Table Of Content1
Differential Display
A General Protocol
Peng Liang and Arthur B. Pardee
1. Introduction
One of the greatest unsolved mysteries of life 1sh ow the hundreds of thou-
sands of genes embedded in the genome of an organism are selectively
expressed mto the mRNA and protems m a temporally and spatially regulated
manner that gives rise to different tissues and organs. The abnormality m this
intricate regulatory cn-cuitry IS beheved to be one of the underlmmg causes of
a variety of pathological alterations or disease states.T he rsolation and charac-
terization of differentially expressed genes becomes one of the first steps
toward the understanding of these important biological questions. Differential
display (1) and a related RAP-PCR method (2) were developed to more effi-
ciently Identify and isolate these genes.
The general strategy for differential display (Fig. 1) IS based on a combma-
tton of three techniques brought together by a concept:
1 Reverse transcrlptlon of mRNA from anchored primers (see Note l),
2 Choice of arbitrary primers for setting lengths of cDNAs to be amplified by the
polymerase chain reaction (PCR), each corresponding to part of a mRNA (tags),
3 Sequencmg gels for high resolution of amplified cDNA
The objective IS to obtain a tag of a few hundred bases, which 1ss ufficiently
long to uniquely identify a mRNA and yet short enough to be separated from
others by size. Given the fact that primers of nearly any length, with or without
anchors, can generate cDNA fingerprints sufticrently reproducible to allow
differentially expressed genes to be identified, it may be hard to define what
should be a standard protocol for differential display. The followmg protocol
using one-base anchored primer m combmatron with arbitrary 13-mers (3) IS
given as an example to illustrate the methodology.
From Methods m Molecular Bology, Vol 8.5 D/fferenf/a/ Dsplay Methods and Protocols
Edlted by P Llang and A B Pardee Humana Press Inc , Totowa, NJ
3
Liang and Pardee
L Reverse banswiption 5’.AAGC3’ (H-TUG)
dNTPs
MMLV reverse tfanscnptase
.
WAA-A~
4 GVGAA
I 5’-AAGCTTGAITGCC-3’ (H-AP-1 Ptimer)
JI. PcRamplificatloll 5’44GC3 (H-TIIG)
dNTPs
a-(‘“S-dATP]
Ampli’lhq DNA poiymelase
AAGCTTGATECC .
GWGAA
A4GCiTGA’lTGCC .
G-GU
IIL Denaturing polyacrylamide gel
Fig. 1. Schemattc representation of one-base anchored differentral display
2. Materials
1. 5X RT buffer: 125 mA4TrwC1, pH 8 3,188 mMKCl,7.5 mMMgC12, and 25 ti
dithrothretol.
2 MMLV reverse transcrrptase (100 cl/@,)
3. dNTP (250 @I)
4. 5’-AAGCTTTTTTTTTTTG-3’ (2 /.&I).
5. 5’-AAGCTTTTTTTTTTTA-3’ (2 pA4)
6 5’-AAGCTTTTTTTTTTTC-3’ (2 /&I).
7 Arbitrary 13-mers (2 pM)
8. 10X PCR buffer.
Differential Display 5
9 dNTP (25 pJ4).
10. Glycogen (10 mg/mL).
Il. Distilled water (dH,O).
12. DEPC-treated H,O
13. Loading dye
14. AmphTaq DNA polymerase, Perkin-Elmer Corporation (Norwalk, CT).
15 a-[33P]dATP (>2000 Wrnmole) or a-[35S]dATP (>l,OOO Ci/mmole) (see Note 2).
16. RNase-free DNase I (10 U/pL).
17 QIAEXrM DNA extraction kit (Qiagen, Chatsworth, CA).
18. pCR-TRAPTM clonmg system (GenHunter Corporation, Nashville, TN).
19. Thermocycler
20. 6% denaturmg polyacrylamide gel.
2 1. DNA sequencing apparatus.
Although individual components may be purchased separately from varrous
suppliers, most of them can be obtained in kit forms from GenHunter Corporation.
3. Methods
3.1. DNase I Treatment of Total RNA
Purification polyadenylated RNAs is neither necessary nor helpful for dif-
ferential display. The major pitfalls of using the polyadenylated mRNAs are
the frequent contammation of the oligo-dT primers, that give high background
smearing in the display and the difficulty m assessing the integrity of the
mRNAs templates (4). Total cellular RNAs can be easily purified with one-step
acid-phenol extraction method (5). However, no matter what methods are used
for the total RNA purification, a trace amount of chromosomal DNA contami-
nation m the RNA sample could be amplified along with mRNAs thereby com-
phcating the pattern of displayed bands. Therefore removal of all contaminating
chromosomal DNA from RNA samples is essential before carrying out differ-
ential display.
1. Incubate 10-100 pg of total cellular RNA with 10 U of DNase I (RNase free) in
10 mMTris-Cl, pH 8.3, 50 mMKC1, 1.5 mMMgC& for 30 mm at 37°C.
2 Inactivate DNase I by adding an equal volume of phenolchloroform (3: 1) to the
sample
3. Mix by vortexing and leave the sample on ice for 10 mm.
4 Centrifuge the sample for 5 min at 4’C m an Eppendorf centrifuge.
5. Save the supernatant, and ethanol precipitate the RNA by adding 3 vol of ethanol
in the presence of 0.3MNaOAC, and incubate at -80°C for 30 mm.
6. Pellet the RNA by centrifuging at 4°C for 10 min.
7. Rinse the RNA pellet with 0.5 mL of 70% ethanol (made with DEPC-H20) and
redissolve the RNA in 20 pL of DEPC-treated HzO.
8. Measure the RNA concentration at ODS6s with a spectrophotometer by diluting
1 pL of the RNA sample in 1 mL of HzO.
6 Llang and Pardee
9 Check the integrity of the RNA samples before and after cleanmg wtth DNase I
by runnmg 1-3 ~18o f each RNA on a 7% formaldehyde agarose gel
10 Store the RNA sample at a concentratton htgher then 1 pg/$ at -80°C before
using for differential dtsplay
3.2. Reverse Transcription of mRNA
1 Set up three reverse transcription reactions for each RNA sample in three
microfuge tubes (0 5-mL), each contammg one of the three dtfferent anchored
ohgo-dT prrmers as follows. For 20 pL final volume 9 4 p.L of dH,O, 4 pI. of 5X
RT buffer, 1.6 pL of dNTP (250 I.&‘), 2 pL of DNA-free total RNA (freshly
diluted to 0 1 pg/pL wtth DEPC-treated H,O), and 2 pL of AAGCT, ,M (2 $4)
(M can be either G, A, or C)
2 Program your thermocycler to* 65°C for 5 mm, 37°C for 60 min, 75’C for 5 mm,
4°C (see Note 3)
3 1 pL MMLV reverse transcrlptase 1s added to each tube 10 mm after at 37°C and
mix well quickly by finger tipping
4. Continue mcubation and at the end of the reverse transcription reaction, spm the
tube briefly to collect condensation Set tubes on ice for PCR or store at -80°C
for later use.
3.3. PCR Amplification
1 Set up PCR reacttons at room temperature as follow* 20 p.L final volume for each
primer set combmation 10 pL of dH,O, 2 $ of 10X PCR buffer, 1.6 l.iL of dNTP
(25 pA4), 2 pL of arbitrary 13-mer (2 CUM), 2 pL of AAGCT, ,M (2 CIM), 2 pL of
RT-mix from step 3 2 , 0 2 pL of a-[33P]-dATP (see Note 2), 0 2 p.L of AmpliTaq.
Mix well by pipetmg up and down (see Note 4)
2. Add 25 pI.. mineral oil if needed
3 PCR as follows 94°C for 30 s, 40°C for 2 mm, 72°C for 30 s for 40 cycles, 72°C for
5 mm, 4“C (For Perkm-Elmer’s 9600 thermocycler it is recommend that the denatur-
anon temperature be shortened to 15 s and the rest of parameters kept the same )
3.4. 6% Denaturing Polyacrylamide Gel Electrophoresis
1 Prepare a 6% denaturmg polyacrylamide gel m TBE buffer
2 Let it polymertze at least for more than 2 h before usmg
3 Prerun the gel for 30 mm
4 Mix 3.5 pL of each sample with 2 p.L of loading dye and incubate at 80°C for
2 mm immediately before loading onto a 6% DNA sequencmg gel (see Note 5)
5 Electrophorese for about 3 5 h at 60 W constant power (with voltage not to exceed
1700 V) until the xylene dye (the slower movmg dye) reaches the bottom Turn
off the power supply and blot the gel onto a piece of 3M Paper Cover the gel
with a plastic wrap and dry tt at 80°C for 1 h Do not fix the gel with methanol/
acetic acid (see Note 6)
6. Orient the autoradiogram and dried gel wtth radioacttve mk or needle punches
before exposing to a X-ray film. Figure 2 shows a representative differential dts-
Differential Display 7
H-T110 H-T110 H-TIIA H-WA H-TIIA H-TIIC H-TllC
H-AP3 H-APB H-API H-AP3 H-AP3 H-APl H-AP3
Fig. 2. Differential display using one-base anchored oligo-dT primers (7). Four RNA
samples from non-transformed cell line Rat 1 and H-ras transformed cell lines rat 1 (ras),
T101-4 and Al-5 (lanes from left to right, respectively) were compared by differential
display using three one-base anchored oligo-dT primers, AAGCT, ,G, AAGCT, ,A and
AAGCT, ,C in combinations with three arbitrary 13-mers, H-API (AAGCTTGATTGCC),
HAP2 (AAGCTTCGACTGT) and HAP3 (AAGC’l’l’l’GGTCAG). The mob-l (ZO)
and mob-7 cDNA fragments were marked by the right and let? arrowheads, respectively.
play obtained with three one-base anchored oligo-dT primers in combinations
with three arbitrary 13-mers (3).
3.5. Reamplification of cDNA Probe
1. After developing the film (overnight to 72-h exposure), orient the autoradiogram
with the gel.
2. Locate bands of interest (see Note 7) either by marking with a clean pencil from
underneath the film or punching through the film with a needle at the four corners
Liang and Pardee
of each band of interest (Handle the dried gel with gloves and save it between
two sheets of clean paper)
3. Cut out the located band with a clean razor blade
4. Soak the gel slice along with the 3M paper in 100 pL dH,O for 10 mm.
5 Boil the tube with tightly closed cap (e.g., with parefilm) for 15 min.
6. Spm for 2 mm to collect condensatron and pellet the gel and paper debris Trans-
fer the supernatant to a new micromge tube.
7. Add 10 pL of 3MNaOAC, 5 pL of glycogen (10 mg/mL) and 450 p.L of 100%
EtOH.
8 Let sit for 30 mm on dry ice or in a -8O’C freezer Spm for 10 mm at 4°C to
pellet DNA.
9. Remove supernatant and rinse the pellet with 200 pL we-cold 85% EtOH (you
will lose your DNA if less concentrated EtOH is used!).
10. Spm briefly and remove the resrdual ethanol.
11. Dissolve the pellet m 10 pL of PCR H,O and use 4 pL for reamplificatron.
12 Save the rest at -20°C in case of mishaps.
13. Reamplification should be done using the same primer set and PCR conditions
except the dNTP concentrations are at 20 piV (use 250 @4 dNTP stock) instead
of 2-4 pA4 and no rsotopes added. A 40-pL reaction is recommended for each
reactron: 20.4 of pL dH,O, 4 pL of 10X PCR buffer, 3.2 pL of dNTP (250 @4),
4 & of arbitrary 13-mer (2 @?), 4 $ AAGCT, ,M (2 @4) (M can be either G, C,
or A), 4 pL of cDNA template from step 3.2. and 0.4 pL of AmphTaq (5 U/pL).
14. Run 30 pL of the PCR sample on a 1.5% agarose gel stained with ethidmm bro-
mide (More than 90% probes should be visible on the agarose gel ) Save the
remaining PCR samples at -2O’C for subclomng.
15 Check to see rf the size of your reamplified PCR products are consistent with
their size on the denaturing polyacrylamide gel.
3.6. Confirmation of Differential Gene Expression
1. Extract the reamplified cDNA probe from the agarose gel using QIAEX kit.
2. Use the extracted cDNA as a probe for Northern blot confirmation following the
standard protocol (ref. 5; see Note 8; Fig. 3)
3. Clone the cDNA probe using the pCR-TR4PTM cloning system (see Note 9).
4. Confirmation of differentially expressed cDNA probes can be also carried out
more efficiently by “Reverse Northern” dot blot or differential screening of
cloned cDNA probes by colony hybrtdization (ref. 6; Chapter 8 by H Zhang et
al. m this book).
5. Clone the full-length cDNA by screening a cDNA library followmg the standard
procedure (5).
4. Notes
1. The initial choice of usmg two-base anchored ohgo-dT primers (1) instead of
one-base anchored primers (3) were owing to a historical rather than scienttfic
reason. The cloned marine thymidine kmase (TK) cDNA originally used as a
Differential Display 9
A Mob-l
H-AP2
+
AAgc~~CTGTACAAAGG~~C~~T~A~~AC~~~~~
ATATGTAAGAACGTATGTATCAATGGGTAGITAAAGTlTACATAGG
CAAATGClTl-GAATGCTACATAlTACAAGATGTGlTGGATGGlllTCAMATAMAT
GTACTGTATTGAATGTAGTATGAGACCAAAAAA GTAATAAAGTAATAATAACTGAC
ATGAAAAAAAAAAAGC-IT
4
H-T1 I C
B Mob-7
H-AP2
*
AAgcttcGAcTGTAcAAA~GcGGAAcTccfGAATGTATTTT
ATAT~AAGAAClTGTGTGGTAAGTATGTATGTAfCAATGGGTAGlTAAA~ACATAGG
CAAATGCllTGAATGCTACATATTACAAGATGElTGGATGGlllTCAAAATAAAAT
GTACCCAAAAAAGTAATAAAGTAATAATAACTGAC
ATGAAATGCAAAAAAAAAAAGCTT
4
H-T1 I G
C 1234
Mob-7
rRNA
Fig. 3. Nucleotide sequences of mob-l (A) and mob-7 (B) cDNA fragments cloned
by differential display. The flanking primers are marked by arrow bars and the
polyadenylation site is underlined. Mob-7 differs from mob-l only by 6 base addition
at the 3’ end of the cDNA (see Note 10). Northern blot analysis with mob-7 cDNA probe
(C). The 253 bp mob-7 cDNA was used as a probe to confirm the differential expres-
sion of the gene using 20 pg of total RNA from Rat 1 and three transformed deriva-
tives Rat 1 @as), T101-4 and Al-5 cells (lanes 1 to 4, respectively). The lower panel is
ethidium bromide staining of ribosomal RNAs as a control for equal sample loading.
10 Lang and Pardee
control cDNA template had only 11 As m its poly(A) tall It was found that one-
base anchored prrmer Tl 1C fatled to amplify the TK 3’ termmus m combmatton
wtth an upstream primer specific to TK. Extension of one more base from the 3’
end instead of the 5’ end of the anchored primer was a logical. Interestingly,
Tl 1CA started to work successfully m PCR to amplify the expected TK cDNA
template (1) Later, longer one-base anchored primers that had mismatches at the
5’ ends of the prtmers were shown to be much more efficient for differential
display m subdividing the mRNA populations mto three groups (3) One-base
anchored primers have significant advantage over the two-base anchored primers
m that the former cuts down the redundancy of priming, elimmates the high back-
ground smearing problem for two-base anchored pnmers ending with the 3’ “T” and
reduce the number of reverse transcription reactions from 12 to 3 per RNA sample.
2 It has been observed that 35S labeled nucleottde origmally used for differential
display would leak through PCR reaction tubes (espectally when thin-walled
tubes are used) and 33P labeled nucleotide was recommended as the best alterna-
tive (9). 33P is not only safer to use but also gives better sensmvtty compared to 35S.
3. For the reverse transcrtption reaction, the mmal 65°C incubation is intended to
denature the RNA secondary structure. The final incubation at 75°C for 5 minis
to inactivate the reverse transcrlptase without denaturing the cDNA/mRNA
duplexes Therefore “hot start “PCR is neither necessary, nor helpful for the sub-
sequent PCR reactions using cDNAs as templates
4 Make core mixes as much as possible to avoid ptpetmg errors (e g , aliquot
RT-mix and AP-primer mdrvidually) Otherwise it would be difficult to pipet
0.2 pL of AmpliTaq. Mix well by pipetmg up and down
5 It is crucial that the urea in the wells be completely flushed right before loading
your samples For best resolution, flush every 4-6 wells each time during sample
loading while trying not to disturb the samples that have been already loaded.
6 DNA is acid labile, especially at high temperature when the gel is dried. This will
affect the subsequent PCR during the reamplificatton of the cDNA fragments to
be analyzed further
7. First tentatively identify those bands that appear to be differentially expressed on
the initial display gel. Then repeat the RT step and the PCR reactions for these
lanes and see if these differences are reproducible before pursumg further It 1s
recommended that bands bigger than 100 bp be selected. It has been generally
observed that shorter cDNA probes have higher probability of failing to detect
any signals on the Northern blot.
8. It IS recommended that the standard prehybrrdrzatron and hybridrzation condttton
at 42°C be used. Wash with 1X SSC, 0.1% SDS at room temperature for 15 min
twice followed by washing with 0.25X SSC, 0 1% SDS at 55-6O”C for 15-30 mm.
Do not go over 60°C Expose with intensifying screen at -80°C for overnight
to 1 wk.
9. pCR-TRAP cloning system is by far the most efficient cloning method for PCR
products that we have tested The pCR-TRAP clonmg system utilizes the third
generation cloning vector that features postttve-selection for DNA mserts Only
Different/al Display II
the recombinant plasmtds confer the antibiotic resistance The prmclple of thts
unique clonmg system 1sb ased on that the phage Lambda repressor gene c1 cloned
on the pCR-TRAP vector codes for a repressor protein. The repressor protein
binds to the Lambda right operators Or1 to Or3 of the cro gene, thereby turning
off the promoter that drives the TetR gene on the plasmtd Therefore, cloning of
the PCR products dtrectly, without any post-PCR purification, into the c1 gene
leads to the inactivation of the repressor gene, thus turnmg on the TetR gene The
cloned PCR insert can then be readily sequenced or retrieved as a probe by PCR
using primers flanking the cloning site of the vector.
10. It 1s known that the poly(A) tail of a rnRNA is not always added at a fixed posi-
tion downstream of the AATAAA polyadenylatton signal This 1s why both
mob-l and mob-7 correspondmg to the same mRNA were detected by the same
arbitrary primer m combmatton with different anchored primers
Acknowledgment
We thank GenHunter Corporation for the permtsslon of adapting its proto-
cols for Message CleanTM kit and RNAlmage TMk it for differential display. The
work was supported m part by a Natlonal Institute of Health grant CA61232
awarded to Arthur B. Pardee and Peng Llang.
References
1 Liang, P. and Pardee, A B. (1992) Dtfferentlal display of eukaryotic messenger
RNA by means of the polymerase cham reaction. Science 257, 967-97 1.
2 Welsh, J , Chada, K , Dalal, S S , Cheng, R , Ralph, D., and McClelland, M
(1992) Arbitrarily primed PCR fingerprmtmg of RNA Nuclezc Aczds Res 20,
4965-4970
3 Liang, P. Zhu, W , Zhang, X., Guo, Z , O’Connell, R P., Averboukh, L , Wang,
F , and Pardee A B (1994) Differenttal display usmg one-base anchored ohgo dT
primers. Nucleic Acids Res 22, 5763,5764.
4 Ltang, P. Averboukh, L., and Pardee, A B (1993) Dtstrlbutton and cloning of
eukaryottc mRNAs by means of differential display* refinements and optimiza-
tion Nuclezc Acids Res 21, 3269-3275.
5 Ausubel, F , Brent, R , Kingston, R. E , Moore, D. D., Seidman, J. G , Smith, J
A, and Struhl, K (1988) Current Protocols In Molecular Biology, Greene and
Wiley-Interscience, New York
6. Zhang, H , Zhang, R., and Ltang, P. (1996) Differential screening of gene expres-
sion difference enriched by differential display. Nuclezc Acids Res 24,2454-2456.
7 Trentmann, S M , Knaap, E., Kende, H., Ltang, P., and Pardee A. B (1995)
Alternatives to 35S as a label for the differential display of eukaryottc messenger
RNA. Sczence 267,1186,1187