Determination of ribonuclease sequence-specificity using Pentaprobes and mass spectrometry

13 Pages·2012·1.29 MB·English

Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press
METHOD
Determination of ribonuclease sequence-specificity using
Pentaprobes and mass spectrometry
JOANNA L. MCKENZIE,1 JOHANNA M. DUYVESTYN,1 TONY SMITH,2 KATERINA BENDAK,3
JOEL MACKAY,3 RAY CURSONS,1 GREGORY M. COOK,4 and VICKERY L. ARCUS1,5
1DepartmentofBiologicalSciences,2DepartmentofComputerScience,UniversityofWaikato,Hamilton3240,NewZealand
3SchoolofMolecularandMicrobialBiosciences,UniversityofSydney,NSW2006,Australia
4DepartmentofMicrobiologyandImmunology,OtagoSchoolofMedicalSciences,UniversityofOtago,Dunedin9054,NewZealand
ABSTRACT
The VapBC toxin-antitoxin (TA) family is the largest of nine identified TA families. The toxin, VapC, is a metal-dependent
ribonuclease that is inhibited by its cognate antitoxin, VapB. Although the VapBCs are the largest TA family, little is known
about their biological roles. Here we describe a new general method for the overexpression and purification of toxic VapC
proteinsandsubsequentdeterminationoftheirRNasesequence-specificity.FunctionalVapCwasisolatedbyexpressionofthe
nontoxic VapBC complex, followed by removal of the labile antitoxin (VapB) using limited trypsin digestion. We have then
developedasensitiveandrobustmethodfordeterminingVapCribonucleasesequence-specificity.Thistechniqueemploysthe
useofPentaprobesassubstratesforVapC.TheseareRNAsequencesencodingeverycombinationoffivebases.Wecombinethe
RNase reaction with MALDI-TOF MS to detect and analyze the cleavage products and thus determine the RNA cut sites.
Successful MALDI-TOF MS analysis of RNA fragments is acutely dependent on sample preparation methods. The sequence-
specificity of four VapC proteins from two different organisms (VapC and VapC from Pyrobaculum aerophilum,
PAE0151 PAE2754
and VapC and VapC from Mycobacterium tuberculosis) was successfully determined using the described strategy.
Rv0065 Rv0617
Thisrapidandsensitivemethodcanbeappliedtodeterminethesequence-specificityofVapCribonucleasesalongwithother
RNA interferases (suchas MazF)froma rangeof organisms.
Keywords: VapC; toxin-antitoxin;mycobacteria;RNase;RNA interferase;PIN-domain
INTRODUCTION The term ‘‘RNA interferase’’ has been given to the VapC
toxins, reflecting their biochemical activity as sequence-
The Pfam database lists 4089 proteins belonging to the
specific RNases. This term also encompasses an unrelated
PIN-domain family (PF01850) from 1129 different species
TA toxin family, the MazF proteins, that cleaves mRNA
(Finn et al. 2010), including eukaryotes, archaea, and pro-
(Zhang et al. 2003).
karyotes. The VapBC (virulence-associated protein) toxin-
The VapBC TAs are the largest family of the nine TA
antitoxin(TA)familyaredefinedbytheirtoxiccomponents,
families classified (Gerdes et al. 2005; Van Melderen et al.
which belong to the PIN-domain protein family. TA pairs
2009), yet they are the least well characterized. Although
are arranged as a bicistronic operon (Anantharaman and
sequence conservation across PIN-domains is poor, there is
Aravind2003),andthetoxingeneencodesastabletoxin (a
conservationofthethree-dimensionalstructure,whichresults
VapC PIN-domain). The preceding gene encodes a labile
in a clustering of acidic residues proposed to constitute the
antitoxin (VapB) that bindsto andinhibitsthe activity of
active site (Arcus et al. 2011). Of the few VapC/PIN-domain
thetoxin.Ingeneral,theantitoxinalsobindstoDNAviaits
proteinscharacterized,mostdemonstrateribonucleaseactivity
N-terminal domain and interacts with specific sequences
(Daines et al. 2007; Miallau et al. 2009; Ramage et al. 2009;
within the promoter of the TA operon (Gerdes et al. 1986).
Ahidjo et al. 2011). VapC of Shigella flexneri 2a virulence
plasmidpMYSH6000andVapCofSalmonellaentericaserovar
TyphimuriumT2aresite-specifictRNasesthatcleaveinitiator
5Correspondingauthor. tRNA between the anticodon stem and loop (Winther and
[email protected].
Gerdes 2011). VapC6 from Sulfolobus solfataricus targets
Articlepublishedonlineaheadofprint.Articleandpublicationdateare
athttp://www.rnajournal.org/cgi/doi/10.1261/rna.031229.111. mRNAs involved in the heat shock response (Maezato et al.
RNA(2012),18:00–00.PublishedbyColdSpringHarborLaboratoryPress.Copyright(cid:2)2012RNASociety. 1
Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press
McKenzieet al.
2011), and VapC from nontypeable Haemophilus influenzae
degrades free RNA in vitro but not double-stranded (ds)
DNAorsingle-stranded(ss)DNA(Dainesetal.2007).VapC-5
from Mycobacterium tuberculosis displays Mg2+-dependent
ribonuclease activity (Miallau et al. 2009), although the
catalytic mechanism or sequence-specificity of these en-
zymeshasnotbeendetermined.AlthoughFitBfromNeisseria
gonorrhoeaestructurallyresemblesVapC ,itsribonucle-
PAE2754
ase activity has not been characterized due to an inability to
express soluble recombinant protein (Mattison et al. 2006).
Ithas,however,beenshowntomediateintracellulartraffick-
inginvivo(Hopperetal.2000).PIN-domainproteinsfrom
eukaryotes are associated with nonsense mediated decay
(NMD) of RNA (Huntzinger et al. 2008) and processing of
pre-18S rRNA fragments (Lamanna and Karbstein 2009).
An important step to understanding the function of
VapC and the PIN-domain proteins is the biochemical
elucidation of their RNase sequence-specificity. We have
previouslydemonstratedribonucleaseactivityforVapC
Rv0065
and VapC from M. tuberculosis (Ahidjo et al. 2011).
Rv0617
Here,wedescribea detailedprotocolforthe purification of
VapC from two organisms and the determination of VapC
sequence-specificity as a first step in identifying the bi-
ologicalsubstrateforVapCenzymes(Fig.1).Therearetwo
significant hurdles in the biochemical characterization of
VapC:expressionandpurificationofVapC(inmanycases,
a very toxic protein) and determination of the target RNA
sequence.Toovercomethefirsthurdle,wehavedeveloped
an approach to overexpress and purify the inactive VapBC
complex and then isolate VapC alone, from this complex.
ThiscircumventstherequirementtoexpressthetoxicVapC
alone, which has previously been shown to be problematic
(Mattison et al. 2006; Miallau et al. 2009; Ramage et al.
2009). To overcome the second hurdle, we have developed
a ribonuclease assay usingsynthetic substrates and MALDI-
TOF mass spectroscopy (MS).
Although determining general ribonuclease activity is
straightforward, there are few methods for elucidation of
sequence-specificity. The most common method used is FIGURE 1. Schematic diagram of VapC purification, sequence-
primer extension (Zhang et al. 2003; Zhu et al. 2009; Han specificity, and kinetic analysis. To neutralize VapC toxicity it is ex-
pressedincomplexwithVapB.ProteolyticlysensitiveVapBisremoved
etal.2010).Alternatively,RNAtranscriptsofspecificgenes
bytrypsin,andVapCispurifiedbyanionexchangechromatography.
can be assayed and cleavage sites determined by labeling RNaseactivityandsequence-specificityarescreenedusingPentaprobes
the assay products with a radioactive isotope such as 32P (ticks indicate Pentaprobes cut by all VapC proteins tested; crosses
(Munoz-Gomezetal.2004;Fuetal.2007).However,these indicatePentaprobesnotcut).ShortRNAoligonucleotidesaredesigned
basedonthePentaprobeRNAcleavedbyallVapCproteinsandcutsites
approaches require prior knowledge of a bona fide target
determined by MALDI-TOF MS and in-house software. A fluorogenic
mRNA and/or use the viral MS2 RNA as a substrate. We RNAsubstratewithasinglecutsiteisthendesignedfordetermination
have developed a new rapid ribonuclease activity assay for ofVapCkineticparameters.
sensitivedeterminationofthesequence-specificityofVapC
proteins. Identification of VapC target sequences allows de-
termination of possible in vivo substrates for VapC. This equalnumberofeachbase),itformsanextensivesecondary
newapproachemploystheuseofPentaprobesinsteadofthe structure, requiring the use of CspA (a major cold shock
commonly used MS2 bacteriophage RNA (Zhu et al. 2006; protein from Escherichia coli) as an RNA chaperone (Jiang
Ramageetal.2009).AlthoughMS2RNAiscomplexenough et al. 1997). The Pentaprobes were generated using a com-
todeterminecleavagesiteslongerthanthreebases(i.e.,MS2 puter algorithm that determined the minimum sequence
RNAis3569basesin lengthandcontainsanapproximately requiredtocovereverycombinationoffivebases—516base
2 RNA,Vol. 18,No.6
Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press
Determination ofVapC sequence-specificity
pairs(Kwanetal.2003).Thissequencewasthenencodedin Expression of VapC from M. smegmatis as a
MSMEG_1284
sixoverlappingdsDNAmoleculesfromwhichRNAcanbe His-tagged fusion protein in E. coli gave insoluble protein.
transcribed, resulting in 12 ssRNA segments (six in the However, expression ofVapC asa maltose bind-
MSMEG_1284
forward direction and six complementary sequences in the ing protein (MBP) fusion in E. coli greatly increased the
reverse direction)covering every combination of five bases solubility of VapC. This approach was reported by Ramage
(Bendaketal.2012).ThereversePentaprobesequencesalso etal.(2009)fortheexpressionofM.tuberculosisVapCpro-
allow dsRNA to be synthesized. The use of Pentaprobe teins. Wheninthe contextofa fusionprotein, MBP actsas
RNA,whichisshorterthanthecommonlyusedMS2RNA, ageneralmolecularchaperoneandpromotesproperfolding
reduces the amount of secondary structure present in the of the attached protein (Kapust and Waugh 1999). MBP
RNA substrate (negating the need for an RNA chaperone) mostprobablypreventsdimerizationofVapC,therebyabol-
while still allowing screening of recognition sequences up ishing its activity and its toxicity to the cell and enabling
tofivebases.OtheradvantagesofthePentaprobeplasmids soluble protein expression. Although we found MBP-VapC
are that dsDNA, ssDNA, dsRNA, and ssRNA can be syn- inthesolublefractionoftheE.colilysate,thefusionprotein
thesized and that biochemical activity is tested against all elutesinthevoidofasize-exclusioncolumn,indicatingthat
substrate types. it forms large soluble aggregates. Further, proteolytic cleav-
Although there have been reports of MALDI-TOF MS age of MBPfromVapC was notpossible,perhapsasacon-
being used for analysis of RNA up to 461 nucleotides (nt) sequence of this aggregation (data not shown).
(Kirpekar et al. 1994), mass resolution decreases dramati- In contrast, the VapBC complex is inactive and thus
callywithincreasingoligonucleotidesize.Thereforetodeter- moreamenabletooverexpression(Robsonetal.2009).Itis
mine the RNase sequence-specificity, we designed short awell-knownfeatureofTAsystemsthattheantitoxinisless
overlapping RNA oligonucleotides based on the targeted stableandmoresusceptibletoproteolyticdegradationcom-
Pentaprobe sequence (Fig. 1). These short RNAs were cut pared with the toxin (Gerdes et al. 2005). To exploit these
and analyzed using MALDI-TOF MS. The use of RNA differentpropertiesofVapBandVapC,theproteasetrypsin
oligonucleotidesandMALDI-TOFMSnegatestheneedfora was used to digest away VapB from several recombinant
reversetranscriptase.MSprovidesafast,sensitive,anddirect VapBC complexes. Thus the mycobacterial VapC proteins
wayofanalyzingtheproductsofribonucleaseactivityassays. VapC and VapC (from M. tuberculosis) were
Rv0065 Rv0617
OncethespecificityofVapCwasknown,detailedkinetic isolated by digestion of their cognate VapBC complexes
analyses were carried out using a sensitive fluorometric sub- with 0.1 mg/mL trypsin and subsequent anion exchange
strate similar to that of the method described by Kelemen purification (Fig. 2). The protease reaction was stopped by
etal.(1999)andWangandHergenrother(2007)forquantita- theadditionof0.1mg/mLtrypsininhibitor(fromSoybean
tion of VapC activity and kinetic analyses of these enzymes. max)beforepurification.MALDI-TOFMSofthedigestion
This approach is fast, robust, and general and can be mixture,followingpurificationofVapCbyanionexchange
combined with results from biological assays to link the chromatography, showed two masses corresponding to
in vitro and in vivo activities of this large and important VapC with and without the C-terminal His-tag (Fig. 2).
family of enzymes. It is also amenable to other sequence VapC and VapC (from the crenarchaeon
PAE2754 PAE0151
specific RNases such as the MazF family of RNases. Pyrobaculum aerophilum) can be overexpressed in E. coli
(Arcus et al. 2004; Bunker et al. 2008) with no toxicity
problems as seen for other VapC proteins. This is most
RESULTS AND DISCUSSION
probably aresult oftheir verylowsolubility at neutral pH.
Using a lysis buffer at pH 9.2 resolubilizes VapC from the
Expression and purification of VapC
cell lysate.
VapCproteinsaregenerallytoxicanddifficulttooverexpress.
WesurveyedarangeofapproachestooverexpressVapC.For
Screening for VapC sequence-specificity
example, initial attempts to express VapC in its
MSMEG_1284 using Pentaprobes
native host Mycobacterium smegmatis were unsuccessful due
to its toxicity. Following induction, no VapC protein was The 12 Pentaprobe vectors can be used to make ss and ds
detected on an SDS-PAGE gel, and sequencing of the VapC RNA and DNA substrates that encode every combination
expressionconstructrevealeda2-bpinsertionthatwasnot of five bases (Bendak et al. 2012). We have demonstrated
present prior to transformation (resulting in a nonsense ribonuclease activity for VapC and VapC using
Rv0065 Rv0617
stop-codon downstream), explaining the absenceofVapC one of the ss Pentaprobe RNA substrates (Ahidjo et al.
protein expression in this case. This mutation presumably 2011). Here we describe a detailed protocol for determi-
arisesinresponsetobasalexpressionoftoxicVapCfromthe nation of the sequence-specificity of RNases and use this
leaky T7 promoter before induction and a requirement to approach to determine the sequence-specificity of two
escapefromthistoxicexpressioninorderforthebacteriato VapCs from M. tuberculosis and two from P. aerophilum.
grow. Figure3illustratestheuseofPentaprobeRNAsforscreening
www.rnajournal.org 3
Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press
McKenzieet al.
VapC andVapC exhibit
PAE0151 PAE2754
no nuclease activity against dsRNA,
ssDNA, and dsDNA, although they had
been shown to cleave the ssRNA equiv-
alent to the same sequence.
Identification of the VapC
target sequence
VapC , VapC , VapC ,
PAE0151 PAE2754 Rv0065
andVapC allcleave932Pentaprobe
Rv0617
RNA. Therefore, a set of short over-
lapping oligonucleotides covering 932
Pentaprobe RNA could be used as sub-
strates for VapC , VapC ,
PAE0151 PAE2754
VapC , and VapC . Ribonucle-
Rv0065 Rv0617
ase activity of VapC was tested against
these short RNA oligonucleotides, and
MALDI-TOFMSwasusedtoidentifythe
RNAcutsites.MALDI-TOFMSisacon-
venient tool for the analysis of many
complex mixtures and is well suited to
analysis of RNA molecules (during the
ionizationprocessDNAispronetoloss
of bases, whereas RNA is more stable)
(Nordhoff et al. 1993). Sample prepa-
rationiscrucialforMALDI-TOFMSas
chemicals commonly used in biochem-
ical assays such as EDTA, glycerol, and
MgCl can reduce sample ionization;
2
RNA also forms adducts with sodium
andpotassiumions(Shaleretal.1996),
which decreases mass accuracy. It is
therefore crucial for the sample to be de-
salted before MALDI-TOF MS analysis.
FIGURE 2. Purification and isolation of VapC. (A) The VapBC complex Rv0065a-Rv0065
fromM.tuberculosisexpressedinM.smegmatiselutesasasinglepeakonanS200sizeexclusion Avarietyofdesaltingtechniqueswere
column. (B) Thecorresponding SDS-PAGE gelshows the presence ofbothVapBandVapC trialed and assessed for their ability to
proteins in the complex. (C) Trypsin digestion of the VapBC complex followed by anion
minimize impurities, reduce adducts,
exchangechromatography.Duetodifferencesintheirisoelectricpoints,trypsiniselutedearly
from the column while VapC is eluted later in the NaCl gradient. (D) Corresponding SDS- andmaximizesamplerecovery.AllVapC
PAGEgeldemonstratesthetrypsindigestofVapBCloadedontothecolumn(LOAD)andthe proteinstestedrequiredNaClandMgCl
2
presenceofVapCwithandwithouttheC-terminalHis-tag. for activity. The use of cation exchange
beads loaded with ammonium ions to
ofVapCsequence-specificity.VapC andVapC exchangeoutthesodiumionswasonlymoderatelysuccess-
PAE0151 PAE2754
aresequence-specificandtargetthesamesequenceasshown ful;sodiumion adductswerestill present upon MSanalysis
by the same cleavage pattern for the 924 Pentaprobe RNA (datanotshown).C reverse-phasepipettetips,alsoknown
18
(Fig. 3). VapC and VapC target a different se- as ZipTips resulted in cleaner RNA, but the majority of
Rv0065 Rv0617
quence on the same 924 Pentaprobe substrate (Fig. 3). The the sample was lost in the process. Both lithium chloride
sequence-specificityofVapC ,VapC ,VapC , andethanolprecipitationandsodiumacetateandethanol
PAE0151 PAE2754 Rv0065
and VapC also differ from that of VapC , precipitation of RNA cleavage products were moderately
Rv0617 MSMEG_1284
which does not cut the 924 Pentaprobe RNA (the sequence- successful approaches in precipitating small pieces of RNA,
specificity and biological role of VapC are pub- although some sample was still lost in the process and the
MSMEG_1284
lished elsewhere) (McKenzie et al. 2012). VapB in complex useofsodiumacetatedidnotremovesodiumadductsfrom
with VapC inhibits its RNase activity as shown in Figure 3 the RNA.
(theVapBCcomplexPAE2754/PAE2755couldnotbetested Ammonium acetate and ethanol precipitation of assay
due to the insolubility of VapB upon expression). reactions resulted in maximum sample recovery, and the
4 RNA,Vol. 18,No.6
Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press
Determination ofVapC sequence-specificity
positioneddirectlybeforethecleavagesite,whereasthere
is some redundancy for the bases present at other positions
in the target sequence (Fig. 4C).
VapC and VapC cleaved almost all of the
Rv0065 Rv0617
short 932-based RNA oligos but with varying efficiency;
analysis of the cleavage products for one of these short
oligosbyMALDI-TOFMS(Fig.5A)revealedthatVapC
Rv0065
and VapC cut GC-rich 4mers, i.e., GGCG, GCCG,
Rv0617
andGGGC(Fig.5B).Analysisofthecleavagesitesacrossall
the RNA oligos cut by these two VapCs confirmed that
VapC and VapC target GC-rich sequences (Fig.
Rv0065 Rv0617
5C). As with the other VapC proteins characterized in this
study,thereisredundancyinthetargetsequenceandVapC
will cleave a range of sequences less efficiently (Fig. 5C).
Table1liststheVapCproteinscharacterizedtodateand
FIGURE3. VapCproteinsRv0065,Rv0617,PAE0151,PAE2754display
the range of sequence targets for these RNase enzymes.
sequence-specific, Mg2+-dependent ribonuclease activity. VapC
PAE0151 VapC and VapC cut GC-rich 4-mers, and
and VapCPAE2754 appear to target the same sequence as seen by the Rv0065 Rv0617
sameRNAfragmentsonthegels;thisisalsoseenforVapC and VapC and VapC cut the G-rich sequences
Rv0065 PAE0151 PAE2754
VapCRv0617, which also appear to target the same sequence. Negative GGUG and GGGG. With all four proteins characterized to
controls (RNA only at 0- and 60-min time points) show no ribonu-
date,thereisredundancyinthetargetsequences,inthatthey
clease contamination; 12 mM EDTA (E) inhibits VapC activity, and
will cleave other sequences, albeit at a lower rate.
VapC when in complex with VapB (C) displays no ribonuclease ac-
tivity. This lane is missing from the VapC panel as VapBC Determination of the specific RNA sequence motif that
PAE2754
cannotbeproducedinthiscaseduetotheinsolubilityofVapB.Ladder istargetedbyVapC proteins isjustthefirststepinfinding
indicatessizesofRNA.
the biologically relevant target. It is likely that the biologi-
cally relevant target is a combination of sequence and RNA
samplesweremore amenable toMALDI-TOFMSanalysis. secondarystructure.However,theidentificationofthetarget
ThismethodwassuccessfulforVapC andVapC sequence is an important first step to characterizing the
PAE0151 PAE2754
assaysastheseareconductedinaTris-HClbuffer.VapC biological activity of individual VapC RNases.
Rv0065
and VapC assays were conducted in a sodium phos-
Rv0617
phate buffer giving rise to sodium adducts on the RNA.
Precise bonds cut by VapC
However, these VapC proteins demonstrated equivalent ac-
tivityinanammonium phosphate buffer. MALDI-TOFMS MALDI-TOF MS analysis also provides insight into the
data were analyzedusing in-housesoftware thatscannedall molecular mechanism of VapC RNase activity. The precise
peaks and matched these with theoretical masses generated masses of the RNA cleavage products from VapC ,
PAE2754
from the known oligonucleotide sequences. VapC , VapC , and VapC reactions reveal
PAE0151 Rv0065 Rv0617
ThiscombinationofPentaprobesandMALDI-TOFMSof a 59 phosphate present on the 39 cleavage product. This
oligonucleotidesbasedonaPentaprobeRNAallowedusto contrasts with the reported mechanism of the MazF and
readily characterize the sequence-specificity of VapC from PemK (Kid) toxins, as well as that recently described for
the two organisms. VapC and VapC cleaved VapC from S. flexneri and VapC from S. enter-
PAE0151 PAE2754 pMYSH6000 LT2
short RNA oligos based on the 932 Pentaprobe. Figure 4 ica. These enzymes have all been reported to cleave the
showstheMALDI-TOFspectraofthecleavageproductsfrom phosphodiester bond to yield a free 59 OH group on the 39
a short 932-based oligo after incubation with VapC cleavageproduct,anda29-39cyclicphosphateonthe39end
PAE0151
orVapC .After5min,alargeproportionoftheRNA of the 59 cleavage product, similar to RNase H (Munoz-
PAE2754
oligo is degraded, and after 60 min, all of the oligo is Gomez et al. 2005; Zhang et al. 2005; Winther and Gerdes
degradedand thehigher-molecular-weight RNA fragments 2011).
are also being degraded (Fig. 4A). This result suggests that Our MALDI-TOF MS data are consistent with other
there is an optimal recognition sequence for VapC metal-dependent ribonuclease enzymes that activate a
PAE0151
and VapC and that other suboptimal sequences are water molecule to initiate nucleophilic attack and cleave
PAE2754
alsorecognizedforcleavage(Fig.4B).Figure4Csummarizes the 39-O-P bond of RNA to produce 39 hydroxyl and 59
thecleavagesitesofVapC andVapC acrossall phosphate cleavage products (Tadokoro and Kanaya 2009).
PAE0151 PAE2754
theshortoligostested.TheMALDI-TOFMSresultsinFigure4 Future work to establish the exact catalytic mechanism
confirmedthatthesetwoproteinstargetthesamesequence of VapC/PIN-domain proteins and the determinants of
and revealed the optimal cut site to be GG*UG, and also the sequence-specificity will allow prediction of the RNA
showed a less optimal cleavage site at GG*GG (Fig. 4C). sequencestargetedby eachmember ofthislarge family of
Overall, it can be seen that a guanine residue is always proteins.
www.rnajournal.org 5
Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press
McKenzieet al.
FIGURE 4. VapC and VapC target GGUG and GGGG sequences. (A) MALDI-TOF MS of 932 RNA oligonucleotide five
PAE0151 PAE2754
negativecontrols(RNA0and60minandEDTA)shownodegradationoftheRNAoligonucleotideduetoribonucleasecontamination.Time
courseassaysofVapC (rightpanel)andVapC (leftpanel)showverylittleactivityafter1minat37°CwithVapC.After5min,acut
PAE0151 PAE2754
site at GGUG (red fragments in B) is observed with other less optimal cut sites appearing later in the time course (15–60 min; black
fragmentsinB).(B)932RNAoligonucleotidefivewithcorrespondingcutsitesandm/zvalues;dottedlinesrepresentfragmentsthatwere
belowtheMSdetectionlimit.(C)AnalysisofVapCcleavagesitesacross932RNAoligonucleotidesascalculatedbyWebLogo(Crooksetal.
2004). The VapC cleavageposition is indicatedby an arrow. Theheight of theletter is proportional to thefrequency ofthat baseat that
particularposition.
Kinetic analysis of VapC VapC displayed no activity against a short, chi-
PAE2754
meric (ssDNA/RNA) oligonucleotide in which the cut site
Fluorogenicsubstrateshavepreviouslybeenusedtoana-
GGUGwasflankedbysixtosevenDNAbasesoneachside
lyze the reaction kinetics of ribonucleases (Park et al.
(data not shown). This protein did, however, cleave the
2001; Wang and Hergenrother 2007) and generally con-
RNAequivalentofthechimericoligonucleotide,suggesting
sist of single RNA bases flanked by short DNA se-
thatflankingRNA(butnotDNA)sequencesarerequiredfor
quences. These mixed oligonucleotides are labeled with
catalysis. A substrate consisting of GGUG surrounded by
a fluorophore at one end and a quencher at the other.
randomizedA,C,andUresidueswasdesignedtohaveonly
When the fluorophore and quench are in close proxim- one cleavage site (Fig. 6A,B) for VapC (eliminating
PAE2754
ity, a small amount of fluorescence is observed. Upon secondary cleavage). We added a fluorophore (6-FAM)
cleavageofthesubstrate,thefluorophoreandquenchare tothe59endofthissequenceandaquencher(IBkFQ)to
no longer in close proximity, resulting in an increase in the 39 end, so that cleavage could be monitored by an
fluorescence. Based on this concept, we have developed increase in fluorescence at 518 nm. This strategy allowed
a sensitive, continuous fluorometric assay to measure determination of the Michaelis-Menten kinetics for
VapC activity. VapC (Fig. 6C).
PAE2754
6 RNA,Vol. 18,No.6
Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press
Determination ofVapC sequence-specificity
CONCLUSIONS
We have developed a simple, effective,
and general method for the isolation of
toxicVapCproteinsthatcanbeapplied
to VapBC complexes from a range of
organisms. Expression of soluble VapC
from mycobacteria was only possible
when in complex with their cognate
antitoxins using M. smegmatis as an
expression host. Then utilizing the in-
herentpropertiesofVapBandVapC,the
proteasetrypsincanbeusedtodigestthe
less stable VapB, leaving active VapC.
VapCcanbesubsequentlypurifiedfrom
trypsin using anion exchange chroma-
tography. This approach can be used
routinely for VapBC complexes from
M. tuberculosis.
The use of Pentaprobes and MALDI-
TOF MS provides a new, robust method
for determination of VapC sequence-
specificity. Pentaprobes provide identifi-
cation of cut sites of up to five bases in
RNA molecules of shorter length, re-
ducing the amount of secondary struc-
ture in the substrate. Shorter RNA oli-
gonucleotides can then be designed to
mimic regions of the whole Pentaprobe
molecule and analyzed by MALDI-TOF
MStodeterminesequence-specificity.The
sensitivity of this technique allows deter-
minationofthepositionofthephosphate
moiety on the cleavage products and is
useful for elucidation of RNA cleavage
mechanisms. This method has been ap-
plied to four VapC proteins from two
different organisms, identifying different
cleavage sites for different proteins, out-
lining the effectiveness and versatility of
the method.
The results presented here point to
anumberofpossiblebiologicalrolesfor
thevapBCoperonsindisparatebacteria.
The G+C content of the two organisms
considered in this work (51% for P.
aerophilumand66%forM.tuberculosis)
FIGURE5. VapC andVapC targetGCsequences.(A)MALDI-TOFMSof932RNA suggests that the RNA target sequences
Rv0065 Rv0617
oligonucleotidethreenegativecontrols(RNA0and60minandEDTA)shownodegradation for the VapC proteins (Table 1) are re-
of the RNA oligonucleotide due to ribonuclease contamination. Time course assays of
latively common among the transcripts
VapC and VapC show optimal cut sites at GCC and GGG (indicated by red
Rv0065 Rv0617
fragmentsinB).Otherlessoptimalcutsitesappearlaterinthetimecourse(15–60min;black fromeachorganism.Thispointstoward
fragments in B). (B) 932 RNA oligonucleotide three with corresponding cut sites and m/z VapCs acting as global down-regulators
values;dottedlinesrepresentfragmentsthatwerebelowtheMSdetectionlimit.(C)Analysisof
of mRNA transcripts under conditions
VapCcleavagesitesacross932RNAoligonucleotidesascalculatedbyWebLogo(Crooksetal.
where VapC is free of its cognate in-
2004).VapCcleavagepositionindicatedbyarrow.Theheightoftheletterisproportionalto
thefrequencyofthatbaseatthatparticularposition. hibitor VapB. It also seems likely that
www.rnajournal.org 7
Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press
McKenzieet al.
M. tuberculosis (Arcus et al. 2011). In-
TABLE1. Sequence-specificityofVapCscharacterized
tuitively,onemightexpectthatdistantly
Pentaprobes 932RNA related VapCs would target unique sub-
VapCORF Organism cut oligonucleotidescut Sequence-specificity sets of RNA molecules. However, the
PAE0151 P.aerophilum 922 3–6 GG(U/G)G evidence presented here suggests other-
923 wise. Thisaddsweighttothe hypothesis
924 that VapCs in M. tuberculosis are in-
925
volved in global control of RNA in the
927
cell under conditions where VapC is
932
PAE2754 P.aerophilum 922 3–6 GG(U/G)G mobilized. This mobilization may be
923 duetotheup-regulation ofcellularpro-
924 teases under specific conditions that
925
wouldreadilydegradeVapBandliberate
927
VapC inside the cell.
932
Rv0065 M.tuberculosis 922 1–7 (G/C)G(G/C)(G/C/A)
923
MATERIALS AND METHODS
924
925 VapC /VapC and VapC
PAE0151 PAE0152 PAE2754
926 wereexpressedandpurifiedaccordingtothe
927
method described previously by Bunker
932
et al. (2008) and Arcus et al. (2004), re-
Rv0617 M.tuberculosis 922 1–7 (G/C)G(G/C)(G/C/A)
spectively. VapBC complexes Rv0065a-
923
Rv0065andRv0617a-Rv0617werecloned
924
925 into pYUB28b according to the method
926 described by Ahidjo et al. (2011) and
927 expressed for the VapBC complex from
932 M. smegmatis according to the method de-
scribedbyRobsonetal.(2009).
The Pentaprobes cut by each VapC vary with each ORF. The 932 RNA oligonucleotides
cleavedbyeachVapC(932RNAoligoscut)wereusedtodeterminesequence-specificityof
Cloning of vapC
each enzyme. VapC characterized to date from the same organism exhibit the same MSMEG_1284
sequence-specificity. into pYUB1049
Theopenreadingframe(ORF)encodingthe
vapC (MSMEG_1284) gene was amplified
VapC will recognize not only sequence but also RNA sec- from M. smegmatis genomic DNA using primers engineered to
ondary structure as a determinant of specificity, and this contain an NcoI restriction site (underlined) in the forward
addsanotherlayerofcomplexitytothedeterminationofthe primer(TAGCTGCCATGGTTATCGACACTTCTGC)andaBamHI
cellular targets of VapC. Winther and Gerdes (2011) have restriction site (underlined) in the reverse primer (TATTTA
GGATCCGCGTGGACCGCAGCG). The amplified products
recently shown that VapC from enteric bacteria specifically
were digested, purified, and ligated into the pYUB1049 shuttle
cleaves initiator-tRNA (presumably via a combination of
vector, enabling expression with a C-terminal His-tag. The con-
sequence and secondary structure), affecting global trans-
struct was transformed into E. coli TOP10 cells and sequenced to
lation when VapC is dissociated from VapB. The target
ensure correct insertion. After sequencing, the constructs were
sequences that we have identified rule out initiator-tRNA transformed into M. smegmatis mc24517 electrocompetent cells
asatargetfortheVapCproteinsfromP.aerophilumandM. andpositivecoloniesselectedbyplatingthetransformantson7H10
tuberculosis; however, it does not rule out VapC targeting agar media supplemented with ADC (albumin, dextrose, catalase
tRNA molecules at other sites. Thus, our working hypo- supplement), 0.05% (w/v) Tween 80, and 50 mg/mL kanamycin
thesis isthat VapC targetsa combination ofRNA sequence andhygromycinB.
and secondary structure, down-regulating specific RNA
transcripts (or tRNA) in response to stress and thereby Protein expression and purification using
acting as post-transcriptional regulators of metabolism. Mycobacterium smegmatis as a host
Furtherinvivoexperimentsarerequiredtodeterminethe
Small-scaleexpressiontestswereusedtoscreenforexpressionof
precise cellular targets for the VapCs from P. aerophilum
VapCinM.smegmatis. Asingle transformedcolony wasselected
and M. tuberculosis.
and used to inoculate a PA-0.5G/Tween 80 seeder culture and
It is intriguing that VapC and VapC target
Rv0065 Rv0617 grown for 48 h at 37°C and diluted (1:100) into a ZYP-5052/
the same RNA sequence. These two proteins are only dis- Tween80expressionculture.Theexpressionculturewasgrownat
tantly related, sharing just 22% sequence identity. These 37°C, andaliquotsof cultureweretakenat24, 48,and96h and
VapCproteinsarepartofanarrayof46VapCproteinsin pelletedbycentrifugation.Cellpelletswereresuspendedin200mL
8 RNA,Vol. 18,No.6
Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press
Determination ofVapC sequence-specificity
Plasmids were extracted by the alkaline
lysis method and sequenced using T7 for-
ward and reverse primers to investigate the
absence ofVapCexpression.
Cloning of vapC into
MSMEG_1284
pMAL-c2x
TheORFencodingthevapCgene(MSMEG_
1284) was amplified from M. smegmatis ge-
nomic DNA using primers engineered to
containanEcoRIrestrictionsite(underlined)
intheforwardprimer(CTAGAATTCATGGT
TATCGACACTTCTG) and a BamHI restric-
tionsite (underlined)in the reverse primer
(TATGGATCCTCAGTGGACCGCAGC).The
amplifiedproductswerethendigested,puri-
fied, and ligated into pMAL–c2x, enabling
expressionof aMBP-VapCfusionprotein.
The construct was then transformed into
E. coli BL21 (DE3) electrocompetent cells
and plated on LB agar medium supple-
mented with100mg/mLampicillintoselect
for positive transformants. Constructs were
sequencedtoensurecorrectinsertion.
Protein expression and purification
of MBP-VapC
MSMEG_1284
fusion protein
A singletransformedcolonywas usedtoin-
oculate a rich media + glucose culture sup-
plementedwith100mg/mLampicillin,which
was then grown for 24 h at 37°C and was
used at a 1:100 dilution to inoculate a rich
media+glucoseexpressioncultureandgrown
at37°CuntilanOD ofz0.5wasreached.
600
Protein expression was then induced with
0.3mMIPTG,andcellswereincubatedfor
a further 2 h at 37°C for maximal protein
expression.
E. coli expression cultures were pelleted
by centrifugation prior to resuspension in
50mM phosphatebuffer (pH 7.4) 200mM
NaCl, and 1 mM EDTA and lysed by son-
ication. The cell lysate was centrifuged at
16,000g for 20 min to separate the soluble
andinsolublefractions.Thesolublefraction
FIGURE6. DesignofafluorometricsubstratefordeterminationofMichaelis-Mentenkinetics containing the MBP-VapC fusion protein
of VapC . (A) MALDI-TOF spectra of RNA oligonucleotide cleavage and (B) RNA
PAE2754 wasloadedontoaHiTrapMBPcolumn(GE
oligonucleotide sequence showing only one cleavage site. (C) Reaction velocities were de-
Healthcare). The column was washed with
terminedfromthe slopesofthe fluorescent datasetsand the calibrationplot. The Michaelis-
Mentenequationwas fit tothedatafor substrate concentrations 0.25–7.5mM.(D)Fromthe lysis buffer, and bound proteins were re-
curvefitVmax,K andk werecalculated. movedinasingleelutionstepwith5mLof
M cat
elution buffer (50 mM phosphate buffer at
pH7.4,200mMNaCl,1mMEDTA,10mM
lysis buffer (50 mM phosphate buffer at pH 7.4, 200 mM NaCl, maltose). Fractions containing the desired protein were analyzed
20mMimidazole).Thecellswerethenlysedbysonicationandthe by SDS-PAGE and subjected to either size exclusion chromatog-
lysate centrifuged at 13,000g for 20 min to separate soluble and raphy or Factor Xa cleavage to remove the MBP protein from
insoluble fractions. Samples were analyzed by SDS-PAGE for VapC.Aninitialevaluationoffusionproteincleavagewascarried
protein expression. outusingFactorXaat1%,2%,and3%(v/v)ofthefusionprotein.
www.rnajournal.org 9
Downloaded from rnajournal.cshlp.org on January 11, 2023 - Published by Cold Spring Harbor Laboratory Press
McKenzieet al.
The reaction mixture was incubated for 2, 4, 6, or 24 h at room 7. Samples are analyzed on a MALDI-TOF mass spectrometer
temperature(22°C)with shakingat300 rpm.Lowconcentrations (Bruker Daltonics) inlinear mode. Laser power istypically at
of SDS (0.01% and 0.05% [w/v]) were added to help improve z60%, but this can change depending on the ionization re-
cleavageofMBP. quirements of the sample. The mass range selector is set to
low range, and a range of 2–12 kDa is collected (dependent
onsizeoftheoligonucleotide).Theinstrumentisfirstcalibrated
Protocol for determining VapC ribonuclease activity
withanoligonucleotidecalibrationstandard(BrukerDaltonics)
and sequence-specificity
using an automatic polynomial correction before analysis of
1. The Pentaprobe insert is PCR amplified using pcDNA3 samples.
forward (AGAGAACCCACTGCTTACTGGCT) and reverse 8. Spectra are saved and exported to the DataAnalysis software
(AGCGAGCTCTAGCATTTAGGTGACA) primers flanking (Bruker Daltonics), peaks identified and labeled, and the
the insert to include the T7 promoter. Pentaprobe RNAs baseline subtracted.
aretranscribedfromthegelpurifiedPCRproductusingthe 9. The mass list and corresponding intensities are exported into
T7 MEGAscript kit (Ambion) and purified by sodium acetate a comma separated excel file. The data are then processed
andethanolprecipitation. using in-house software to determine possible cut sites. The
2. OnemicroliterofpurifiedVapC(1mg/mL)isincubatedwith intensitycutoffwassettomorethan1400soallpeaksabove
1 mg of each Pentaprobe RNA for 60 min at 37°C in the 1400 intensity will be picked for analysis. The software de-
presenceof6mMMgCl .6Timepointsaretakenandstopped termines the difference between the predicted mass of the
2
by the addition of formamide loading dye and heated for oligonucleotide and theactual value asmeasured byMALDI-
5 min to 70°C. Negative controls include the omission of TOFMS.Thefragmentswiththeclosestmatchingmasseswill
VapC (RNA only), the addition of 12 mM EDTA, and the determine thecut site.
additionof1mLVapBCcomplex(1mg/mL)insteadofVapC.
Samplesareanalyzedon10%urea-denaturingpolyacrylamide Kinetic analysis of VapC
PAE2754
gelspost-stainedwithSYBRGreenIIRNAstain(Invitrogen).
3. Overlapping RNAoligonucleotides aredesigned to model the Fluorogenicsubstratedesign
PentaprobeRNAthattheVapCproteinsofinterestcleaveand
A chimeric RNA/DNA oligonucleotide was designed with four
mimic the secondary structures of the equivalent regions on
RNAbasesflankedbyDNA(59-TAAGTCrGrGrUrGACATCAG-39)
thewhole Pentaprobe RNA.
andtestedforribonucleaseactivitybyMALDI-TOFMSasperthe
4. Assay reactions containing 1 mL purified VapC (1 mg/mL) is
protocol above. The RNA oligonucleotides UAAGUCGGUGA
incubated with1mgofeachRNAoligonucleotide for60min
CAUCAG and CUAAUCGGUGACUACA were tested for single
at 37°C in the presence of 6 mM MgCl in a final volume of
2 cut sites by MALDI-TOF MS as above. The CUAAUCGGUGA
10mL.Assayreactionsarestoppedbyadditionof5Mammo-
CUACA oligonucleotide labeled with 6-FAM (6-carboxyfluorscein
nium acetate (final concentration, 2 M) and three times the
fluorophore)atthe59endandIABkFQ(iowablackflurophore
reactionvolumeof100%ethanolandthenchilledonicefor
quencher) at the 39 end was ordered from Integrated DNA
the remainder of the experiment (at least 30 min). The pre-
Technologies (IDT) along with the cleavage products, 6-FAM-
cipitatedRNAfragmentsarecentrifugedat13,000gfor25min
CUAAUCGG and UGACUACA-IABkFQ.
at 4°C to pellet the RNA, and the pellet is washed with 70%
ethanolandthenresuspendedin10mLnucleasefreewater(not
Calibration plot
DEPCtreated)
5. MatrixforMALDI-TOFMSispreparedfreshandconsistsof5 Reactions containing a 1:1 molar ratio of the labeled 59 and 39
mg 3-hydroxypicolinic acid (3-HPA), 10 mL 2.5 M diammo- cleavageproductsatvariousconcentrations(0.1,0.25,0.5,1,1.25,
niumcitrate,125mLacetonitrile(ACN),and365mLnuclease 1.5mM),12mMTris-HCl,12mMNaCl,6mMMgCl ,to300mL
2
free water. The solution is vortexed well until all matrix is with nuclease free water were equilibrated to 37°C. Fluorescence
dissolved and thencentrifuged at13,000gfor 5 min. was measured as described above for 100 sec. Fluorescent values
6. Onemicroliterofmatrixsolutionisspottedontoeachspoton were used to construct a calibration plot of relative fluorescent
an Anchorchip target plate (Bruker Daltonics) and left to air units(RFU) versusoligonucleotide fragment concentration.
dry. One microliter of oligonucleotide calibration standard
(BrukerDaltonics)isthenpipettedontoamatrixspot,and Fluorogenicsubstratecleavage assay
1mLofsampleispipettedontosubsequentspotsandleftto
air dry. A Hitachi F-700 fluorescence spectrometer (Hitachi High Tech-
nologies) was fitted with a Hitachi Thermostatted cell holder ac-
cessory.Thecellwasmaintainedat37°Cbywaterfeedfromawater
bathat5.8L/min.Timescansuseda0.5datapitch,withPMTset
6Ribonuclease activity assays for VapC and VapC from M. to 450 V, excitation (ex.) 485 nm, emission (em.) 518 nm, 5 nm
Rv0065 Rv0617
tuberculosiswereconductedin12mMphosphatebuffer(sodiumphosphate slits, and 2 msec response time. Scans for assays and blanks were
typicallyusedexceptforMALDI-TOFMSwhereammoniumphosphatewas recordedfor100sec.
used),6mMNaCl,and6mMMgCl2.Ribonucleaseactivityassaysfor A stock VapCPAE2754 was prepared at 0.2 mg/mL and a stock
VapC andVapC fromP.aerophilumwereconductedin12
PAE0151 PAE2754 substrate solution prepared to 100 mM stock in nuclease free
mMTris.HCl,6mMNaCl,and6mMMgCl.Individualassayreactions
were set up for each time point to reduc2e the possibility of RNase water.Threehundredmicroliterassayreactionscontainingvarious
contamination. concentrationsoffluorogenicsubstrate(0.25,0.5,0.75,1.0,1.5,2.0,
10 RNA,Vol. 18, No.6