Table Of ContentTThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
ISSN 1346-7565 Acta Phytotax. Geobot. 60 C3) L:31-140 (2010)
BiosystematicStudieson the Family TofieldiaceaIeI.
Phylogeny Species 7bfieldia 7)ianthaInferredfrom
of of and
PIastidand NuclearDNA Sequences
MINoRuN.TAMuRAiZ HiResHi JuN YAMAsHITA2,
SHizuKA FusE3 ANDAzuTMAAIK,AAKI IsHII4
'DqT)artment ofBotaa Cy;raduat Sechoot qfScience. K.voto Ultiversi 1o(,i,tashii'akawa-o'iRweaskeea-rechho ,Sak.yo-ku,
l k5 , e t6 o0 6 - 85 0 2 , JL a v a n .*mn ta mur a@s ys .bo t.d yo to- u,a cv' p ( ke u t h o r fo r c o r re s p o n d en c,el; bistitutefor
Bioresources, Okctyama Univensit y2,-20-1 Chuo, Ktirashiki-shi ,Oka.vama 7iO-e046, Jk4Jan ;jMiiseuni ofIVdture
andfinman Activitie sf,lyogo, 6 l2ll'oigaok aS,ando-shi, i'lyo g6o69-i546 ,JLipan ;fBotanic Gaalrctens,
Graduate Schoog (ef'Science, Osaka City LJniversi 2t0y0,0 kri,saich Kia,tano-shi, Osaka 576-OO04 ,Jtupan
Using pLastid trnK, trnL and trnL-F sequcnces and nue]ear ITS sequenccs (455 b8p in total )frem 32 in-
dividual sof 13 speeies, we conducted a cembined analysis to clarify phylogenetic rclatienships ot' the
spccies of T(ofield iaancl 1)'ianth aand to discoye rnew taxonomic eharacters, According to strict consen-
sus of 45 most parsimonious trees, the two genera 'aTreb .menophyletic with leegi b6ootstra psupport. In
7Zlfield tihare,e robust clades (100% )are fbrmed: (1 ) coccinect, 7b. nudo. Tb .diveF:gen 7sb,. yunnanen-
sis and 7b. thibetiea, (2 )7b. calyculata, and (3 )7b. okuboi, Tb. gtabra and 7b. pu,s'il lTah.e species efthe
clade 3 arc primaril ycltaracterized by a broad and sharply bent leafapex as in some species of 7}'iantha,
Jn clade 1, the Chinese species of 7b ,dtveFlge nTsb,. yunnanensi sand 7b. tkibetiea are groupcd (100%),
They share long need]e-like or hair-li kpreoccsses on the leaf margin, ln 7>'iantha t,wo clades are formed:
'T}'.
(1 ) J'aponica ,7}: occidentalis and 7h giutinos afrDm the USA (76%) a,nd (2 )7>" r.aeemo,s'a and 7}' g,lu-
tinosa t'ro mCanada (91% )T,his might suggest that 7}t glutinos ais the assetnblage retaining ancestral
character states of 7}'iantha and shou]d be divide dat leas tint otwo species jn the futur etreatments.
'7ofeldiar.lbfieldiaceae,
Key words: Alismatales. ITS, molecu]at phylogcny, taxonomic eharacters , T}'i-
antha, trnK, trnL, trnL-F
[Ibfieldiacea e(Alismatal earse) rhizomatous The only molecular phylogeny of Tofieldiace-
"Ibfieldia-
perennia lherbs formerly include din Liliaceae. ae (TUmur aet ai. 2e04aj revea!ed that
The species grow in rocky alpine places, alpine ceae consist of Tofeldla Huds,, 7}"ianth a(Nutt,)
meadows, marshes, savannas, rock face salong Baker, Hlriflperoca lMlciDsaniel and Pleea Mi-
rivers, etc., and often on calcareous soils. The chx., and resolved the phylogenetic relationships
flower sare actinomorphic, homochlamydeous, among the fbur genera. Since that paper aimed at
trimerous, hypogynous, and nearly apecarpous, circumscribing 1[bfieldiacea em,any of the spe-
The capsules dehisce septicida]ly. Tlies echarac- cies were not included E.xcept fbr the monotypic
ter states are believe dto be ancestral in the mono- Hdrperocaili asnd Pleea, enly fiv especies of 7b-
cotyledons, and [Ibfieldiacea eare often consid- and only two species of 7>iantha weTe ana-
.fietdla
ered to be one of the morphological]y most lyzed.
primitjve familie samong the monocotyledons In this study, we focus on the Ttlfietd iaand
(Thorn1e992forMelanthiaceaeT,akhtajan1997, 7}"ianthaT.i"ianthdaiffbrsfirorTnofieldiian
usu-
Tamura 1998 fbr Nartheciaceae). ally having three flower sper node, glandular
NNIII-IE-leEcltreoncitcronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
132 Acta Phytotax,Gcobot. Vol.60
hairs ,and appendaged seeds, Nevertheless, 1)r-
antha has often been include din TQfietdia .For Materials and Methods
example, 7}'ianth aj'cu?onic a(Miq, )Bake/r ,en-
demic to Japan, was treated as nlfieidia in a!1 Piant mate"iaLs'
published Japanesc fiora s(e. gO.hwi 1953, Kita- DNA sequences of the plastid regions of the
mura 1964, Satake 1982). Tamura et al. (2004aj trnJl gene (includi mnatgK), trnL gene and trnL-
shosu'ed that the clade of ftianth ais independent Fintergenic spacer and the nuclear region ofITS
and sister to the clade containing the species of for nine species, one subspecies and one variety
Tofeldia. The results, however, were based on an (20 OTUs) of TQfieldia ,three species (1 0OTUs)
analysis ofonly several species, of 7)"iantha ,and Harperocallis flav MacDaniel
We recognize 11 species of Tofeldia, TQfielcl- and Pleea tenuij?)tia Michx. (a sthe outgroup)
ia coccinea Richardson and lb. pusiUa (Michx.)were determined (Tab l1e) ,We selected the out-
Pers. are distribut ewdidely in borea lregions. group based on the results of Tamura et al.
The other species, includin gTb. divergen sBu- (2004a A)s. fbr 7}"ianth aoceidentalis subsp, oc-
reau & Franch., 7b. glabra Nutt., 7b. nucla Max- cidentalis and 7k occidentalis subsp. breviso,la
im., lb. okziboiMakino and 7b. thibetica Franch., (C .L. Hitchc. )Packer, we faile din determining
are localize dI,n spite of this interesti ncogntrast the DNA sequences of trnK and ITS, and thus we
in distributio nranges, the relationships of the obtained data fbr only trnL and trnL-F(Tab]e 1).
species of TQfieldia have never been resolved, Alt of the sequence data arc deposite din the
'n'iantha ¢omprises four species: nt glutinosa DNA Data Bank ofJapan (DDBJ )database.
(Michx B.ak)er, 7}: occidentalis (S .Watson) R. R.
Gates and 7}" .racemosa (Waltc SDmall in North DAC4 exgraction, PCR amplijication and DIVA se-
America (Packe 2r002), and 7). ,ioponica in Japan quenclng
(Tamur ain press) ,7>'ianth aglutinos ais widely Total genomic DNA was extracted from fresh
distribu tien dthe USA and Canada, while the leaves ,silica gel dried leaves ,or leave sofherbar-
other three species are narrow]y localize dA.lso ium specimens from thc Missouri Botanica lGar-
in n"iantha, the phylogeny ofthe species has nev- den <MO) and Kyoto Universit y(KYO) ,by the
er been analyzed by molccular methods. slightly modified cetyltrimethylammonium bro-
The firs tai'm o'f this paper is to clarify the rn ide (CTAB) method of Doyle & Doyle (1987).
phy!ogeneti crelationships of the species ef Tb- The trnK, trnL plus trnL-F; and ITS regions
.fieldi aand 7>"ianth ausing amplc materials of the were amplified using the polymerase chain reac-
two genera ,although we were unable to analyze tion (PCR )with a programmable temperature-
the Russian Tofeldia cernua Sm. and the Himala- control system GeneAmp PCR System 9600 or
yan Tofetdia himalaica Baker. To achieve our 2700 (Appli eBidosystems) T.he amplification re-
goals ,w ¢ sequenced both plasti dand nuclear action mixture was prepared using TaKaRa Ex
DNA regions, which were 4558 bp in total after Taq DNA polymerase fo11owing it sinstructioll
the aljgnment. manual (Taka rSahuzo). We used sixteen, two,
Perhaps because of the simple morphology of and six PCR primers (Tabl 2e) for the amplifica-
[[bfieldiacea ev,ery few morphoLogical characters tion of trnK, trnL + trnL-b] and ITS regions, re-
have been used for the taxonomy of npteldia and spectively, and the tbllowing PCR profile :a 30-
n"iantha. The second aim of this paper is to dis- 37 cycle reaction with denaturatio ant 940C fbr
aover new taxonomic characters fbr Tofegdi aand O.5-1 min, annealing at 50-620C for O.5-1 min,
7}'ianth aby analyz{ng the detailed phylogenetic and extension at 720C for O.5-3 min, in addition
relationships of species of the two genera based to an initi adlenaturatio ant 940C fbr 2,5-5 min
on the molecular analysis, and a fina lextension at 720C for 5-7 min. We pu-
rified the PCR products with MicroSpin S-300
HR Columns (Pharmac Biiaotech )or QIAquick
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnSyts teSmaytsictsematics
rt(arc 2h0]O TAMuRA &AL.-1'hylogeny of 7kij7etd ianad 7}'iantha 133
TARLE L .Source sgfmateriats of Tofietdiaeeae
'1'axon Locality Veucher Acc. no.(trnK)Acc.]i[].vrn[&rrsiL-EiAcc.no.{TTS)
'TLIfieldia
ccrlycugata Wahlb. Gcrmuny:Frankrurt,Palmcngarten C. Bayer ,s. (nK.YO) AB541027 ABS410S9 AB541078
Germany:Garmisch-Partenkirch- A.Cirb'ger20.0ZV.1CKYO) AB54102g ABS410GO AB541079
en, Schachen, l70e m
Jta[y :Lago di Gardu, Val di lvTesta, eveminekx E 643 CMO) AB5410Z9 AB451S79 ABs41ogo
550mItaly
: Prov, de Trento ,Tinemalzo, J' .Maquei S2yPO (MO) AB541030 AB4S15SQ AB541081
1800m
7bjieidiacoccineaRichardson
vttr. coccinea USA/ Alaska, Lime Hills ,550 -67 Urn C. L. Parker di R. Lipki nSS84 ABS41031 AB451586 AB5410g2
(MO),Lt
var. kondoi {Miyab e& Kudo) Japan/ Hokkaido, Mt. Apoi, 63S m N. Jlrmura di S. Fuse 1.i227 AB541032 AB541061 AB541eS3
H.Hara CKYO),lt
Japan:Nagano1iretl,Mt. IL I7}imaura ,S, Fuse & 7/ AB541e33 AB541062 AB5410S4
Amakazari, 19SO ]n ls・hi i14344 (KYO)
7}zfieidi daivergens Bureuu & China: Yunnan, Dali. 2530 m ,・ tN.d .lhmura 4704 (KYO) AB541034 AB541063 AB5410g5
Franeh,nVieJdi[rglabraNutt.
USA; NorLh Care[ina, S of H. Al ,ldi]ldenke ILI CMO) AB541035 AB451S90 ABS41086
Jacksonville
Tbjieid inuada Maxim, japan/MiePvef,,Washiyama,11OmM. N, 7kemztt S'.a R.i,y '&e Z ABS41036 ABS41064 ABS41087
Ishii1517i(KYO)
J4a3paa 1n-:J aHpyano:gIolo kPkariedto,, KamegaLsubo, (,VK. YtN'O ,7)tjimduira & S, Ftts elj532 ABS41037 ABS410fiS AB541088
]QfietdiaekuboiMakinv Mt, Yubari, 1480m N llimuna & S. Fleis Ie5220 ABS41038 AB541066 AB541089
{KYO)M,
Japan :Hokkaido .Mt. YubarL 1]55 m iV. IlimTt r&a S, ")/s eIS2I6 AB541e39 AB5.41e67 AB54iD9D
(KYO),W.
Japan /Hokkaide, Mt. Yuhari .134 Sm iV. 7lrmltr adi S. )'us e1521)' ABS4104U AB541068 AB541091
(KYO),l{
Jupan/ lshikawa Preft ,Ml. N. 7inmura [E S. Fute r)',519 AB54f041 ABS41U69 ABS41092
Halcusan, 2580 rn (KYO),if
Japan/ Tshikawtt Pre CZ ,Mt. N. 71rmura & S. Fuse i.i521 AB54t042 ABS41070 ABS41e93
Hakusan,2500m {KYO)
7}ijietdiapttsiU(aMichx.Pe)Fs.
subsp.pusiila Denmark: Grecnland. SW of B. Fredtskild di C. Bay 3I48 AB54LQ43 tLB451593 ABS41094
Nonv'uk,5m {MO),4I
subsp. auh'tFiaca H, Kunz Austria:Mt.Dachstein,2030m N. 7lrmzir a& S. Fuse l6'OZ4 A.B541044 ABS41071 AB54109S
(KYO)C.
7kVieldiarhibeticaFranch. China /Siehuan H,ollgya l,l5e m H/ Li 394CMO) AB541045 AB4STS96 ABS41096
7?ijietdia,yunnanensi,s'Franch.China :Yunnan ,KL]nmin gl,g80m S. X }lian 256 (MO) AB541046 AB4St5S9 AB5410g7
Ti'it:nthagli.fiin-sa(belichx.)BUaSkAc/rA}aska,IndianRiverValle},, C.L.1'arker.ilY(OMO) AB541047 AB45t599 AB5410V8
40mCanada:Alberta.Banl'fNational
F..1BreteleFi39J4{MO) AB541048 AB4Sl597 AB541099
Park, 14SO m
USAi ldaho, Custcr SummeFs di at. 9354 (MO) AB541049 AB4Sl59S AB54110e
T]'iantha.iq)onica(Miq.)Buker Jnpan: Yhrnagata PreE, Mt. ,Lf. ?V l7Lineut 'cRa. S. flisf f1O135 AB54105e ABS41072 AB54tlOI
Chokai, 1650 m (KYO)M,
Japuii:IshikawaPref..Mt. A'.n:mura itS.Fuse t552S AB54105] AB54tC)73 AB5411e2
Hakusan, 2100 rn {KYO)".
Japan :Ishikaw aPrctL M,t. Okada fl),amsuar &di AB541eS2 AB541074 ABS41103
Shukadake.lgeO-190em lbsri 5511{OCU')
itdi
Japan :Shig aPrcC ,Mt, Miku"i ,800 m M. N, 1lrmu"u 13SOI (KYO) AB541053 AB541075 ,A,B541104
]'icTnth aoecidenkrlis (S .Watson) R , R Gates
subsp.occidentalis USA:California,NEofStirllng, L. Ahat' t& P. llhart 4rs8 (MO) -* AB451601 - -**-**
1750mUSA:
subsp,brevistyla(C,I,,Hitchc,) Washington SLate, J M Thompson 1.5079 CMO) ** AB451602
Paeker77iantharacetnosa{WalterS)nSoiqnuaallimic Nut. Forest, 2150 rn
USA/ South Carolina, Santcc S, R. M'il 2388,g {MC)) ABS4i054 AB4S16e4 A1354LI05
CoastalReserve
USA/ Alabama. Perdido ,V. Crovfe. sy.n. S-98 (GA) AB54105S AB541e76 AB54II06
USA: Flerida ,Walton M S. .Iud a226i (MO) AB5410S6 AB4S1603 ABS411U7
Hini:perocaUis.fiavaMcDanieUlSA: Hvrida, LiberLy S, B, Jbnes 25fP3 CMO) AB541057 AB4S16()6 AB541108
Pteea tenutfotia Michx. USA:NorthCarolima,Wilmington E IJ .Utech 78-300 (KYO) ABS4t058 ABS41e17 AB541109
* ocv: herbarium, Bota'nica lG'a-r GdrEadnu'atse ,school Et giEftiE ioseankaE eci.Ly university.
** 1)NA sequences orLhe trnKand ITS regions of T}iantha vcc'identalis subsp. occidenialifi and 71 occidematis suhsp. brevist. vwelrac
unab[e tn be determined.
NNIII-IE-leEcltreoncitcronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
i34 AetaPhytotax,Geobot. VOI.60
PCR Purificatio nKit (Qiagen), 544 to 579 bp, the piasti tdrnL-F intergenic spac-
Direct sequencing was conducted with 25, 7, ers firo m234 to 250 bp, and the nuclear ITS re-
and 7 primers (Tabl 2e) for trnK, trnL + trnL-F; gions from 574 to 589 bp. Values ofpairwise se-
and ITS regions, respectively, using an ABI quence divergenc eranged from O.O to 3.8% for
PRISM 310 or 3100 Genetic Ana]yzer (AppliedtrnK, to 5.1% for trnL, to 5.69 'f6br trnL-Il and to
Biosystems )and a BigDye [ferminator Cycle Se- 8.7% for ITS.
quencing Ready Reaction Kit (Appli Beidosys- DNA sequences of 7)"iant hwaerc much less
tems), according to the manufacturer's instruc- variable than those of Ttlfietd iIna .7)iantha, the
tions .Mostly we sequenced both strands, but in a trnK genes ranged from 2605 to 2627 bp, and the
few cases we sequenced only a single strand. We ITS regions from 573 to 575 bp. The trnL genes
manually aligned the DNA sequences obtained. were a constant 554 bp in all OTUs of 7)"iantha.
The trnL -F intergeni scpacers were also consis-
Plp,logeneticanalysis tently 241 bp in lengt hin all OTUs. Values of
We employed the maximum parsimony meth- pairwise sequence divergenc eranged from O,O to
od for phylogeny reconstruction using PAUP" 2.39 ,f6or trnK to 1,2% for trnL. to O,8% fbr trnL-
version 4.0 beta 10 (Swoffo r2d002) .Heuristic F; and to 3.0% fbr ITS.
(100
search option of random addition sequence
replications), tree bisectio nand reconnection Plo?logeneti carnal.vsis
(TBR) swapping a]gorithm and multiple parsimo- Combining all OTUs analyzed in this study
nious trees (MULPARS) were used to find the into the same data set, ofthe 2986 bp of trnK se-
most parsimonious trees, Only the base substitu- quences that were aligned fbr the analysis, 563 bp
tions were treated as characters for phylogenetic (1 8.9'9r6 )were variable, and 307 bp (10.3 9we,re6)
reconstruction. All base substitutions wcre equal- phylogenetical liynformative. Of the 618 bp of
ly weighted, The gaps were treated as missing aligned trre Lsequences, 77 bp (12.5 9wetre6) vari-
values. The consistency index (CI )re,tention in- able, and 49 bp (7.9% w)ere phylogenetical liyn-
dex (RI )an,d rescaled consistency index (RC) fbrmative, Of the 295 bp of aligned tffnL-F se-
were calculated with PAUP*, inc]udin guninfor- quences ,51 bp (17.3V w'er6e) variable, and 22 bp
mative characters. Bootstra panalysis with 1000 (7.5% )were phylogenetical ilnyfbrmativ eO.fthe
replications (heuris t1i00c ;random; TBR) was 659 bp of aligned ITS sequences, 291 bp el4.2gtfi)
perfbrmed using PAUP*. were variable, and l52 bp (23,I Vwe6re) phyloge-
Congruence among the data sets ofthree plas- neticaliy informative.
tid regions, trnK, trnL and trnL-E and also con- The partition-homogeneity test among the
gruence among the combined data set ofthe three data sets of three plastid regions, trnK, trnL and
plastid regions and the nuclear ITS data set were trnL-li ;fbund a P value of e.66 ,Considerin gthe
examined with the incongruence length difZ[er-incongruenc ethreshold of O.05 ,we concluded
ence (ILD )test (Farr eits aL 1994), implemented that the data sets of the three plasti rdegjons were
in PAUP", as the partiti ohnomogeneity test .The combinable, Further, the partition-homogeneity
tests were performed with 100 replications of test of the combined data set of the three plastid
heuristi csearch with random addition sequence regions and the nuclear ITS data set found a P
(10 0replications), TBR swapping, and MUL- value ofO,17, Thus, xiv' econcluded that the data set
PARS. of three plasti dregions and the nuclear ITS data
set were also combinable,
Results and Discussion The combined analysis of the plasti dtrnK}
trnL and trnL-F sequences and nuclear ITS se-
DMI seauence variation quences resulted in 45 equally most parsimoni-
In Tofeldia, the plasti dtrnK genes ranged ous trees with 1371 steps, The C] .was O.85 ,the RI
fi;om 2536 to 2643 bp, the plastid trnL genes from O.93 ,and the RC O.78.
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorPrl anPtlSyastnetma tSicysstematics
March2010 TIAMuRA & iNLr-Phylogeny of fZzi7eld ianad 7)'iantha l35
TABLE 2. Narne ,dircctien ,DNA sc quence and reference lb rPCR and sequence primers used in this study
Primernamc DirectionDNA sequencc (SL3') Reference
[Plas ttimKd: gene (includ miatnllg )]
trnK-11a SenseSenseSCeTnCAsAeCAGnGtTiA.sGeAnGsTeACTCG Liston & Kaderei t( 1995)
trnK-300F" GGGTTTAGTGAATAAATGGATAG Yamashita & Tamura (2000)
trnKr314F" AATGGATAGAGTCCTATGGCCCC Ncwly designed
trnK.400R" AACCTTTTCCCGCATCAGGC Yhmashita & Tamura C2000)
trnK-407R" Antisense CACAGAGGAACCCTTTCCCGC Newly designed
trnK-450Fa SenseAntiseGnAsTeTATGGAGCGTAGGCAGA Newly designed
trnK.650Ra CCACTAAACAGGGAGTCCAATC Newlydesigned
tl'nK-697FU SenseAntiseCnCsTeTGTTCTGACCATATCGCAC Ncwly designed
trnK-706Rfi ATTATACATAGTGCAATATGGTC Yamashita& Tamura (2000)
matKr750Fb SenseAntiscGnAsTCeTCGGCAACAACGCTTC Ncwly designed
GAGTAACGGATATAAGAAGCGTTG Newly designud
matK-80oRb
matKrAI;b SenseAntisensCeTATATCCACTTATCTTTCAGGAGT Ooi et al. ( 199S)
CCTAAAATTTCCATGGGTTCGTG Newly designed
matK,8sORb
matKrle80Fb SenseScnseSenAsAeGATnTtTiTsGeCnAsAeTTATTGTAG Yamashita&Tamuta(2000)
GAAATACCAAAATCTCAGAA Fuse & Tamura (2000)
matK-1150F"
TATACTAATACCCCACCCC Johnson & Selti(s1995)
rnatK-123sFb
GGGGTGGGGTATTAGTATA Johnson& SoEti(s199S)
matK-1235R"
SenseAntiseTnAsCAeATGTCGGATACAAGATGTTCC Newly designed
matK.135oFa
AAGATGTTGATCGTAAATGA Johnson& Soltis(1995)
matK-147oRa
matK-1649Fb SenseAntiseTnCsTTeTTGATGAAGAAATGGA Tamura et al. (2004b)
matKr1700Rb ACCAAAAGTGAAAATAATATTGCCA Tamura et aL (2004b)
SenseSenseAntCiAsTeCnCsCeATTAGTAAGCCGAT Newly designed
matK.190oFEi
MatKr8F" TCGACTTTCTTGTGCTAGAACTTT Steel e& Vilgaly s(1994)
matK.8R" AAAGTTCTAGCACAAGAAAGTCGA Steele & Vilgalys ( 1994)
trnK.2621U Antisense AACTAGTCGGATGGAGTAG Listen & Kadereit (1995)
[Plast itrdn:L gene & trnL-F intergen iscpacer]
trnL-c"trnL-4ooFh SenseSenseACnGtAAiAsTeCnGsGeTAGACGCTACG Taberlet et al. (1991)
CACTCCAGAGTCTGATTGAT Newly designed
trnL-400R" ATCAATCAeACTCTGGAGT(} New]y designed
trnL-42oFh SenseAntisensCeAAGAATAAAGAGAGAGTCC Newly designed
'taberlel
trnL.db GGGGATAGAGGGACTTGAAC et aL (1991)
btrnL-etrnF-tff ScnseAntiseGnGsTcTCAAGTCCCTCTATCCC Taberle ett aL (1991)
rllaberlet
ATTTGAACTGGTGACACGAG ei aL (1991)
[NucleaIrTS:]
18s-FaITsr7FbITS"81;,SienseSenseSenAsAeGSTeTnCsGeTAAnAtCiAsAeGnGsTeTTCCGTAGGTG Bogler et al. (1995)
GGTTTCCGTAGGTGAACCTGCGGAAGGATC Newly designed
(}GTGGCGGTCCAATGAACAAACCCC Newlydesigned
ITs3aITS2EITS-9Ra GCATCGATGAAGAACGCAGC Whlte et at. (1990)
GCTGCGTTCTTCATCGATGC White et at. (1990)
Antisense GCTCATGTCCACCACTCATCGTGACTTGTC Newly designd
¢
ITS4u Antisepsc TCCTCCGCTI[IATTGATATGC White (1990)
et aL
sHUsedforbothPCRamplificationandDNAscquencing
Used for only DNA seqLLencing
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnt SSyystsetmaetmicastics
136 ActaPhytotax.Geobot. Vol.60
According to the strict consensus tree (Fi g1,), pttsiil a,subspp, pusilla and austriaca H. Kunz,
the species of 7tlfieid iaare grouped with 1009t6 are grouped (1009 ats6 e)xpected, while 7b. okuboi
bootstra psupport, and the specics of 7i"ianth aare from Japan and 7b. glahra in the eastern USA are
also grouped (1OO% )T.his independence between also grouped (89%).
Tofetdia and 7>'ianth awh,ich was already indi- In 7)"ianth at,wo c]ades were formed. One
cated in [tamura et al. (2004 ab)ased on a molecu- clade (76g ,i6nc)luded "t .ioponica, 7} Locciclenta-
lar phylogeneti canalysis, is substantiated using li sand 7h glutinos afrom Aiaska and Idaho,
an ample sample size in this study, These findings USA. and the other clade (91% )contained 7) "r.a-
are consistent with recent taxonomic treatments cemosa and 7)" .glutinosa from Alberta, Canada.
in which 7>"ianth ais often regarded as distinct The results may suggest that 7}t gltitinos waho,se
from Tofeldia (Utec 2h002, Tamura in press), distributi iosn much wider than the distributi oofn
In Tofeldia, three robust clades (1009 iwe6re) the other three species, is the assemblage retain-
formed, Clade 1 comprises 7b. coccinea, 7b. ing ancestral character states of 7)ianlh aand
nudo, 7b. diveilgen 7,bs.' y,unnanensis Franch. and should be divided at leas tinto two species in fu-
7b, thibetica; clade 2 contains 7b. ca(yculata ture treatments, Befbre such a move, however,
Wahlb., and clade 3 include s7lo .okuboi, 7b. gla- ample materials of "" .glutinosa covering the
bra and Tb, pusitla .The species of clade 3 are whole range of distributio nshould be subjected to
characterized by the broad leafapex being sharp- molecuEar analysis. The other two American spe-
Ey bent as in seme species of 7}'ianth aal,though cies, 7b. oecicientalis and 7>z raeemosa, and the
the leaf apex of 7b, pusilga is sometimes gently Japanese 7}i .icuponic aare monophyletic with
curved (Fi g2.) .The leaf apex of the other species 599,6 ,98%, 91% support, respectively.
of 7t?fiei dainaalyzed in this study is more or less In niantha.ioponic aap,lant from Mt. Chokai
slender, and straight, gent]y curved or slightly (Yamagat ano)rt,hern Honshu, with 94% support,
bent (Fi g2.) .Leaf apex morphology has been in- diverged firs tfrom the remaining three plants,
ftequently used as a taxonomic charactcr in 7b- which are from Mt. Hakusan (lshikaw aMtj.,
.fieldia ,but this study revealed that the morphol- Shakadalc e(Ishika wanad) Mt. Mikuni (Shigaj,
ogy ofthe leaf apex is ofgreat taxonomic yaluc in all located in central Honshu. The relationships
Tofeldia. among 7) "J.'aponica agree with the hypothesi sof
In the clade of Tofieldia coccinea, 7b. nudu. Fojii & Senni (2006 s)N'h,ich emphasized that the
7b. divergens ,7b. .yunnanensis and 7b, thibetica, mountains ef central Honshu served as refugia
two subclades (IO09 'we6re) furthe rformed: one fbr Japanese alpine plants during interglac ipael-
of the circumboreat 7b. coecinea and the eastern riods.
Asian 7b. nudn, and the other of the remaining Concerning the distributi oofn TQfieldi aand
three species, The latte trhree species, all endern- n'iantka ,an interesti ncgemmon patter nis rec-
ic to China, share long needle-like (Fi g3.A) or ognized: each major clade consists of one widely
bai Flike (Fig 3.B & C) processes on the leaf mar- distribut ebdoreal species, with severai localized
gin. Scabrous versus smooth leaf margins are southern species. In the clade of 7b. coccinea, 7b.
sometim ¢s used as a diagnostic character in 7b- nudo, Tb. divergens ,n) .yunnanen,gis and 7b. thi-
field Iin aad.dition, however, the shape and size ot' betica ,7io .eoccinea corresponds to the boreal
the processes on the leaf margin may also be species; in the clade of 7b. okuboi, 7b. glabra and
valuable in the taxonomy of Tofieldi (aFi g3.). 7b. pusilla, 7b. pusitl ais the borea lspec{es; in the
Among the three Chinese species, n). diveF:gens clade of 7>'ianth aspp., it is 7}' g.lutinosa.
and Tb, yunnanensis are grouped (1009, 6Th)i.s is
not contradictory to the treatment of Chen & We express our sincere gratitude to Drs. CLemens Bayer,
Andreas GT(iger,Wendy B,Zomlefer,Madclcinearoves,
Tamura (2000 )in which Tb, yttnnanensis is re-
duced to 7b. divergens I.n the clade of Tb. okuboi, Hpilraonst hmait cOrikaalsd.a, aWnde aTroer ug rTabtkeufoukl ato fKourn msuipnplgying lns tusit -u'ti teohf
7b. glabra and 7b. pusiUa, two subspecies of lb. Botany, the Chinese Academy of Scicnces w.ho helped us
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorPrl anPtlSyastnetma tSicysstematics
March2010 TixMuRA & ."Ll..-I'hylo gofen TytVleld ainad ]'ia}itha 137
7lo .coc'cinea var. coccinea
7b. eoecinea var. kondoi (Hokliaido)
7b. coecinea var. kondoi CNagano)
Tb. nuda (Mie)
To. nuda (Hyogo)
7b.divergens
Tb.yunnanensis
Tb. thi.betica
gg,g
Tb. ealyculata (lta lLya:go di Garda)
7b. calyculata (Ita Plryev:. de Trento)
7b. (GermanyF:rankfurt)
calyculata
7b, calyc;ulata (Germany:G-apTti.S.Cts,ehe.)
Tb. (HokkaidYou,bari1480m)
okuboi
7b. okuboi (Holdca iYudboar,i 1355m)
7b, oimboi (Hokkaid You,bari 1345m)
7b. (IshikawHaak,nsan 2580m)
okuboi
7b, okuhoi (lshika Hwakau,san 2500m)
Tb. glabra
fo. pusiil assp, pusitra
7le }p.usill assp. a"striaca
f>'j.oponie(aShiga)
r?. j'crponi c(aIshika Srhwaaka,dake)
]: .iaponica CIshika Hwakau,san)
'7?,
(Yamagata)
J'apenica
7}" o.ccidentalis ssp. occidentalis g'gil-Sk
7}' o,ccidentalis ssp. hrevistyla
TY. giutinos a(USA :Alaska)
7>'. (USA:Idaho)
glutinosa
1)t racemosa (USA: Seuth Carolina)
T7. (USA:Alabama)
racemosa
T), racefnosa (USA :Florida)
71F: (Canada)
glutinosa
Harperocallisflava
f'lee atenuijZ)lia
FsG.1. Stric tconsensus of the 45 equally rfiost parsimenious trees resulting from th fplastid trnK, trnL
and trnL-k' and nuclear ITS DNA sequencc data of 71ij7etdi aand T>'ianih aN.umbers thbove the branehes indicatc bootstrap
values thut are expressed tts percentages or 1000 replictttes.
NII-Electronic Library Service
TThhee JJaapapnaesneSeosciee tySociety ffoorr PPllanatnSyts teSmaytslctsematics
138 A L t a P hv"totax Geobot Vol 60
't'' ''
rt#. '
tM
''
' tt 'tt ''' '"tt t' "llg 'F'l 'It '1'''.ttvtt- '
a A, t t . " st' ' bt} 'tt ,';l,'ykl'J" ttt ' ' K
'
?'
''
'
w't Htt
t{ti r 'tt t v tt . I t/t. ;t,)t'L・ TJtt'r''''t
' ttwtLtt-J t lt t t t L t't -)t
' r t
' "
v 'Ab
.
'
- E' tt
e .H tM' 'r t'i-
' t- tt' '''
'
w. 'i l t
'
1
t t
s. t]l" rsyl rvt - . r
ll l 'NL 'ttt
t
r ・ ' ''
va
;
'
'
J e
Fib 2 LoafapicesofspeLiebof7by7eldiaandspeLiegofT}ymntha A 7b F{akusan,2SOem(7lrmblia&buse
okuboitromMt
lf521 KYO) B Io okubottromMt Hakusan,2580m(7Limura& FugelfY9 KYO) C 7b glabm(}fotdenke 113 MO)
D&L lo pwhiUa subsp pusilla (17redgkild& 3B1a4)8,Me) F&G Tb cocc(neavar (occinea (Parker&Lipk 8t8n84,
MO) H fb co["necriai kondoi(1kemura19499, KYO) l fo nudo(7lamuradi Fuge15471 KYO) I Tb calycutata(WZi-
quet 82!90, MO) K T} 'Jcrponiea (7ttmt tacr1aleig e15528, KYO) L 77 occidentativgubsp brevts4)l a(71iomps of)n079,
MO) M Ir glutinosa fromUSA (Paik e)t190, MO) N J} 'gltitznos faioin Canada (B"eteier13 N9IJO)4 ,O 7} 'racemo
ga (ffi 2l38l88, MO)
NII-Electronic Library Service
TThheJea paJnaespeSaoncleestyefo rSPloacntiSyestteym atflcosr Plant Systematics
March2010 TAMuRA & AL.-Phylogcny ol' 7Qfietdi aand 1"riantha 139
''"il"' '"
'ltc,,・ ,・',1'/rI'SwI t.c1'{/',・ ',.,1' t''['ll
t tt /t x t""tt・i$,"・g・k'ts''z.g・・,il・i・ika・・t'・t・・,f;・・,・kt・g・,ri・'I,l'E・,gee.tstw
t .t t t.t . t. t
t
,1,ni-/,t lgass;lt,・i,[,'i,;・fE.st
/,; ./,
''.t..'t,tt.Lt/t.S t
[' ;n '.. ./ ,.."t ,-,' tt't'/tt ;t.
FiG. 3. Lear margins of speeies of TZijTeld iAa:. 7b. thibetica (L i3Y4, MO) xs・ith long needlc-1ike proeestse sB.: 7b. dive}'gens
(Bartholom &eL avt I470, MO) -ith hair-1i pkreocesses .C: n), yunnanensis (nfa n256, MO) with hair-1ik eprocesses .D:
7b coccinea var. kondoi (rlrmu ri9a499, KYO) with knobby proccsses .E: 7b, nudla (7lrtn u&r Faleig ie5471, KYO) without
preeesses Bar = 200 ym.
in various ways during the fioldwork. Our thanks are also Farris ,J, S., M. Kti11ereg 6A.. G. Kluge & C. Bult. 1994.
due to the director asnd staff members of the herbari aMO Testin gsignlficance of incongruencc. Cladistics IO:
and KYO for allowing us to examine specimens and to 315-3I9.
excise leaves from specimens, from which DNA was ex- Fujii ,N. & K. Senni. 2006. Phylogeography ot' Japanese
tracted. The study was supportcd in part b> ia Grant-in- alpine plant sb:iogeographi ictnportance of alpine re-
Aid fbr Scicntif iRecsearch (l55700 8f3ro)m the Ministry gien ofCentral Henshu in Japan 'faxon 55: 43 -52.
ofEducation, Scienc uand Culture, Japan. Fuse, S. & M. N. Tamura. 2000. A phylegenetic analysis
oftheplastidmatKgenewiLhemphasisonMelanLhia-
References ceae sensu lato, Plant Biol. 2: 415-427.
Johnson,L,A.& D.E,Soltis1,995.Phylogenetiicnt'er-
ences in Saxifragaceae sensw stncto and Gika (Pole-
Bogler, D. J. ,J. L. Neff & B. B. Simpsen. 1995. Multiple moniaceae) using matK sequences. Ann. M{ssouri
origins of the yucca-yucc amoth association. Proc. Bot, Gard. 82: 149-17S.
Natl. Acad. Sci.. USA 92: 6864-6g67. Kitamura,S.1964,Liliaceaei.n:Kitamura,S,,G.TVrurata
Chen, X.-Q. & M. N, Tamura. 2000. 7?zfietdi Iah.: Wu, Z.- & T. K"yama (eds ,C)o,loured Illustration osflterba-
Y. & P. H, Raven (cds. F)l,ora of China, vol. 24, pp. ceous P]ants ofJapan, vol. IIL pp. 90-157, Hoikusha,
76- 77. Sciencc Press, Bcijing, and Migsouri Botani- Osaka (i nJapanese),
eai Garden Press ,St ,Louis, Listen. A, & J, W. Kadereit. 1995. Chlorop]ast DNA evi-
Doyle, J. j. & J, L. Duyle. 1987. A rapid DNA isolation dence I'o rintrogression and long distanc edispersa iln
procedure fbr small quantitie sof fresh leaf tissue, the deser tannual Senecio ]7a), u(sAsterac ePalaen)t.
Phytochem. Bull ,19 :11-l5.
NNIII-IE-leEcltreoncitcronic Library Service
TThheJea paJnaespeSaoncieestye Society ffoorr PPllanatnt SSyystsetmaetmicastics
]40 ActaPhytetax.Gcobot. vol,6e
Syst. Evol. 197: 33-41. 392. Springer B,erlin.
Ohwi, J ,1953. Flora ofJapan, Sh{bundo ,Tokyo Ci nJapa- Tamura, M. N. Liiiacea ef.n: Iwatsul(i ,K., D. E. BoufTbrd
nese). & H. Ohba (eds .F)l,ora ef Japan, vol, IVb. Angio-
Ooi, K,, Y, Endo, J. Yokoyatna & N. Murakami. 1995, $permac: Monocotyledoneae. Kedansha, [[bky o(in
Useful primer design sto amplify DNA t'ragmen tosf press).
the plasti gdene matK frer nangiesperm plants J. ,Jap, Tamura, M. N., S. Fuse, H. Azuma & M. H'Eabsfeibeel. d2i0a0c4eaa.e
Bot. 70: 328-331. Biosystematic stuclies on the farnil y I.
Packet J, G. 2002. T)'iantha .In: Flora ofNorth America Phylogeny and ci rcum scrjptien of the ftLmily inferred
Edjtoria Clommittee (ed. )Fl,ora of North America, frem DNA sequences of neatK and rbcL. 1'lan tBiol .6:
vol. 26. pp. 61-64. 0xlbrd University Press ,Ne-・ 562・-567,
Ybrk. Tamura, M. N., J. Yamashita, S. Fuse & M. Haraguchi.
Satake .Y. 1982. LiLiacea ei.n :Satake ,Y., J. Ohwi, S. 2004b. Mo]ecular phylogeny of monocotyledons in-
Kitamura, S, Watari & T. Tominari (eds. W)i.ldF]ow- ferrcd fi'om combined analysis of plastid matK and
ers of Japan ,Herbacceus Plants ,vol, l ,pp. 21-51. rbcL gene sequences. J, Pl .Res. 117 :109-t20.
IIeibonsha, Tbkyo ({ nJapanese). Thorne, R. I; .1992. ClassificaLio na-d geography of the
Steele, K. P. & R. Vilgalys. 1994 .Phylogcneti canalyses flowerin gplants B.ot. Rev. 58: 225-348.
of Poiemoniaceae using nucleotide sequences ef the Utech, F. H. 2002. Liliaeeae .in: Flora ofNorth America
plastid gene matK. Syst ,BoL, 19 :126-142. Editori aClemmittee Ced. )F,lora efNorth Arnerica,
Swoffbrd, D. L. 2002. PAUP': Phylogenetic Analysis Us- vol. 26, pp, 50-347, Oxford University IPres sN,ew
{ng Parsimony ("an dOther Methods), Version 4.0 York.
bcta 10, Sinauer, Sunderland, White, T. J., T, Bruns, S. Lee & J, Tay]or. 1990. Arnplifi-
Tabcrlet, P,, L. Gielly. G. Pautou & J. Bouvet. 1991. Uni- cation and direc tsequencing of funga lribosomal
versal pri[ners for arnpLificaLion uf thrcc non-ceding RNA genes for phylogenetics. in: Innis, M., C. Gel-
regions of chloroplast DNA. Plant Molec. Biel, 17: fand .J. Sninsky & T. Wh"e (eds .PC)R, Protocol sA:
1105--1109. GuidetoMethedsandApplications,pp.315-322.Ac-
Takhtajan, A. 1997. Diversit yand C;lassifica tofiFolnow- ademic Press ,San Diego,
ering 1'Lant Cso.lumbia Uniyersit Pyress ,New York. Yamashita ,J. & M. N. Tamura. 2000. Melecu]ar phylog-
Tamura, M. N. 1998. NarLheciacea eI,h : Kubitzki, K. eny ot' the ConyaLlariace a(eAsparaga line: Wsi)ls,on,
(ed ,T)h,e Farnilie sand Genera ef Vascular Plants, K. L. & D. A. Morrison (eds, M)o,noeots: Systematics
vol. Ill .FLewering Plants M:onocotyledons ,pp, 381-- and Evolutio ,n pp. 387-400. CSIRO, Melbourne.
Received October 6, 2009; accqptedf`ltbruasly 2, 201O
NII-Electronic Library Service