Table Of ContentJournalofBiogeography(J.Biogeogr.)(2014)41,1414–1427
Assessing model sensitivity in ancestral
ORIGINAL
ARTICLE area reconstruction using LAGRANGE: a
case study using the Colchicaceae family
Juliana Chaco(cid:1)n* and Susanne S. Renner
DepartmentofBiology,UniversityofMunich, ABSTRACT
80638Munich,Germany
Aim Likelihood analyses of ancestral ranges require a parameterized model
that consists of a time-calibrated phylogeny, an ‘adjacency matrix’ of allowed
or forbidden area connections, and an ‘area–dispersal’ matrix with probabilities
for discrete periods of time. The approach is implemented in the software Lag-
range. Because it can incorporate information about past continental posi-
tions, the approach has been used in historical biogeographical studies of
relatively old clades. Surprisingly, no study has evaluated the interactions
among these input matrices. Here we use the lily family Colchicaceae and arti-
ficial data to study the relative effect of the input matrices on final estimates.
Location Africa, Australia, Eurasia, North America and South America.
Methods Using eight plastid, mitochondrial and nuclear DNA regions from
85 of the c. 280 species of Colchicaceae (representing all genera and the entire
geographical range) and relevant outgroups, we obtained a well-resolved phy-
logeny dated with a molecular clock. We then assigned species to six geograph-
ical distributions and carried out 22 Lagrange runs in which we modified the
adjacency and dispersal matrices, the latter with zero, two or four time periods
and one, three or five dispersal probabilities. For a second data set, the areas at
deep nodes in the empirical tree were modified by shuffling species distribu-
tions. Models were compared based on global log-likelihoods.
Results The adjacency matrix strongly determined the outcome, while time
slices and dispersal probability categories had minor effects. Ancestral areas
reconstructed at most nodes were unaffected by the different input matrices.
Colchicaceae are likely to have originated in Cretaceous East Gondwana, ini-
tially diversified in Australia (c. 67 Ma), reached southern Africa during the
Palaeocene–Eocene, and from there extended their range to Southeast Asia
(probably through Arabia) and then North America (through Beringia).
Main conclusions At least in small data sets, Lagrange models should be
tested with sensitivity analyses as carried out here, concentrating on con-
strained versus unconstrained adjacency matrices, and it should be good prac-
tice to report the set-up of both input matrices, not just the dispersal matrix,
which is the less decisive of the two.
Keywords
*Correspondence:JulianaChaco(cid:1)n,Systematic Adjacency matrix, ancestral area reconstruction, area–dispersal matrix, chron-
BotanyandMycology,UniversityofMunich,
ogram, Colchicaceae, geographical range evolution, Gondwana, historical bio-
MenzingerStr.67,80638Munich,Germany.
E-mail:[email protected] geographical methods, likelihood models, palaeogeography.
1414 http://wileyonlinelibrary.com/journal/jbi ª2014JohnWiley&SonsLtd
doi:10.1111/jbi.12301
Whento keepancestral area reconstruction models simple
willonlybepreferredoveradispersalscenarioifitiscongru-
INTRODUCTION
ent with the a priori accepted geological context (Ree et al.,
The rise of molecular clock dating as a tool in historical bio- 2005). An absence of expansion into another area could be
geographical analysis has been accompanied by the develop- just that or could be a result of extinction in that area; both
mentofnewmethodsofancestralareareconstruction(AAR). are captured by extremely low dispersal probability values. A
Themostsophisticated ofthesemethods,LikelihoodAnalysis user can build as many dispersal matrices for different
of Geographic Range Evolution or Lagrange (Ree et al., periodsoftime(‘timeslices’)asdeemedappropriate.
2005; Ree & Smith, 2008), is model-based and has been the The components described above imply that Lagrange
method of choice for deep-time biogeographical studies requires more ad hoc parameter values than other biogeo-
because it allows the incorporation of palaeogeographical graphical methods. Studies using the program have differed
data.Thisisachievedthroughthedispersal–extinction–clado- considerably both in model details and in the reporting of
genesis (DEC) model (Ree & Smith, 2008), which uses four model parameterization (Table 1 in Nauheimer et al., 2012,
components: (1) a fully resolved chronogram; (2) a species provides an overview). For example, studies have left adja-
distribution matrix denoting a species’ presence in a set of cency matrices unconstrained (Carlson et al., 2012) or con-
geographicalareas;(3)anadjacencymatrixspecifyingallowed strained (Clayton et al., 2009), but without testing how this
andforbiddenranges;and(4)anarea–dispersalmatrixspeci- interacted with the other input matrices or how an alterna-
fying dispersal probabilities between areas. The DEC model tive treatment would have impacted the global model likeli-
assumes that two stochastic processes underlie the range evo- hood. Similarly, the probability of dispersal between
lution ofaspecies in theabsence of lineage divergence: range Australia and South America during the Cretaceous (145–
expansionthroughdispersalbetweenareasandrangecontrac- 66 Ma) in different studies was assigned a probability of
tion through extinction within an area. Therefore all models P = 1 (Buerki et al., 2011: time slices before 60 and before
have two free parameters: a mean rate of dispersal between 80 Ma), P = 0.5 (Mao et al., 2012: time slice between 105
the areas i and j, Dij, and a mean rate of extinction in the and 70 Ma) or P = 0.01 (Nauheimer et al., 2012: time slices
area i, Ei (Ree & Smith, 2008). The likelihood function then of 150–90 Ma and 90–30 Ma). The number of probability
integrates over the conditional likelihoods of all ancestral categories also has differed from author to author, so far
statesateveryinternalnodeweightedbytheirpriorprobabil- ranging from five (Mao et al., 2012; P = 0.1, 0.25, 0.5, 0.75
ity (set by the user-defined input matrices), proceeding and 1)to three(Buerki et al., 2011;P = 0.01, 0.5and 1).
backwardsfromthetipsofthetreetoitsroot. We know of five studies that have attempted to use
As regards component (1), the input chronogram provides model comparison to assess model fit. A problem here is
the time-calibrated nodes and branches for which the proba- that there is no test statistic suitable for assessing the per-
bility of ancestor–descendant area change is calculated. formance of DEC models because they have the same num-
Component (2), the species distribution matrix, allows users ber of free parameters and are not hierarchically nested.
to define areas appropriate for their clade and research ques- Therefore, likelihood ratio tests or the Akaike information
tion, with the limitation that the number of biogeographical criterion (AIC) are not applicable (see Posada & Buckley,
parameters to estimate from the data increases exponentially 2004). As a workaround, workers have used the global like-
with the number of areas, decreasing the inferential power of lihood calculated by Lagrange to compare models and the
the model (Ree & Sanmart(cid:1)ın, 2009). Studies have used from rule that a two log-likelihood unit difference between mod-
three to 15 geographical areas (see Table 1 in Nauheimer els indicates significance (Edwards, 1992). Using this
et al., 2012), seeking a balance between the dispersion of tips approach, Couvreur et al. (2011) and Baker & Couvreur
[species] across areas (hence the potential inferred ‘area (2013) found that their models with zero time slices were
switches’ at nodes deep in the tree) and the risk of having significantly more likely than constrained models with five
manysingletons(areasoccupied byasingle tiptaxon).Com- time slices. In a large data set of Cupressaceae, Mao et al.
ponent (3), the adjacency matrix, is a presence–absence (2012) similarly compared the likelihoods of models with
matrix in which a user defines composite ranges allowed or four, five, six, seven or eight time slices. The migration
forbiddeninthemodel(forexample,thecombinedcontinent probabilities ranged from 0.1 for well-separated areas to 1.0
LaurasiabutnotacombinedAsiaandAustralia).Itissimilar for contiguous landmasses. They found that the most com-
to the cost matrix used in the program diva (Ronquist, plex (eight-time-slice) model had the best global likelihood.
1997),except that diva does nothaveaconfiguration option By contrast, in a large Araceae matrix, the likelihood of a
for excluding discontinuous ranges. For component (4), the simpler (three-time-slice) model was higher than that of a
area–dispersalmatrix,theuserspecifiesvalues(suchas1,0.5, more complex (four-time-slice) model (Nauheimer et al.,
0.01 or 0) for dispersal probabilities between areas based on 2012). The only studies to test the effects of constrained
prior notions about range expansion. These values become and unconstrained adjacency matrices are an analysis of
area-specific scaling factors for the program’s calculation of Psychotria in Hawaii (Ree & Smith, 2008) and one of
the average rate of dispersal. Vicariance scenarios are not Cyrtandra in the Pacific Islands (Clark et al., 2008); both
favoured a priori. If descendants are restricted to separate found that a constrained matrix fitted the data better than
areas of the ancestral range, a vicariant speciation scenario an unconstrained one.
JournalofBiogeography41,1414–1427 1415
ª2014JohnWiley&SonsLtd
J.Chaco(cid:1)nandS.S. Renner
To advance the field of likelihood-based historical bioge- (Vinnersten & Reeves, 2003; Vinnersten & Manning, 2007;
ography, we decided to investigate the interactions among del Hoyo & Pedrola-Monfort, 2008; Persson et al., 2011),
the input matrices, number of time slices, dispersal probabil- while the best circumscription of Wurmbea is still unclear
ity categories, and node/area/time slice ratio in an empirical (Thi et al., 2013). None of these studies included balanced
data set and an artificial one. The lily family Colchicaceae and dense species sampling of the largest problem genera
constitutes a suitable group for this purpose owing to its Colchicum and Androcymbium.
almost worldwide geographical distribution and the availabil- The approach taken in this study was to conduct experi-
ity of a well-supported dated phylogeny (Chaco(cid:1)n et al., in ments in Lagrange with different adjacency matrices, area–
press). This family of c. 280 species in 15 genera is distrib- dispersalmatrices,dispersalprobabilitiesandtimeslicesusing
uted in Africa, Eurasia, Australia and North America, while twodatasets:atime-calibratedphylogenyfortheColchicaceae
being notably absent in Central and South America (Fig. 1; and an experimental data set, with the same input topology
see Nordenstam, 1998). Strictly African genera are Baeometra but geographical assignment of tips [species] reshuffled. This
(one species), Camptorrhiza (two species), Hexacyrtis (one increasedareadispersionacrosstaxa,whichallowedustoeval-
species), Ornithoglossum (eight species) and Sandersonia (two uatetheeffectonLagrangeresultsofadatasethavingmore
species); strictly Australian genera are Burchardia (six spe- switchesintheancestralareasatdeepernodes.Acriticalevalu-
cies), Kuntheria (one species), Schelhammera (two species) ation of the pitfalls and strengths of maximum likelihood-
and Tripladenia (one species). Disporum (20 species) is based ancestral area reconstruction could be useful in two
native to Asia, and Uvularia (five species) is restricted to ways. First, there is insufficient awareness of which prior
North America. Four genera have disjunct geographical dis- (user-defined) matrices determine the results and which are
tributions: Iphigenia (12 species) occurs in Africa, India and less important. Second, input matrices can be (and have
Australasia; Gloriosa (10 species when including Littonia) in been) used by successive studies of clades of similar ages and
Africa, India and Southeast Asia; Colchicum (c. 157 species geographical distribution. For example, essentially the same
when including Androcymbium, Bulbocodium and Merendera; connectivity matrices were used in studies of Pinaceae,
Manning et al., 2007) in the southern and northern parts of Sapindaceae and Araceae (Moore & Donoghue, 2007: Fig. 7;
Africa, the Mediterranean and Eurasia; and finally Wurmbea Havillet al.,2008;Buerkiet al.,2011;Nauheimeret al.,2012;
in Australia (c. 30 species) and southern Africa (20 species, Lockwoodet al.,2013).
when including the monospecific genera Onixotis and Neo-
dregea; Vinnersten & Manning, 2007). The sister family of
MATERIALS AND METHODS
the Colchicaceae are the Alstroemeriaceae, a family of 200
species, allintheNeotropics(Fig. 1)exceptforthreeinAus-
Taxonsampling
tralia and New Zealand (Chaco(cid:1)n et al., 2012). Previous
molecular-phylogenetic work on the Colchicaceae confirmed We obtained DNAsequences from 85 ofthe c.280 species of
the non-monophyly of the genera Gloriosa and Colchicum Colchicaceae representing all genera and the geographical
Figure 1GeographicaldistributionofColchicaceae(darkgrey)andtheirsisterfamily,Alstroemeriaceae(lightgrey).Onlythreespecies
ofAlstroemeriaceaearefoundineasternAustraliaandNewZealand(black),wherec.13speciesofColchicaceaealsooccur.
1416 JournalofBiogeography41,1414–1427
ª2014JohnWiley&SonsLtd
Whento keepancestral area reconstruction models simple
range of the family. As outgroups, we used five species of materialwithspecies namesandauthors,geographical origin,
Alstroemeriaceae and Petermanniaceae, the latter a mono- herbariumvoucherspecimenandGenBankaccessionnumbers
typic family (Petermannia cirrosa) of rhizomatous woody islistedinAppendixS1intheSupportingInformation.
climbers restricted to temperate rain forests in eastern Aus-
tralia (Conran & Clifford, 1998; Petersen et al., 2012). Eleven
DNA extraction,amplification andsequencing
additional outgroups from the Liliales, belonging to the fam-
ilies Campynemataceae, Liliaceae, Melanthiaceae, Philesia- TotalDNAwasextractedfrom20 mgofdriedleaftissueusing
ceae, Ripogonaceae and Smilacaceae, were included in the theNucleospinPlantIIkit(Macherey-Nagel,Du€ren,Germany).
dating analyses (see below). Our ingroup sampling consisted Theconcentration andpurityoftheresultingDNAwasmea-
of 36 of the c. 157 species of Colchicum L. representing the suredinaNanodrop2000UV-VisSpectrophotometer(Thermo
whole geographical range, the only species of Baeometra FisherScientificInc.,Wilmington,NC,USA).Thechloroplast
Salisb. ex Endl. (Baeometra uniflora (Jacq.) G.J.Lewis), the six genesndhF,matKandrbcL,themitochondrialmatR,andthe
species of Burchardia R.Br., one of the two species of Camp- completenuclearribosomalinternaltranscribedspacerregions
torrhiza Hutch., four of the 20 species of Disporum Salisb. ex (ITS) were amplified using the primers listed in Table 1. The
G.Don., three of the 10 species of Gloriosa L., the only spe- PCRconsistedofaninitialdenaturationstepat94 °C 9 3 min,
cies of Hexacyrtis Dinter (H. dickiana Dinter), four of the 12 followedby35cyclesofamplificationwithanannealingstepat
species of Iphigenia Kunth, the only species of Kuntheria 50–56 °C 9 1 min, and a final extension at 72 °C 9 7 min.
Conran & Clifford (Kuntheria pedunculata (F.Muell.) Conran ForthemitochondrialmatRthedenaturationwasperformedat
& Clifford), six of the eight species of Ornithoglossum Salisb., 94 °C 9 2.5 min, and for ITS at 95 °C 9 5 min. Additional
theonlyspeciesofSandersoniaHook.(Sandersoniaaurantiaca sequences from the chloroplast regions atpB–rbcL, rps16 and
Hook.), one of the two species of Schelhammera R.Br., the trnL–FwereobtainedfromGenBank.TheamplifiedDNAwas
only species of Tripladenia D.Don (Tripladenia cunninghamii sequencedusingBigDyeTerminatorv.3.1CycleSequencingKit
D.Don), three of the five species of Uvularia L., and 16 of andanABI3100Avantcapillarysequencer(bothfromApplied
thec.50 species ofWurmbea Thunb. Biosystems,Inc.,Warrington,UK).Sequenceswereassembled
A recent phylogenetic study of the Colchicaceae, focusing in Sequencher 5.1 (Gene Codes, Ann Arbor, MI, USA) and
on chromosome number evolution (Chaco(cid:1)n et al., in press), alignedinmafft 5.64(Katoh &Standley, 2013)withmanual
includedallavailableGenBanksequencesofColchicum(i.e.41 adjustmentinMacClade4.8(Maddison&Maddison,2002).
species previously placed in Androcymbium and 96 species of AllsequenceswereBlast-searchedinGenBanktoexcludethe
Colchicum)andshowedbeyonddoubtthatthetypespeciesof possibilityofcontamination.
Androcymbium, A. melanthioides (C. melanthioides), is more
closelyrelatedtospeciesofColchicumthanitistomanyspe-
Phylogeneticanalyses andmolecularclock dating
ciestraditionallyplacedinAndrocymbium.ThissupportsMan-
ning et al.’s (2007) sinking of Androcymbium into Colchicum, Thecombinedplastid,mitochondrialandnuclearmatrixcom-
and we therefore accept these authors’ species nomenclature. prised102taxa(86accessionsof85ingroupspecies,sincewe
Note that species and marker sampling in Chaco(cid:1)n et al. (in includedsequencesfromtwospecimensofColchicumcuspida-
press) and the present study are not identical. All sampled tum)and6451alignednucleotideregions.Totestcongruence
Table 1Listofprimersandamplificationconditionsforthegenessequencedinthisstudy.
Region Location Primername Primersequence(50–30) Reference
ndhF cp 972F(Fw) GTCTCAATTGGGTTATATGATG Olmstead&Sweere(1994)
1318F(Fw) GGATTAACYGCATTTTATATGTTTCG Olmstead&Sweere(1994)
1318R(Rv) CGAAACATATAAAATGCRGTTAATC Olmstead&Sweere(1994)
1603R(Rv) GCATAGTATTGTCCGATTCATRAG Olmstead&Sweere(1994)
rbcL cp 1F(Fw) ATGTCACCACAAACAGAAA Lledo(cid:1)etal.(1998)
Z427S(Fw) GCTTATTCAAAAACTTTCCAA Johansen(1997)
Z427Rs(Rv) TTGGAAAGTTTTTGAATAAGC Johansen(1997)
724R(Rv) TCGCATGTACCTGCAGTAG Lledo(cid:1)etal.(1998)
matK cp AF(Fw) CTATATCCACTTATCTTTCAGGAGT Yokoyamaetal.(2000)
R3(Rv) GGTATTAATACATCTGACACATAAT Yokoyamaetal.(2000)
matR mt F1(Fw) AAGCCCTCGAGCCTCCTTTG Barkmanetal.(2007)
R1(Rv) GCAGTTATATGGATACGGTGC Barkmanetal.(2007)
ITS nr ITS1(Fw) TCCGTAGGTGAACCTGCGG Baldwin(1992)
ITS2(Rv) GCTGCGTTCTTCATCGATGC Baldwin(1992)
ITS3(Fw) GCATCGATGAAGAACGCAGC Baldwin(1992)
ITS4(Rv) TCCTCCGCTTATTGATATGC Baldwin(1992)
ITS,internaltranscribedspacerregion;cp,chloroplast;mt,mitochondrial;nr,nuclearribosomal.Fw,forward;Rv,reverse.
JournalofBiogeography41,1414–1427 1417
ª2014JohnWiley&SonsLtd
J.Chaco(cid:1)nandS.S. Renner
amongtheDNAregions,apartitionedanalysiswasconducted ing Luzuriaga, namely the number of vein orders, the shape
in raxmlGUI 1.0 (Silvestro & Michalak, 2012) using the andtextureoftheepidermalcells,andtheshapeanddistribu-
‘per-partitionbranchlength’optionundertheGTR+Gsubsti- tion of the stomata on the adaxial surface. However, other
tutionmodel,whichhadbeenfoundasthebestfitforeachof characters also resemble living species of Drymophila, such as
the three data partitions with FindModel (http://www.hiv. the presence of undifferentiated adaxial vein cells and the
lanl.gov/content/sequence/findmodel/findmodel.html), which proximal vein convergence with respect to the mean vein of
implementsPosada&Crandall’s(1998)Modeltest,usingthe the lamina (Conran et al., 2014), indicating that this fossil
Akaikeinformationcriterion.Statisticalsupportfornodeswas constrainstheageofthestemnode,notofthecrownnodeof
assessed by 1000 maximum likelihood (ML) bootstrap repli- Luzuriaga. Absolute ages for geological periods are from
cates under the same model. The tree resulting from this test Walker & Geissman (2009), and estimated node ages were
was compared with the ML phylogeny of Colchicaceae from checked against estimates from larger monocot data sets that
thestudyofChaco(cid:1)net al.(inpress). did not use exactly the same fossil constraints as those used
Molecular clock analyses were conducted in the Bayesian here(Janssen&Bremer,2004).
program beast 1.7.5 (Drummond et al., 2006; Drummond
& Rambaut, 2007), using the same matrix and substitution
Ancestral area inference for theempirical
model. As before, a partitioned test (with independent rates
andartificial data sets, andmodel choice
for the plastid, mitochondrial and nuclear data) was also
conducted in beast by unlinking the partitions in BEAUti Geographicalareasweredelimitedbasedonthecurrentdistri-
1.7.5 (part of the beast package). We used an uncorrelated butionrangesofthesequencedspeciesofColchicaceae,Alstro-
lognormal relaxed clock model and a Yule process tree prior. emeriaceae and Petermanniaceae, with the information
The length of the Markov chain Monte Carlo (MCMC) was coming from herbarium vouchers and taxonomic revisions
set to 90 million generations with parameters sampled every (Wilbur,1963;Macfarlane,1987;Yadavet al.,1993;Nordal&
1000 generations and a burn-in of 10%. Two beast runs Bingham,1998;Nordenstam,1998;Mu€ller-Doblies&Mu€ller-
were performed to assess the convergence of the results. A Doblies,2002;Persson,2007).Thesixareaswere:A,southern
‘maximum sum of clade credibility’ tree with mean node toequatorialAfrica,whichisanimportantcentreofColchica-
heights was computed in TreeAnnotator 1.7.5 (part of the ceae species diversity in the genera Baeometra, Camptorrhiza,
beast package) withaposterior probabilitylimit of0.9. Gloriosa, Ornithoglossum, Sandersonia, Wurmbea (together at
Weappliedfourcalibrationpoints,threeofthemfromfos- least20species)andColchicum;B,Mediterranean/Irano-Tura-
sils.Therootofthephylogenywassetto117millionyearsago nianregion,wherec.100speciesofColchicumoccur(Persson,
(Ma) with a normal prior distribution and 95% confidence 2007),andwhichcomprisessouthernEurope,northernAfrica,
interval (SD 0.5; confidence interval, CI, 116.2–117.8 Ma) Anatolia, parts of Jordan, Syria, the Israeli-Palestinian region,
based on Janssen & Bremer’s (2004) estimate for the crown the Sinai Peninsula, upper Mesopotamia, a large part of the
groupoftheLiliales.Agammapriordistributionwasusedfor ArmenianHighlands,southernandeasternTranscaucasia,the
thethreefossilcalibrationsasfollows:thecrownnodeofSmi- CaspianshoreofIran,theIranianPlateau(excludingthetrop-
laxwassetto41 Ma(shape2.0,scale3.5andoffset36.3 Ma), icaldeserts),thewesternmostHimalayas,andthearidterritory
which represents a conservative minimal age, given that Smi- ofsouth-easternEuropeanRussiatotheGobidesert(Takhta-
lax-like fossils are known from the early Eocene (48.6– jan,1986);C,AustraliaandNewZealand,centresforBurchar-
55.8 Ma; Edelman, 1975; Wilf, 2000) and the middle Eocene dia, Kuntheria, Schelhammera, Tripladenia, Wurmbea
(37.2–48.6 Ma; MacGinitie, 1941; Wilde & Frankenhauser, (together c. 30 species) and Iphigenia (I. novae-zelandiae), as
1998). The crown age of the monotypic family Ripogonaceae wellastheoutgroupgeneraPetermannia,DrymophilaandLuz-
wassetto51 Ma(shape2.0,scale0.6andoffset50.0)basedon uriaga (L. parviflora; Conran & Clifford, 1998); D, Asia and
leaf macrofossils of Ripogonum from Tasmania dated to 51– Southeast Asia, centres for Disporum and Iphigenia (10 spe-
52 Ma (Conran et al., 2009). The fossil corresponds to the cies),Gloriosa,andtosomeextentColchicum;E,easternNorth
extinct species Ripogonum tasmanicum Conran, R.J.Carp. & America,whereUvulariaisendemic;andF,SouthandCentral
G.J.Jord., which presents features of the living species of Ri- America, where the outgroup genera Alstroemeria, Bomarea
pogonum(suchaspresenceofbrochidodromousvenationpat- andthreeLuzuriagaspeciesareendemic(Chaco(cid:1)net al.,2012).
tern, five major leaf veins, variously oriented stomata, and To study the effect of the Lagrange model components,
strong adaxial anticlinal sinuosity) and that are absent from we designed experiments that modified the adjacency matrix,
themostcloselyrelatedgeneraPhilesiaandLapageria(Conran the number of time slices, and the dispersal probabilities in a
et al.,2009).ThestemnodeoftheLuzuriagacladeintheAl- hierarchically structured manner, resulting in a total of 22
stroemeriaceaewassetto22 Ma(shape2.0,scale0.3andoffset experiments (11 for the Colchicaceae data set and 11 for the
21.4 Ma),basedontheageofaLuzuriaga-likeleaffossilfrom artificial data set, see below). A graphical overview of the
theFouldenMaardepositsnearOtago,NewZealand,datedto experiments is shown in Fig. 2 and their settings and
c.23 Ma(Conranet al.,2014).Theresupinationofthepetiole rationale are described in the next paragraphs. The version
of this fossil places it in the Alstroemeriaceae, and additional of Lagrange used in this study was 20130526, and the
morphological and anatomical features resemble those of liv- chronogram obtained in beast (see previous section) was
1418 JournalofBiogeography41,1414–1427
ª2014JohnWiley&SonsLtd
Whento keepancestral area reconstruction models simple
Figure 2Flowdiagramdepictingthe22
experimentsconductedinLagrangeforthe
empiricalColchicaceaedataandthe
artificialdata.
the starting component of the analyses. The artificial data set (CE),Asia–SouthAmerica(DF).BecauseColchicaceaespecies
consisted of the same Colchicaceae chronogram except that allhaverelativelynarrownaturalranges,welimitedthemaxi-
the tips were recoded such that both old and young nodes mumnumberofancestralareasatnodestotwo.
in the tree would be affected: seven Australian species In the next step, we defined the area–dispersal matrices,
(Wurmbea australis, W. biglandulosa, W. centralis, W. dioica, which specify the dispersal probabilities between areas during
W. murchisoniana, W. pygmaea and W. saccata) were coded specificperiodsoftime(timeslices).Toassesstheeffectofthe
as North American and nine Australian species (the six number of slices, we designed three area–dispersal matrices
Burchardia species, Schelhammera undulata, Kuntheria pe- with 0, 2 or 4 time slices (Fig. 2, Appendix S2a). The zero-
dunculata and Tripladenia cunninghamii) as African. By time-slice scheme comprised the entire time between 120 Ma
including a data set with artificially reshuffled species ranges and the present and contained all 86 nodes (Appendix S2b).
we were able to test the effect of geographical dispersion or The two-time-slice scheme was designed such that similar
clusteringofthetips, whichwill affecttheplausibilityofgeo- numbersofnodeswereincludedpertimeslice.Thus,thetime
graphical‘switches’ deeper in thetree(see Introduction). slice between 0 and 10 Ma contained 37 nodes, and the time
As the first experimental step, we used either an uncon- slice between 10 and 120 Ma contained 49 nodes (Appendix
strainedadjacencymatrixinwhichallrangeconnectionswere S2b). The four-time-slice scheme reflected major palaeogeo-
permitted (‘1’ in all fields of the matrix) or a constrained graphicalchangesduringthehistoryofColchicaceaeandcon-
matrixinwhichareasconnectedatleastonceoverthelast120 tained a highly unbalanced number of nodes per slice; 0–
millionyearsreceivedavalueof‘1’,othersa‘0’(Fig. 2).This 30 Ma(collisionoftheAustralianPlatewithEurasia;Antarctic
is based on the assumption that Colchicaceae, like all organ- Circumpolar Current established) with 74 nodes, 30–60 Ma
isms, have a lower ability to disperse over non-adjacent areas with nine nodes (Drake Passage opens between the Antarctic
thanadjacentareas.Forthatreasonthefollowingrangeswere PeninsulaandsouthernSouthAmerica;TethysSeacloses;North
forbidden: Africa–Australia (AC), Africa–Asia (AD), Mediter- Atlanticlandbridgestillavailable:Tiffney&Manchester,2001),
ranean/Irano-Turanian–Australia (BC), Mediterranean/Irano- 60–80 Ma (the Australian and Antarctic territories of East
Turanian–South America (BF), Australia–North America Gondwana still linked to South America in West Gondwana
JournalofBiogeography41,1414–1427 1419
ª2014JohnWiley&SonsLtd
J.Chaco(cid:1)nandS.S. Renner
acrosstheAntarcticPeninsula)withtwonodes,and80–120 Ma in Table 3. Models using an unconstrained adjacency matrix
(breakupofWestGondwana)withonenode(AppendixS2b). (MC0 to MC4 for the Colchicaceae and MA0 to MA4 for
The last experimental step involved dispersal matrices with the artificial data set) were significantly (more than two log-
varying numbers of dispersal probability categories: one with likelihood units) more likely than models that used a con-
P = 1.0 (one category), one with P = 0.01, 0.5 and 1.0 (three strained adjacency matrix (MC5 to MC10 for the Colchica-
categories), and one with P = 0.1, 0.25, 0.5, 0.75 and 1.0 ceae and MA5 to MA10 for the artificial data set; Table 3,
(five categories; seeFig. 2). A low valuewas assigned to non- Figs 2–4). The best model for the Colchicaceae data set was
neighbouring areas, a medium value for partly connected MC4 (Table 3), which used an unconstrained adjacency
areas, and a high value for connected or neighbouring areas. matrix, four time slices and five categories of dispersal prob-
For the four-time-slice matrices with three categories of dis- abilities (Fig. 2). Ancestral areas inferred under this model
persal probabilities, we employed the probability values of with a probability ≥ 0.5 are shown in Table 2 and Fig. 3.
Buerki et al. (2011), while for the five categories of dispersal The best model for the artificial data set was model MA4,
probabilities we followed Mao et al. (2012). For the two- which is equivalent to MC4 for the empirical data (see Fig. 2
time-slice matrices, we averaged the probability values of the and Table 3). Models with the worst likelihood scores were
oldest and youngest bins from these two studies. For zero- MC5 and MC9 (for the Colchicaceae, with the same –lnL
time-slice matrices, we used the corresponding adjacency score) and MA9 (for the artificial data set), which used a
matrices and replaced the zeros either with P = 0.01 (for the constrained adjacency matrix with zero time slices (MC5) or
three categories of dispersal probabilities) or with P = 0.1 four time slices (MC9) and three categories of dispersal
(for the five categories of dispersal probabilities). All area– probabilities (Fig. 2).
dispersal matricesused areshown inAppendix S2a. There was no correlation between likelihood scores and
To assess models, we compared their global log-likelihood number of time slices in either data set (Table 3). For
(as given by Lagrange) and used the standard cut-off value instance, using the empirical data, the likelihood score of
of two log-likelihood units as indicating a significant differ- MC1 with two time slices was better than that of MC3 with
ence between models, with the less negative likelihood being four time slices (–lnL 110.3 vs. 113.8, respectively). However,
preferred (Edwards, 1992). the opposite was true for MC2 with two time slices com-
paredto MC4 withfourtime slices (–lnL108.8vs.107.9).
In both data sets (real Colchicaceae data and experimen-
RESULTS
tally modified data) the number of dispersal probability cate-
gories affected model likelihood, but not area reconstructions
Molecular phylogeny and chronogramof
(Table 3, Appendix S3), and among models that only dif-
theColchicaceae
fered in this parameter (MC1 vs. MC2, or MC7 vs. MC8)
Thepartitionedanalysesshowednoincongruencesamongthe those with five dispersal probability categories (P = 0.1, 0.25,
nuclear, plastid and mitochondrial data, and only minor dif- 0.5, 0.75 and 1.0) had significantly better likelihoods than
ferenceswerefoundintheagesestimatedfromthethreedata thosewiththree categories (P = 0.01, 0.5and1.0;Table 3).
partitions. A dated phylogeny is shown in Fig. 3. Topologi- With regard to the inferred rates of dispersal, the lowest
cally,itiscongruentwiththetreeobtainedbyThiet al.(2013, rates were estimated under models MC0 and MA0 and the
with70speciesofColchicaceaeasopposedto85here)except highest under models MC10 and MA10 (Table 3). For the
forthepositionofBurchardia,whichinourtreeformsthesis- extinction rate, the lowest value was estimated under MC2
ter clade to all remaining Colchicaceae, while in theirs it is for the Colchicaceae and MA0, MA1 and MA4 for the artifi-
nested higher up.The meanages for well-supported nodesof cial data set (Table 3). A plot of the global likelihood scores
biogeographicalinterestareshowninTable 2.Themostrecent and dispersal and extinction rates show that inferred dis-
common ancestor of the Colchicaceae started diversifying c. persal rates are generally higher than extinction rates
67 Ma(95%HPD:54–82 Ma),andthefirst-diverginglineage (Fig. 5).
is Burchardia, which diversified in Australia starting at c. Ancestral areas reconstructed at most nodes were unaf-
23 Ma (95% HPD: 12–37 Ma). The Colchicaceae then split fected by the different input matrices (Appendix S3a). Con-
into two clades, an Asian/North American clade formed by flicting reconstructions with P ≥ 0.5 were only obtained for
Disporum/Uvularia, the split of which is dated to c. 29 Ma nodes N179, N178 and N157 (Tables 4 & 5), and the geo-
(95%HPD:15–46 Ma),andacladeformedbytheremaining graphical placement of the root of the Colchicaceae (N191)
Australian and African species, which started diversifying c. was not resolved under any model (Table 6). The node with
56 Ma(95%HPD:45–69 Ma)(Table 2). the highest number of alternative ancestral areas inferred
(with P ≥ 0.5) was N178 (Table 5, Fig. 3). At this node and
at node N157, Lagrange inferred areas that include South
Resultsof theLAGRANGE experiments
America (area F), where no Colchicaceae occur today. Mod-
Theancestralrangesandprobabilitiesinferredinthe22Lag- els MC0, MC1 and MC2 led to the least ambiguous results
rangeexperiments areshowninAppendix S3andtheglobal (Table 5),whileMC6andMC8resultedinthegreatestnum-
likelihood scores ((cid:2)lnL), dispersal rates and extinction rates ber of ambiguously reconstructed ancestral areas. In our
1420 JournalofBiogeography41,1414–1427
ª2014JohnWiley&SonsLtd
Whento keepancestral area reconstruction models simple
Figure 3ChronogramofColchicaceaeinferredfromchloroplast,mitochondrialandnuclearribosomalDNAsequencesfor85ingroup
speciesand16outgroups,amongthemAlstroemeriaceaeandPetermanniaceae,with95%confidenceintervalsfornodeages(greybars)
andancestralareasinferredinLagrange(colouredsquares).Thesquaresizeisproportionaltotheprobabilityofthereconstructions
(seeP-valuesinTable 2).TherootofColchicaceae(N191)wasnotresolvedinanyLagrangeexperiment,asindicatedwithaquestion
markonthisnode(seeTable 6).Alternativeancestralareasobtainedwithdifferentmodelsareshowninsidetheovals(seeTable 4).
Theblackcirclesindicatethecalibrationnodesusedinthedatinganalyses.
JournalofBiogeography41,1414–1427 1421
ª2014JohnWiley&SonsLtd
J.Chaco(cid:1)nandS.S. Renner
Table 2Meannodeages(Ma)and95%highestposterior thehighestgloballikelihood scorewasMC4(Table 3),which
densityinterval(HPD)obtainedfortheColchicaceae(seeFig. 3 used an unconstrained adjacency matrix, four time slices and
forthelocationofnodes).Theancestralareasinferredwitha fivecategoriesofdispersalprobabilities(Fig. 2).Therewereno
probability≥0.5withthebest-fitmodel(MC4)inLagrange
significant differences in global likelihood and dispersal and
arealsoshown.
extinction rates between the empirical Colchicaceae data and
Node Age(95%HPD) Ancestralrange theartificialdataset(Figs 4&5)showingthattheshufflingof
areas (and therefore changes in the extent of area clustering)
N201 105.6(89.4–117.6) [C|C]0.91 did not affect the output of Lagrange, at least not in this
N199 86.5(70.8–101) [C|C]0.65
N191 67.3(54–82.1) n.a. small experiment. The likelihood score is calculated from the
N190 22.9(11.6–36.6) [C|C]1.00 fractionallikelihoodsatpointsalongbranchesintersectingthe
N179 64.2* [C|E]0.55 boundaries of a time slice, coupled with the likelihoods of
N178 56.4(44.6–68.8) [A|C]0.70 rangeinheritancescenarios(dispersalorextinction)atlineage
N177 19.6(6.2–36.8) [C|C]1.00 divergence points (Ree & Smith, 2008). This means that the
N172 48(37.7–59.4) [A|A]0.70
number of time slices and of dispersal probability categories
N171 42.9(32.6–53) [A|A]0.69
willaffecttheoveralllikelihoodscoreandtheaverageratesof
N170 22.4(10.6–35.4) [A|A]0.66
N169 10.4(3.2–19.4) [A|A]0.59 dispersalandextinction,butnottherange-inheritancescenar-
N161 37.5(27.9–47.1) [A|A]0.95 ios,whichareaffectedonlybytheconstraintsimposedbythe
N160 32.7(23.7–42.2) [A|A]0.95 adjacencymatrix.Thisisexactlywhatwefound.
N159 30.8* [A|A]0.93 InboththeempiricalColchicaceaedataandtheartificialdata
N158 29.2* [A|A]0.87 set,thehighestlikelihoodscores(Table 3)andfewestambigu-
N157 25.6(17.8–33.3) [A|C]1.00
ous AARs (Table 5) were obtained with unconstrained adja-
N156 13.6(6.8–20.6) [C|C]1.00
cencymatricesinwhichallrangeswereallowed,meaningthat
N143 17.57(11.0–24.7) [A|A]1.00
N128 43.3(32.9–54.2) [A|A]1.00 allrowsandcolumnsintheadjacencymatrixweremultiplied
N127 34.6(25.5–44.1) [A|A]0.99 withthearea-specificscalingfactorsfromthedispersalproba-
N126 25.5(15.7–36.1) [A|A]1.00 bilitymatrix.Ourconstrainedadjacencymatrices,bycontrast,
N125 19.0(9.9–28.7) [A|A]1.00 forbidcertainranges,resultinginamultiplicationofarea-spe-
N113 32.3* [A|A]0.99 cific scaling factors by ‘0’ (this being the value for forbidden
N112 25.5(17.7–34.1) [A|A]0.87 ranges).Inourcase,theforbiddenrangeswereAfrica–Australia
N111 19.4(11.8–26.8) [A|A]0.97 (AC), Africa–Asia (AD), Mediterranean/Irano-Turanian–Aus-
N110 16.8* [A|A]0.91
N108 9.6(3.7–16.3) [AB|B]0.99 tralia (BC), Mediterranean/Irano-Turanian–South America
N88 22.1* [A|A]0.64 (BF),Australia–NorthAmerica(CE)andAsia–SouthAmerica
N81 17.6(11.2–22.3) [B|B]0.67 (DF)basedontherationalethattheseareashavenotbeencon-
N38 20.7(6.2–36.8) [A|A]1.00 nectedinthepast120millionyears(seeMaterialsandMeth-
N33 28.8(14.5–45.5) [D|E]1.00 ods). It so happens, however, that nodes 178 and 157 in our
N32 15.1(5.9–26.2) [E|E]1.00
treebothinvolvesplitsinvolvingtheforbiddenACrange(Aus-
N27 7.0(1.8–13.5) [D|D]1.00 tralian/African Wurmbea in N157; Australian Tripladenia–
*Theconfidenceintervalfortheseagesisbelow95%. Kuntheria–Schelhammera versus an African clade in N178).
n.a.,notapplicable. Lagrange therefore ‘looked’ for other areas to combine as a
possibleancestralrange,oneofthembeingAfrica/SouthAmer-
empirical data set, these ambiguous results were strikingly ica (AF; the former West Gondwana). The finding that an
concentrated in the model that used the constrained adja- unconstrained adjacency matrix had the highest global likeli-
cency matrix (Fig. 2,Table 4). hoodscoreisthusapplicableonlytoourdata.Intheonlyother
study in which the effects of constrained and unconstrained
adjacency matrices have been compared, the constrained
DISCUSSION
matrix had a higher global likelihood than the unconstrained
one (as assessed by the two log-likelihood difference; Ree &
Therelative effects of theapriori components
Smith, 2008). Clearly, users of Lagrange should be aware of
inLAGRANGE
thedecisiveeffectoftheadjacencymatrixandideallystudythe
The results of the 22 experimental runs demonstrate, as sensitivityoftheirresultstotheassumptionsmadewhenper-
expected, that the Lagrange results are sensitive to the user- mittingorforbiddingancestralrangesinanyspecificcase.
defined model parameters, especially the adjacency matrix
(Table 3; see Fig. 2 for model details). The area–dispersal
Thebiogeography of Colchicaceaebased
matrixandthedispersalprobabilities,bycontrast,havenegli-
onthemost likelymodel
gibleeffects (inboththeempirical andtheartificialdataset),
and at least in our data, the AARs at most nodes were unaf- Maximum likelihood-based ancestral area reconstruction
fectedbytheuser-definedaprioriparameters.Themodelwith (AAR) requires a fully resolved chronogram (Ree & Smith,
1422 JournalofBiogeography41,1414–1427
ª2014JohnWiley&SonsLtd
Whento keepancestral area reconstruction models simple
Table 3Globalmaximumlikelihoodscores((cid:2)lnL)attherootnodeanddispersalandextinctionratesestimatedintheLagrange
experimentsfortheempiricalColchicaceaedataandtheartificialdataset(seeFig. 2formodeldetails).Intheexperimentsthe
adjacencymatrix(AM)waseitherunconstrained(U)orconstrained(C),thetimeslices(TS)variedbetween0,2and4,andthe
numberofcategoriesofdispersalprobabilities(CDP)variedbetweenthreeandfive.Thebestlikelihoodscoresarehighlightedinbold
andwereobtainedwiththeunconstrainedajacencymatrix.
AM TS CDP Colchicaceae Artificial
Experiments (cid:2)lnL Dispersal Extinction Experiment (cid:2)lnL Dispersal Extinction
U 0 1 MC0 114.1 1.3(cid:2)3 3.38(cid:2)9 MA0 113 1.3(cid:2)3 4.29(cid:2)9
U 2 3 MC1 110.3 3.5(cid:2)3 1.69(cid:2)10 MA1 111.8 3.2(cid:2)3 4.29(cid:2)9
5 MC2 108.8 3.8(cid:2)3 2.96(cid:2)11 MA2 107.1 3.7(cid:2)3 9.39(cid:2)9
U 4 3 MC3 113.8 2.9(cid:2)3 4.32(cid:2)4 MA3 116.8 2.7(cid:2)3 8.30(cid:2)4
5 MC4 107.9 5.0(cid:2)3 1.63(cid:2)9 MA4 105.2 5.0(cid:2)3 4.29(cid:2)9
C 0 3 MC5 143.2 4.3(cid:2)3 3.65(cid:2)3 MA5 129.9 3.1(cid:2)3 2.36(cid:2)3
5 MC6 140 3.7(cid:2)3 3.38(cid:2)3 MA6 126.3 2.9(cid:2)3 2.39(cid:2)3
C 2 3 MC7 136 8.2(cid:2)3 3.64(cid:2)3 MA7 128.5 6.3(cid:2)3 2.70(cid:2)3
5 MC8 134.6 8.4(cid:2)3 3.71(cid:2)3 MA8 121.2 6.5(cid:2)3 2.55(cid:2)3
C 4 3 MC9 142.5 7.1(cid:2)3 3.80(cid:2)3 MA9 132.1 5.2(cid:2)3 2.68(cid:2)3
5 MC10 136.2 1.1(cid:2)2 3.43(cid:2)3 MA10 118.8 8.6(cid:2)3 2.27(cid:2)3
connectiontoWestGondwanastillcloseandtheclimatesuf-
ficiently warm for dinosaurs and broad-leaved forests to
inhabit Antarctica (Poole & Gottwald, 2001; Ezcurra & Agn-
olin, 2012). After the initial radiation of the Colchicaceae at
c. 67 Ma (N191 in Table 2), early lineages suffered extinc-
tion, as indicated by the long length of the branch subtend-
ing the Burchardia clade (Fig. 3). Although the area where
the most recent common ancestor of the Colchicaceae ini-
tially radiated couldnotbe inferred (N191in Table 6), based
on the current distribution of the sister families (Figs 1 & 3)
it may have been in the Australian portion of East Gondw-
ana. Range expansion to Africa appears to have taken place
during the Palaeogene, c. 56.4 Ma (node N178; Fig. 3,
Table 2). Similar African/Australian disjunctions are known
from other families, including Proteaceae (Barker et al.,
Figure 4Scatterplotshowingthegloballikelihoodscores
obtainedintheLagrangeexperimentsusingtheempirical 2007), Restionaceae (Linder et al., 2003; Verboom et al.,
(Colchicaceae)andtheartificialdatasets. 2008), Poaceae (Ehrharta; Verboom et al., 2003) and Irida-
ceae (Patersonia–Geosiris; Goldblatt et al., 2002): patterns
that are all now attributed to transoceanic dispersal. Alterna-
2008). A well-supported phylogeny therefore was a precon- tive scenarios involving dispersal from South America to
dition for this study, which is why we relied on the com- Africa or from South America to Australia were also inferred
bination of nuclear, plastid and mitochondrial data. The (Fig. 3, see above) but these seem doubtful as they imply
long evolutionary history of the Colchicaceae family, which complete extinction inSouth America where noColchicaceae
spans from the Lower Cretaceous to the Holocene (Fig. 3), occur naturally today (Fig. 1).
together with their natural distribution on several continents, Colchicaceae then appear to have diversified in southern
madethisfamilysuitableforourgoalofassessingthesensitiv- and central Africa from about 48 Ma onwards (N172 in
ity of likelihood-based AARs to changing model parameters, Table 2 and Fig. 3). As Africa moved north and the Tethys
and ourparticular interest atthe outsetwashow thenumber Sea was closing, the ancestor of the Disporum/Uvularia
of time slices would affect the results. Although our taxon clade (N33 in Table 2) dispersed to Southeast Asia probably
samplingcomprisesonly30%ofc.280Colchicaceaespecies,it via Arabia and from there to North America (between 28.8
includesatleastonespeciesfromeachofthe15genera,witha and 15.1 Ma, Table 2) via the Bering land bridge. Several
proper focus on the largest genera, Colchicum and Wurmbea, Oligocene and Miocene long-distance dispersal events are
whichtogethercomprisemorethan50%ofallspecies(207of inferred to explain the ranges of Wurmbea, Iphigenia and
280). Colchicum (Fig. 3), one of the oldest ones being that of
The common ancestor of Colchicaceae/Alstroemeriaceae is Wurmbea eastwards from southern Africa to Australia at c.
likely to have lived in Australia around 71–101 Ma (Fig. 3, 25.6 Ma (N157 in Table 2; already suspected by Bergh &
Table 2), which then was part of East Gondwana, with the Linder, 2009).
JournalofBiogeography41,1414–1427 1423
ª2014JohnWiley&SonsLtd
Description:Department of Biology, University of Munich, integrates over the conditional likelihoods of all ancestral 0.01 or 0) for dispersal probabilities between areas based on . the Nucleospin Plant II kit (Macherey-Nagel, Dьren, Germany). Havill, N.P., Campbell, C.S., Vining, T.F., LePage, B., Bayer,.