeth CTCATGCATTTATTAT\AITTTTTTTATAGTTATACCTATTATAAT
TGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCT
finer coarser
CCAGATATAGCTTTCCCTCGATTAAATAATATAAGATTTTGATTA
TTACCTCCTTCTTTAATACTTTTAATTTCAAGAAGAATTGTAGA
Distalventraldivision Bentsharplydorsad Evenlycurveddorsad AAATGGAGCTGGCACTGGATGAACTGTTTATCCCCCTCTTTC
CTCTAACATTGCTCATCAAGGATCATCTGTAGATTTAGCAATCT
RIGHT VALVA: Loweratanterior Higheratanterior TCTCACTCCATCTAGCTGGAATTTCATCTATTTTAGGAGCTATT
end end AATirrATTACCACAATTATTAATATGCGAATTAAAAATTTATCTT
TTGATCAAATATCTTTATTCGTGTGATCTGTTGGTATTACTGCT
TTACTTTTACTCTTATCTCTACCAGTCTTAGCTGGAGCTATTAC
Distaldorsaldivision:
AATATTACTTACTGACCGAAATCTTAATACTTCTTTTTTCGACC
Dentationonedgeof Moredistal; finer Moredorsal;coarser CAGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Paratypes: 14males, 19females,ACG,CostaRica(USNM).
SACCUS Moredelicate; Heavier;longer The lone synonym ofN. luda is Proteides hundurensis Mabille.
shortertoaboutgone Mabille's (1891) original description ofone female from Honduras
clearlyappliestoN. luda.
UNCUS,dorsallynr. Nolongitudinal Pairoflongitudinal Foodplants: Larval ioodplants of this rainforest
origin humps humps
skipper at least eight species in five genera (one
introduced) of Bromeliaceae (Table 3) [no known
N. luda is a species of the dry forest (Fig. 3). At a overlapin foodplantuse at specieslevelwith dry-forest,
glance, N. pluviasilva is darker than N. luda and does sisterspeciesN. luda; but one overlap atgenus level].
not express a large, pale, outer marginal area on the
ventral side ofthe hindwing nearlyas well (cf. Figs. 26, Larval foodplants (Table 3). Foodplants do not
27with24, 25). Infemales ofN. pluviasilva,die double distinguish sisterspecies ofthe pyrgine genus Polyctor:
both of these skippers eat one and the same plant
hyalinecellspotoftheforewingextensivelyoverlaps the
spotinspace2whereasinN. luda females, this forewing species in each ofthree genera (Allenanthus, Coutarea,
and Exostema) ofthe family Rubiaceae. Nevertheless,
cell spot overlaps the spot in space 2 little or not at all
(cf. Figs. 15, 27with 13,25). P. cleta andP. polyctorusediese plants atverydifferent
Description. Member,withN. luda,ofmainly SoudiAmerican frequencies. Although this may reflect different
—
N. scipio species complex treated by Evans (1955) as a polytypic preferences ofthe skippers, it more likely stems from
species. ThiscomplexcloselyrelatedtotypespeciesofNeoxeniades,
the different ecologic distributions of the foodplants:
N.musarionHaywardofRiodeJaneiroandPetropolis, Brazil.
Fades: Brown ground color dark. Ventral brown ground color Coutareahexandra occurs atlowfrequencyinbothrain
sexuallydimorphic: warmerandrustierinmale(Fig.26);colder,with and dry forest, A. erythrocarpus is a rainforest plant
purplishgrayoverscaling,infemale(Fig.27). Sexualdimorphismalso
pronouncedin size offorewinghyaline spots in space2 andin cell: Table 2. Major differences between female genitalia of
much larger in female than in male, with spots overlapping one Polyctorcleta andP. polyctor.
another (cf. Figs. 15, 27 widi Figs. 14, 26) [no such pronounced Polyctorcleta Polyctorpolyctor
sexual dimorphisms inN. luda (Figs. 12, 13, 24, 25)]. Large, outer
marginal,palepatchonventralhindwinginconspicuousinmale(Fig.
26)toallbutnonexistentinfemale (Fig.27) [patchalwaysobviousin
bothsexesofN. luda (Figs. 24,25)]. Dorsally, malealwaysshowing Sclerotizedsterigmal Smaller Larger
hyalinespotinspace lbjustabovemidvein 1,butspotalmostalways area
small(Fig. 14)totiny. Female,moreoftenthannot,lackingthisspot
dorsally;butspot,whenshowing,usuallytiny(Fig. 15). [InN. luda, Overallasymmetry Notextreme Pronounced
malealwayswidithisspot,andspotusuallywell-expressed (Fig. 12);
abouttwo-thirdsoffemaleswiththisspotwhich,whenpresent,more
oftensmall(Fig. 13)thantiny] Sclerotizedflapon Absentorsmall Verylarge
Malegenitalia: Symmetric;shortanterioredgeofslightlyraised, rightsideofsterigma
dorsally dentate, distal end ofvalva curved somewhat cephalad in
lateralview (Fig. 41) [aboutstraight to curved somewhatcaudadin Sclerotizedostium Conspicuously Relativelyflushwitir
lateralview(Fig.39)inN. luda]. bursae projecting(tubelike) surfaceofsterigma
Female genitalia: Immediately anterior to papillae anales, fromsurfaceof
sclerotized transverse plate of lamella postvaginalis with broad, sterigma
roundedmidventralelevation[narrower,morepointedinN. luda].
Volume 61, Number3 143
Table 3. Larval foodplants of two species of Polyctor, (used byP. cleta at the very edge ofthe dry forest/rain
Cobalus, andNeoxeniadesinAreadeConservation Guanacaste, forest ecotone), and E. mexicanum is a common dry-
northwesternCostaRica;thenumberofrearingrecordsforeach
plantspeciesisgiven(source.Janzen& Hallwachs2006). forest plant (used once byaP. polyctorthat apparently
strayedsome 15 km from rain forest).
Polyctorcleta Conversely foodplants do seem to distinguish the
Rubiaceae species of the species pairs in the hesperiine genera
Allenanthuserythrocarpus 9 Cobalus and Neoxeniades. In each pair, the rainforest
skipper feeds on more species than its dry-forest
Coutareahexandra 7
counterpart. Cobalus virbius eats two plant species in
Exostemacaribaeum 1 two genera, and C.fidicula eight plant species in five
Exostemamexicanum 124 genera, ofthe family Arecaceae (palms). Neoxeniades
Polyctorpolyctor luda eats three plant species in two genera, and N.
pluviasilva eight plant species in five genera, of the
Rubiaceae
family Bromeliaceae (bromeliads). The species in each
Allenanthuserythrocarpus 44
skipper pair share no foodplant species and just one
Coutareahexandra 166 genus. However, these considerable differences in diet
Exostemamexicanum 1 may have little taxonomic significance. Palms and
Cobalusvirbius bromeliads are far more diverse in rain forest than thev
are in dry forest, so that the rainforest skippers have a
Arecaceae
wider choice. Were either species ofa pair to invade
Acrocomiaaculeata 7 the other's ecosystem, it might well find its relatives
Bactrisguineensis 5 foodplants acceptable. This conjecture is somewhat
Cobalusfidicula weakened by the fact that the rainforest skippers,
though polyphagous, still restrict dieir diet to fewer
Arecaceae
species ofpalms and bromeliads than are available to
Astrocaryumalatum 25 them; and even one dry-forest species is somewhat
Bactrisgasipaes(introduced) 5 choosy. To illustrate, die ACG diy forestprovides onlv
Bactrisgracilior 6 twospeciesofpalms forC. virbius,bothofwhichiteats,
whereas the rain forest offers >10 species of palms
Bactrishondurensis 10
beyond the eight so far recorded for C.fidicula. The
Chamaedoreadammeriana 1
dry-forest skipper N. luda eats the diree terrestrial
Chamaedoreapinnatifrons 1 bromeliad species, butnot die epiphytic ones, available
Cryosophilawarscewiczii 1 to it, whereas N. pluviasilva eats bodi kinds of
bromeliads, but seems nevertheless to ignore man}' of
Prestoeadecurrens 1
the epiphytic species athand.
Neoxeniadesluda DNA barcodes (Figs. 42-46). For our barcoding
Bromeliaceae methods, see Hajibabaei et al. (2006:971). We
Aechmeabracteata 4 determined sequence divergences amongindhidualsin
Aechmeamagdalenae 30 each species pair (as well as in a related outgroup
species) by means of the Kimura-2-Parameter (K2P)
Bromeliapinguin 138
distance model (Kimura 1980), anddien showed diese
Neoxeniadespluviasilva divergences in neighbor-joining (NJ) trees (Saitou &
Bromeliaceae Nei 1987). A paper in preparation will deposit in
Aechmeapubescens 12 GenBank all of the sequences used here (along with
thousands more for hundreds of species in various
Ananascomosus(introduced) 3
lepidopteran families, including Hespeiiidae). All
Guzmaniadesautelsii 3
voucherspecimenshavebeendepositedindie National
Guzmaniadonnellsmithii 12 Museum ofNatural History, Smithsonian Institution.
Guzmanianicaraguensis 1 Sincewe could not discriminate between die species
Pitcairniaarcuata 1 in each pair during our earlv barcoding efforts, we
greatly increased sample sizes; but we still included
Pitcairniaatrorubens 4
some COI sequences that were too short to qualify as
Vrieseagladioliflora 19 legitimate barcodes. Two of the resulting NJ trees
144 Journalofthe Lepidopterists' Society'
Figs. 4-15. RearedadultsindorsalviewofPolyctor, Cobalus, andNeoxeniades from ACG, CostaRica(specimens in USNM).
Males even-numbered, femalesodd-numbered. Wingspanandvouchercodegivenforeachspecimen. 4, 5,P. cleta: 32 mm,02-
SRNP-32285;40mm,06-SRNP-869. 6, 7,P.polyctor:35mm,05-SRNP-42248;34mm,03-SRNP-9639. 8,9,C. virbius:32mm,
92-SRNP-6215.1; 32mm,92-SRNP-46. 10, 11,C.fidicula: 39mm,05-SRNP-23068; 36mm,04-SRNP-32408. 12, 13,N. luda:
49mm,01-SRNP-11651;53mm,03-SRNP-38341. 14, 15,N. phwiasilva: 43mm,06-SRNP-31674;52mm,05-SRNP-22927.
Volume 61, Number 3 145
Figs. 16-27. RearedadultsinventralviewofPolyctor,Cobalus,andNeoxeniad-esfromACG,CostaRica(specimensin USNM).
Males even-numbered, femalesodd-numbered. Same specimens in same sequence asin Figs. 4—15. 16, 17,P. cleta. 18, 19, P.
polyctor. 20,21,C. virbius. 22,23,C.fidicula. 24,25,N. lucla. 26,27,N. pluviasilva.
146 Journalofthe Lepidopterists' SociETi
Figs. 28,29.AsymmetricmalegenitaliainleftlateralviewoftwospeciesofPolyctorfromACG,CostaRica(USNM),scale 1.0
rai. 28,E cleta,genitaliadissectioncodeX-6165,vouchercode03-SRNP-30880. 29,P. polyctor,X-6159,02-SRNP-712S.
nearly separated the two species ofPolyctor (Fig. 42) barcodes match those of C. fidicula are not the two
andthoseofCobalus (Fig. 44). However, thethirdtree females ofC. virbius (notedabove,under"Morphologic
appreciablyintermixedthe two species ofNeoxeniades differences" [withvouchercodes 92-SRNP-340 and06-
(Fig. 45). The short sequences lacked diagnostic sites SRNP-13344]) whose hindwing facies approaches that
and therefore compromised die NJ analysis. ofC.fidicula females. Because, in each pairofskipper
Subsequent exclusion of short sequences resulted in species, dieinterspecificnucleotidedifferences arevery
clearspecies separation (Figs. 43, 46). few(comparedwith manyspecies ofskipperspreviously
Closeexaminationofthebarcode nucleotides showed examined), full-length, high-qualitybarcode sequences
drat the two species of Polyctor consistently differ at (-650 bp) are critical for distinguishing the species in
—
three nucleotide positions (610, 616, and 625), and dre eachpair. Ofcourse, charactersofthisland like many
—
two species ofNeoxeniades, atone (115). Similarly, die others mayvarygeographically.
two species of Cobalus differ in one nucleotide (at The levels atwhich these species are distinguished is
position 181), except fortwo females ofC. virbius (04- so low that, in many other circumstances, their
SRNP-21798 and 06-SRNP-22664) whose "diagnostic" differences could easily qualify as nothing more than
nucleotide is the same as that of the C. fidictda individual variation. It follows that the designation of
specimens. The two females of C. virbius whose some percentage or degree of divergence as a point
Volume 61, Number3 147
FlGS. 30,31.AsymmetricmalegenitaliainrightlateralviewoftwospeciesofPohjctorfromACG,CostaRica(USNM),scale ;
1.0mm. 30,P. cleta,X-6165,03-SRNP-30880. 31,P. pohjctor,X-6159,02-SRNP-712S.
32 33
FlGS. 32,33. Asymmetricmalegenitaliain dorsalviewoftwospecies ofPohjctorfromACG, CostaRica (USNM), scale = 1.0
mm. 32,P. cleta,X-6165, 03-SRNP-30880. 33,P. pohjctor,X-6159,02-SRNP-7128.