Table Of ContentPRIMARY RESEARCH PAPER | Philippine Journal of Systematic Biology
DOI 10.26757/pjsb2020c14002
DNA barcode of the Lanzones scale insect, Unaspis mabilis Lit
& Barbecho (Hemiptera: Diaspididae)
Vanessa Kate I. Alvarez1, Ireneo L. Lit, Jr.2,3,§, Cristian C. Lucañas2,3, Kristine O. Abenis2, Romnick A.
Latina1, and Barbara L. Caoili1,*
Abstract
The mitochondrial cytochrome c oxidase subunit 1 (COI) nucleotide sequences of Unaspis mabilis Lit & Barbecho
(Hemiptera: Diaspididae), are provided for the first time. The total genomic DNA of each scale insect was extracted from
individuals infesting lanzones leaves from three selected sites in Los Baños, Laguna. A partial COI gene amplicon with
approximately 750 bp was obtained using the primer pair PcoF1 and LepR1. Nucleotide sequence alignment showed no
variation among the COI sequences from all the samples. BLASTn search yielded no significant match with any of the
available sequences for Unaspis species. The closest hit was Aulacaspis tubercularis Newstead (GenBank Accession No.
HM474091) with 87.4% nucleotide similarity. Nonetheless, phylogenetic analyses revealed that generated COI sequences
from U. mabilis form a monophyletic clade with U. yanonensis and U. euonymi, with closer proximity to the former.
These findings also strengthen the species status of U. mabilis under the genus Unaspis. The DNA barcodes generated
from this study (GenBank Acc. Nos. MN114099, MN14101, and MN114102), could, therefore, be used to verify the
species identity of other lanzones scale accessions, as well as monitor the distribution and spread of U. mabilis, which
would greatly influence possible pest management options.
Keywords: cytochrome C oxidase I, COI, Lansium domesticum Correa, lanzones
Introduction such as diarrhea, fever, dysentery, and even malaria (Yapp and
Yap 2003). However, recent threats posed by insect pests
Lanzones, Lansium parasiticum (Osbeck) Sahni & Bennet gravely affected its local production.
(=Lansium domesticum Corrêa), is a well-known fruit sold in The recently described Unaspis mabilis Lit & Barbecho
the Philippine market. In 2013, the volume of production for (Hemiptera: Diaspididae) is a species of armored scale insect
lanzones reached approximately 35,000 MT (Philippine that infests on lanzones. Serious infestation was first observed in
Statistics Authority 2018). Aside from being a table fruit, it is 2004 in North Cotabato (Provido 2007). The same scale insect
also known to have medicinal value, which makes it a good was also found to attack lanzones in Davao (Provido 2007; DA-
choice of crop for massive production (Tilaar et al. 2008). SMIARC 2014), South Cotabato and Saranggani provinces
Lanzones is known as an alternative medicine to treat illnesses (Tacio 2008). In addition, an outbreak in Makilala, North
Cotabato was reported in 2009 (Lit & Barbecho 2014). The
1Institute of Weed Science, Entomology and Plant Pathology, College
infestation was reported to have spread to Negros Occidental
of Agriculture and Food Science, University of the Philippines Los
Baños, College, Laguna 4031 Philippines; 2Environmental Biology (pers. comm.), Batangas (Watson 2015), Laguna (Lit &
Division, Institute of Biological Sciences, College of Arts and Barbecho 2014; Watson 2015), and recently in Aklan (Lit 2015,
Sciences, University of the Philippines Los Baños, College, Laguna unpublished identification report).
4031 Philippines Owing to the minute nature of these scale insects, there
3Entomology Section, Museum of Natural History, University of the were several misidentifications, as summarized by Lit &
Philippines Los Baños, College, Laguna 4031 Philippines
Barbecho (2014) and Watson (2015). They were initially
misidentified in popular pest reports as Lepidosaphes ulmi
*Corresponding email: [email protected]
(Linnaeus), and later as Lepidosaphes beckii (Newman), as their
§ Co-corresponding email: [email protected]
scale cover superficially resembles those of mussel scales (e.g.
Mindanews 2007; Provido 2007; Cahatian & Pagal 2011). Later
Date Submitted: 13 August 2019
on, it was thought to represent Unaspis citri (Comstock) (e.g.
Date Accepted: 27 June 2020
© Association of Systematic Biologists of the Philippines Volume 14 Issue 3 - 2020 | 1
Alvarez et al.: DNA barcode of the Lanzones scale insect
BPI-NPQD 2014). There were also a few misconceptions in centrifugation at 15,000 x g for 20 min. The DNA pellet was
national news that “coconut scale insects Aspidiotus spp. allowed to air-dry and was resuspended in 20 µL DNA
spreads to lanzones” (Valencia 2014). However, a careful and hydration solution with 0.3 µL of RNAse. The tubes were
thorough morphological examination by Lit & Barbecho (2014) incubated at 37°C for 1 h and then incubated at 65°C for another
established that the mussel scale insect is a new species, hour. The samples were stored at -20°C until use.
Unaspis mabilis Lit & Barbecho.
Despite only being reported from the country, Lit & Amplification of COI gene
Barbecho (2014) hypothesized that it may be an invasive The COI gene was amplified using PcoF1 (5’-
species, based on its aggressive behavior and spread. With that, CCTTCAACTAATCATAAAAATATYAG-3’), and LepR1 (5’-
a more robust monitoring system should be implemented. The TAAACTTCTGGATGTCCAAAAAATCA -3’) primers
use of a DNA barcode for U. mabilis, would serve as a useful following the thermocycle conditions; 2 min at 95°C; 5 cycles of
tool to survey and monitor its spread as well as understand its 40 s at 94°C, 40 s at 45°C, 70 s at 72°C; 40 cycles of 40 s at 94°
biogeographical origins, which is essential in designing efficient C, 40 s at 51°C, 70 s at 72°C; 5 min at 72°C; held at 4°C (Park
management programs. et al. 2010) in 25 µL PCR reaction mixture containing 12.5 µL
The mitochondrial gene, cytochrome c oxidase I (COI), of 2X Taq Master mix (Vivantis, Malaysia), 10 pmol PcoF1, 10
serves as a standard DNA barcode for animals. This COI gene pmol LepR1, 4 mM MgCl , and 50 ng genomic DNA. The
2
has a simple genomic structure, is distinct, easy to isolate and amplicons were resolved in 1% agarose gel in 0.5x TBE buffer
has a rapid pace of evolutionary change (Avise et al. 1987), and stained with GelRed® (Biotium, Inc., Fremont, CA, USA).
is one of the most frequently sequenced mitochondrial DNA Molecular size of the PCR products were estimated using
genes (Caterino et al. 2000). Here, the partial sequences of the VC100 bp Plus DNA Ladder (Vivantis, Malaysia). The gels
mitochondrial COI gene that could be used as a DNA barcode were viewed and photographed using Alpha Imager Mini
of the lanzones scale insect, U. mabilis, is provided. (Protein Simple, San Jose, CA, USA) at 302 nm.
Materials and Methods COI nucleotide sequence analysis
Samples with corresponding expected molecular weight of
Insect samples amplicons were sent to Apical Scientific Sdn. Bhd. (Taman
Unaspis mabilis samples were collected from lanzones Serdang Perdana, 43300 Seri Kembangan, Selangor, Malaysia)
trees in three sites in Los Baños, Laguna: Mt. Makiling Station via Asia Gel Corp. (Villa Lourdes Townhomes, Congressional
9, Bagong Silang, and Mudspring. High rates of lanzones scale Avenue, Barangay Bahay Toro, Quezon City 1100) for Sanger
insect infestation were recorded in these areas. The specimens sequencing. The generated nucleotide sequences were edited in
were verified as U. mabilis by Dr. Ireneo L. Lit, Jr., the main BioEdit software (Hall 1999). Those with high quality
author of the species. nucleotide sequences were then subjected to BLASTn (https://
blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=Blast Search)
Total genomic DNA extraction for NCBI database mining. Phylogenetic analysis of the
The total genomic DNA of each lanzones scale insect was generated COI sequences was also performed using Mega X
extracted following the protocol of the Animal and Fungi (Kumar et al. 2018)
Genomic DNA Extraction Kit™ (Jena Bioscience, Germany)
with slight modifications. Briefly, fresh specimens were placed Results and Discussion
individually on the cap of a 1.5 mL microcentrifuge tube and
homogenized in 40 µL of cell lysis buffer with 0.3 µL The primer pair PcoF1 and LepR1, designed to address the
proteinase K solution. The homogenates were incubated at 55°C low recovery of COI barcodes for scale insects (Park et al.
for 2 h. After which, 30 µL of protein precipitation solution was 2010), successfully generated an approximately 750 bp COI
then added into each tube, mixed on a vortex mixer for 30 s and gene amplicon from Unaspis mabilis samples from the three
centrifuged at 15,000 x g for 10 min. The supernatant was then collection sites (Figure 1). The amplicons generated were of the
transferred into a new microcentrifuge tube with 80 µL of same expected molecular size as those reported by Park et al.
isopropanol, which was then mixed by inverting the tubes 50 (2010).
times. The genomic DNA was collected by centrifugation at High-quality COI nucleotide sequences of 649 bp in length
15,000 x g for 15 min to form the DNA pellet. After discarding were obtained from the insect samples from Barangay Bagong
the supernatant, 100 µl washing buffer was added followed by Silang (n=10), Mudspring Area (n=12), and Mt. Makiling
Philippine Journal of Systematic Biology Online ISSN: 2508-0342 Volume 14 Issue 3 - 2020 | 2
Alvarez et al.: DNA barcode of the Lanzones scale insect
relatively low nucleotide identity match with A. tubercularis is
due to 86 substitution sites observed within the COI gene region.
Surprisingly, an even lower percentage nucleotide identity
match (86.35%) was observed between the U. mabilis COI
nucleotide sequences and its congener, U. euonymi (Comstock)
(GenBank Acc. No. HM474405.1), with 91 substitution sites
observed (Figure 3). These results further proved the utility of
the generated COI sequences as DNA barcode for U. mabilis.
Despite a deep sequence genetic divergence (>2%) and
apparent BLAST mismatch, phylogenetic analysis of
Diaspididae COI nucleotide sequences revealed that the
Figure 1. Molecular size estimation of the amplicons of cytochrome c
generated U. mabilis DNA barcodes form a monophyletic clade
oxidase I (COI) gene region of Unaspis mabilis Lit & Barbecho from
with U. yanonensis (Kuwana) and U. euonymi indicative of its
three sites in Los Baños, Laguna (Lanes 1-12 in each panel). The PCR
products are resolved in 1% agarose gel ran in 0.5x TBE buffer and valid species status under Unaspis genus (Figure 4).
stained with GelRed® (Biotium, Inc., USA). VC 100 bp Plus DNA Interestingly, U. mabilis had a closer proximity to U. yanonensis
Ladder (Vivantis, Malaysia) was used as a molecular size standard than U. euonymi. Nevertheless, the degree of divergence and
(MW). uniqueness of U. mabilis COI barcode from the rest of the
sequences examined proved its utility as a marker for this
Station 9 (n=10). Alignment of the nucleotide sequences species. In a DNA barcoding study using the same COI locus
showed a 100% identity among all the samples without any stop done by Park et al. (2011b), high genetic differences were also
codon within the deduced amino acid sequence (Figure 2) and observed among scale insects belonging to Pseudococcidae and
thus, represents an uninterrupted open reading frame. This Diaspididae. It was reported that genetic divergences within
result confirmed the integrity of the COI nucleotide sequences species (n=57 taxa) and in congeneric species (n=30 taxa)
generated, and hence, could serve as an ideal DNA barcode for ranged from 0-5.98% with a mean of 0.97%, and 1.93-23.29%
U. mabilis. with a mean of 10.09%, respectively. Almost similar degree of
Comparison of the U. mabilis COI nucleotide sequence divergence ranges within and in congeneric species was also
with other COI sequences in GenBank revealed an 87.40% observed in 1,090 Heteroptera COI barcodes (Park et al. 2011a).
identity match with another armored scale, Aulacaspis The nucleotide sequence identity matrix of U. mabilis, U.
tubercularis Newstead (GenBank Acc. No. HM474091.1). The euonymi, and A. tubercularis showing the divergence among the
Figure 2. Nucleotide sequence alignment and the deduced amino acid sequence of cytochrome c oxidase I
gene of Unaspis mabilis Lit & Barbecho infesting lanzones Lansium parasiticum collected in Bagong Silang
(MN114099), Mud Spring (MN114101) and Mt. Makiling Station 9 (MN114102), Los Baños, Laguna.
© Association of Systematic Biologists of the Philippines Volume 14 Issue 3 - 2020 | 3
Alvarez et al.: DNA barcode of the Lanzones scale insect
Figure 3. Multiple nucleotide sequence alignment of cytochrome c oxidase I gene consensus
sequence of Unaspis mabilis Lit & Barbecho infesting lanzones, Lansium parasiticum, Aulascaspis
tubercularis (HM474091.1) and U. euonymi (HM474405.1).
species is summarized in Table 1. U. mabilis samples are Aulacaspis belongs) and the Unaspis group, within the tribe
significantly different from U. euonymi and A. tubercularis with Diaspidini (Normark et al. 2019).
genetic distances of 14.4% and 13.3%, respectively. These With the very minute size of U. mabilis, the availability of
sequence variation values are highly significant since a a DNA barcode will speed up studies on its distribution across
minimum of 2.0% divergence in the COI nucleotide sequence is geographical locations. This DNA barcode, which is the first
enough for species delineation (Hebert et al. 2003). report for U. mabilis, could also be used as a tool to monitor and
By itself, the closeness of U. mabilis with U. euonymi is trace the spread of this insect as well as identify other potential
attributable to their being congeners but the significant host plants. The identical COI sequences obtained from the three
difference confirms the distinctness of U. mabilis as a species, populations suggest the presence of only one haplotype, an
as first established by Lit & Barbecho (2014) based on indication that the establishment is recent. Comparison of the
morphological characters. In fact, it is the first Unaspis species DNA barcode from U. mabilis from other locations could,
to be reported on a host plant in the Meliaceae. The closest therefore, provide potential data for understanding its origins.
match, albeit 87% only, with A. tubercularis, can be attributed Such information is essential in designing pest management
to the closeness of the subtribe Chionaspidina (where strategies against this pest.
Table 1. Nucleotide sequence identity matrix of Unaspis mabilis Lit & Barbecho infesting lanzones, Lansium parasiticum collected in
Bagong Silang (MN114099), Mud Spring (MN114101) and Mt. Makiling Station 9 (MN114102), Los Baños, Laguna.
U. mabilis U. mabilis U. mabilis A. tubercularis U. euonymi
COI Sequences
MN114099 MN114101 MN114102 HM74091.1 HM74405.1
U. mabilis MN114099 1 1 0.867 0.856
U. mabilis MN114101 1 1 0.867 0.856
U. mabilis MN114102 1 1 0.867 0.856
A. tubercularis HM74091.1 0.867 0.867 0.867 0.855
U. euonymi HM74405.1 0.856 0.856 0.856 0.855
Philippine Journal of Systematic Biology Online ISSN: 2508-0342 Volume 14 Issue 3 - 2020 | 4
Alvarez et al.: DNA barcode of the Lanzones scale insect
Figure 4. Phylogenetic relationship of Unaspis mabilis (n=3) and selected Diaspididae species (n=27) based on partial
nucleotide sequences of cytochrome C oxidase I sequences analyzed by neighbor-joining using K2P distance model and 1000
bootstraps, with Pseudococcidae species namely, Pseudococcus jackbeardsleyi (KY373149.1) and Planococcus citri
(EU250560.1) as outgroups.
Conclusion and Recommendation Acknowledgement
A 649 bp long COI gene sequence was generated as a We thank the Department of Science and Technology –
DNA barcode for U. mabilis. This important molecular Philippine Council for Agriculture, Aquatic and Natural
information can facilitate studies on the distribution of this Resources Research and Development for funding the projects
species across geographical locations, particularly where (1) Development of Molecular Diagnostic Tools for Armored
lanzones are grown. It could also provide potential data for Scale Insects (Hemiptera: Diaspididae) and their Natural
understanding its biogeographical origins, especially since there Enemies on Coconut and Associated Crops (Phases 1 and 2)
is doubt as to the species current endemic status in the and (2) Morphology-Based Diagnostics of Armored Scale
Philippines and the hypothesis that it might be an invasive alien Insects (Hemiptera: Diapididae) and Their Natural Enemies on
species. In turn, such understanding can have potentially great Coconuts and Associated Crops (Phases 1 and 2), under which
impacts on possible pest management options. Future detection the scale insects on lanzones trees within coconut plantations
on other potential host plants can also be hastened using this were initially collected and studied. The fresh materials used for
molecular barcode. generating the DNA barcode were collected under a permit
granted by the Makiling Center for Mountain Ecosystems,
© Association of Systematic Biologists of the Philippines Volume 14 Issue 3 - 2020 | 5
Alvarez et al.: DNA barcode of the Lanzones scale insect
College of Forestry and Natural Resources, University of the urged against using pesticides. MindaNews August 24, 2007
Philippines Los Baños. https://www.mindanews.com/business/agriculture/2007/08/
insects-destroy-lanzones-trees-but-growers-urged-against-
Literature Cited using-pesticides/
Normark, B.B., A. Okusu, G.E. Morse, D.A. Peterson, T. Itioka
Avise, J.C., J. Arnold, R.M. Ball, E. Bermingham, T. Lamb, & S.A. Schneider, 2019. Phylogeny and classification of
J.E. Neigel, C.A. Reeb, & N.C. Saunders, 1987. armored scale insects (Hemiptera: Coccomorpha:
Intraspecific phylogeography: the mitochondrial DNA Diaspididae). Zootaxa, 4616 (1): 1-98. https://
bridge between population genetics and systematics. doi.org/10.11646/zootaxa.4616.1.1
Annual Review of Ecology, Evolution and Systematics, 18: Park, D.S., R. Foottit, E. Maw & P.D. Hebert, 2011a. Barcoding
489-522. doi.org/10.1146/annurev.es.18.110187.002421. bugs: DNA-based identification of the true bugs (Insecta:
Bureau of Plant Industry – National Plant Quarantine Division Hemiptera: Heteroptera). PLoS ONE, 6(4). doi: 10.1371/
(BPI-NPQD). 2014. Declaring severe infestation of journal.pone.0018749.
Aspidiotus spp. and Unaspis sp. in mangosteen (Garcinia Park, D.S., S.J. Suh, P.D. Hebert, H.W. Oh & J.J. Hong, 2011b.
mangostana) and lanzones (Lansium domesticum), DNA barcodes for two scale insect families, mealybugs
respectively, including other scale insects affecting other (Hemiptera: Pseudococcidae) and armored scales
plants. BPI Special Quarantine Order no. 1, series of 2014. (Hemiptera: Diaspididae). Bulletin of Entomological
https://pqs.bpinsicpvpo.com.ph/domestic.php. Research, 101(4): 429-434. doi:10.1017/
Cahatian, P.O. & Y.G. Pagal, 2011. Biological studies of two S0007485310000714.
species of predatory ladybird beetles of the lanzones mussel Park, D.S., S.J. Suh, H.W. Oh & P. Hebert, 2010. Recovery of
scale insect (Lepidosaphes ulmi Linnaeus). [Abstract] USM the mitochondrial COI barcode region in diverse Hexapoda
(University of Southern Mindanao) R&D Journal https:// through tRNA-based primers. BMC Genomics, 11(1): 423.
scinapse.io/papers/1640020967 doi:10.1186/1471-2164-11-423.
Caterino, M.S., S. Cho & F.A. Sperling, 2000. The current state Philippine Statistics Authority, 2018. Crops Statistics of the
of insect molecular systematics: a thriving Tower of Babel. Philippines 2013–2017. Quezon City. Retrieved from
Annual Review of Entomology, 45: 1-54. doi.org/10.1146/ https://psa.gov.ph/sites/default/files/Crops%20Statistics%
annurev.ento.45.1.1. 20of%20the%20Philippines%202013-2017.pdf
Department of Agriculture Region XI – Southern Mindanao Provido, N.T., 2007. How to control lanzones pest. Philippine
Integrated Agricultural Research Center [DA-SMIARC]. Headline News Online, 26 September, 2007. Retrieved 01
Bio control of scale insects in lanzones. SMIARC April 2019 from http://www.newsflash.org/2004/02/si/
Technoguide. [Brochure]. DA SMIARC Knowledge si002421.htm.
Management-Farmer Info & Technology Services Center, Qin, Y.-G., Q-S Zhou, F. Yu, X.-B. Wang, J.-F. Wei, C.-D.
Davao City. Zhu, Y.-Z. Zhang & A.P. Vogler, 2018 Host specificity of
Hall, T.A., 1999. BioEdit: a user-friendly biological sequence parasitoids (Encyrtidae) toward armored scale insects
alignment editor and analysis program for Windows 95/98/ (Diaspididae): Untangling the effect of cryptic species on
NT. Nucleic Acids Symposium Series, 41: 95-98. quantitative food webs. Ecology and Evolution, 2018: 8:
Hebert, P.D., A. Cywinska, S.L. Ball & J.R. Dewaard, 2013. 7879-7893. DOI: 10.1002/ece3.4344
Biological identifications through DNA Tacio, H.D., 2008. Meet the luscious lanzones. Random
barcodes. Proceedings of the Royal Society of thoughts. Retrieved 01 April 2019 from http://
London, B Biological Science, 270 (1512): 313-321. henrytacio.blogspot.com/2008/09/meet-luscious-
Kumar, S., G. Stecher, M. Li, C. Knyaz & K. Tamura, 2018. lanzones.html.
MEGA X: Molecular Evolutionary Genetics Analysis Tilaar, M, W.L. Wih, A.S. Ranti, S.M. Wasitaatmadja,
across computing platforms. Molecular Biology and Suryaningsih, F.D. Junardy & Maily, 2008. Review of
Evolution, 35: 1547-1549. Lansium domesticum Corrêa and its use in cosmetics.
Lit, I.L. Jr. & N.M. Barbecho, 2014. A new species of armored Boletin Latinoamericano y del Caribe de Plantas
scale insect (Hemiptera: Diaspididae) on Lansium Medicinales y Aromáticas, 7(4): 183-189. Retrieved 22
domesticum trees in the Philippines. Arthropoda Generalis, May 2019 from https://www.redalyc.org/
4: 1-7. html/856/85670401/.
MindaNews, 2007. Insects destroy lanzones trees but growers
Philippine Journal of Systematic Biology Online ISSN: 2508-0342 Volume 14 Issue 3 - 2020 | 6
Alvarez et al.: DNA barcode of the Lanzones scale insect
Valencia, C. 2014. Cocolisap spreads to lanzones, mangosteen.
ABS-CBN News, 09 July, 2014. Retrieved 13 April 2019
from https://news.abs-cbn.com/nation/regions/07/08/14/
cocolisap-spreads-lanzones-mangosteen.
Watson, G.W., 2015. Unaspis lansivora sp.n. (Hemiptera:
Diaspididae), a new pest of Lansium domesticum
(Meliaceae), and a key to Unaspis species. Zootaxa, 3905
(3): 432-440. doi.org/10.11646/zootaxa.3905.3.9.
Yapp, D.T. & S.Y. Yap, 2003. Lansium domesticum: skin and
leaf extracts of this fruit tree interrupt the lifecycle of
Plasmodium falciparum and are active towards a
chloroquine-resistant strain of the parasite (T9) in vitro.
Journal of Ethnopharmacology, 85(1): 145-150.
doi.org/10.1016/S0378-8741(02)00375-6.
© Association of Systematic Biologists of the Philippines Volume 14 Issue 3 - 2020 | 7
