Table Of ContentARTICLE
OPEN
DOI:10.1038/s41467-017-00104-7
‘ ’
ARMAN archaea depend on association with
euryarchaeal host in culture and in situ
Olga V. Golyshina1, Stepan V. Toshchakov2, Kira S. Makarova3, Sergey N. Gavrilov4, Aleksei A. Korzhenkov 2,
Violetta La Cono5, Erika Arcadi5, Taras Y. Nechitaylo6, Manuel Ferrer7, Ilya V. Kublanov2,4, Yuri I. Wolf3,
Michail M. Yakimov 2,5 & Peter N. Golyshin 1
Intriguing, yet uncultured ‘ARMAN’-like archaea are metabolically dependent on other
members of the microbial community. It remains uncertain though which hosts they
relyupon,and,becauseofthelackofcompletegenomes,towhatextent.Here,wereportthe
co-culturing of ARMAN-2-related organism, Mia14, with Cuniculiplasma divulgatum PM4
during the isolation of this strain from acidic streamer in Parys Mountain (Isle of Anglesey,
UK).Mia14ishighlyenrichedinthebinaryculture(ca.10%genomicreads)anditsungapped
0.95Mbp genome points at severe voids in central metabolic pathways, indicating
dependenceonthehost,C.divulgatumPM4.AnalysisofC.divulgatumisolatesfromdifferent
sites and shotgun sequence data of Parys Mountain samples suggests an extensive genetic
exchangebetweenMia14andhostsinsitu.Withinthesubsetoforganismswithhigh-quality
genomicassembliesrepresenting the‘DPANN’superphylum, theMia14lineagehashadthe
largest gene flux, with dozens of genes gained that are implicated in the host interaction.
1SchoolofBiologicalSciences,BangorUniversity,DeiniolRoad,BangorLL572UW, UK.2ImmanuelKantBalticFederalUniversity,Kaliningrad236040,
Russia.3NationalCenterforBiotechnologyInformation,NationalLibraryofMedicine—NationalInstitutesofHealth,Bethesda,MD20894, USA.
4WinogradskyInstituteofMicrobiology,ResearchCenterforBiotechnologyRussianAcademyofSciences,Prospect60-LetiyaOktyabrya7/2,Moscow
117312, Russia.5InstituteforCoastalMarineEnvironment,CNR,SpianataS.Raineri86,98122Messina,Italy.6InsectSymbiosisResearchGroup,MaxPlanck
InstituteforChemicalEcology,Hans-Knöll-Strasse8,Jena07745, Germany.7InstituteofCatalysisCSIC,CampusCantoblanco,28049Madrid,Spain.
CorrespondenceandrequestsformaterialsshouldbeaddressedtoO.V.G.(email:[email protected])
NATURECOMMUNICATIONS|8: 60 |DOI:10.1038/s41467-017-00104-7|www.nature.com/naturecommunications 1
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/s41467-017-00104-7
D
eepmetagenomicanalysisofenvironmentalsamplesfrom Parys/ParysMountain,werevealedpossibleinsituinteractionsof
acidic environments across our planet has demonstrated these organisms with other microbial community members.
the existence of previously neglected uncultured archaea Furthermore, we analysed the voids in its metabolic pathways
that areonly very distantly related to recognised phyla1. Initially (and thus dependencies on potential hosts) and mapped its
detected at Iron Mountain (California, USA), these archaeal phylogenetic position. Finally, using data on arCOGs gains and
lineages were subsequently confirmed to occur in various losses, we reconstructed its evolutionary trajectory starting from
acid mine drainage (AMD) systems2. This enigmatic group of the last archaeal common ancestor (LACA), which pointed at
archaea (the so-called ‘Archaeal Richmond Mine Acidophilic Mia14havingthegreatestknownextentofgenefluxeswithinthe
Nano-organisms’,or‘ARMAN’wasinitiallyfoundinthefraction ‘DPANN’ superphylum.
ofcellsfilteredthrough0.22μmmembranefilters1.Metagenomic
assemblies suggested average genome sizes of these organisms
to be relatively small for free-living organisms (approximately 1 Results
Mbp)1. An interesting observation documented by electron Coexistence of Mia14 with Cuniculiplasma divulgatum PM4.
microscopywasthatsomecellsofasmallsize(<500nm)interact We have previously isolated and described two strains of a new
throughpili-likestructureswithlargercellsthatlackedcellwalls. archaeal family, genus and species, named Cuniculiplasma
Comolliandcolleagues3suggestedthe‘ARMAN’organismswere divulgatum (order Thermoplasmatales), from acidic streamers
the ‘small’ cells, whereas cell wall-deficient larger cells were at Parys Mountain (UK) and Cantareras mine (Spain)15.
attributed to some members of the order Thermoplasmatales, a Both strains S5 and PM4 were characterised as acidophilic
group of organisms known to be widely represented in AMD organoheterotrophes with mesophilic optima for growth and as
systems4. Emerging findings from metagenomic data sets of facultativeanaerobes15. The genomes of these isolates were
ARMAN-like archaea and especially their ubiquity suggest that remarkably similar to one another (>98% average nucleotide
this group plays important roles in the environment, although identity16 and to that of the genomic assembly ‘G-plasma’ from
the exact roles have yet to be established2.The phylogenomic Iron Mountain (USA))17. During the isolation, C. divulgatum
placementofarchaeafromthisgroupstillrepresentsamatterfor strain PM4 was co-cultured for 2 years with another archaeon
discussion5–7. designated Mia14 with a proportion of genomic reads, PM4:
The known example of small-sized cultured archaea is Mia14 of approx. 10:1. The initially poor growth of the PM4
represented by Nanoarchaeum equitans, currently the only validly component was significantly improved by the addition of
described member of the phylum Nanoarchaeota. Cells are complex organic compounds, such as beef extract and trypton
about500nm(orsmaller)indiameterandexhibitatypicalarchaeal (0.1% w/vol). However, the enhanced growth of C. divulgatum
ultrastructure8. Nanoarchaeum equitans exists only in association and an increased frequency of re-inoculations had a dramatic
with the host, Ignicoccus hospitalis, which supplies certain effect on the growth of Mia14, which was eliminated from
organic compounds (lipids and amino acids), growth factors and the culture and, after approximately 2.5 years of regular
likely ATP to N. equitans9. Other nanoarchaeota-related examples (every 20–22 days) passages into the fresh medium, was
includeanNst1archaeonforminganassociationwithitshost,the not detectable by PCR with specific primers. Another possible
Sulfolobales-related organism10, and ‘Candidatus Nanopusillus explanation is that the faster growth of C. divulgatum strain
acidilobi’, thriving in a partnership with Acidilobus spp.11. PM4wastheresultoftheeliminationofMia14,whichmayhave
These nanoarchaeota are hyperthermophilic marine and terrestrial negatively affected the growth of PM4 in earlier cultivation
organisms with extremely compact genomes that likely are not stages. Whatever the case, we could not maintain Mia14 for
of an ancestral nature, but rather probably resulted from massive longerthan2.5years.However,asMia14washighlyenrichedin
gene loss6. Nanoarchaeota-related organisms (including those theinitialenrichmentcultureswithC.divulgatumstrainPM4,we
known only by metagenomics-resolved genomes) are phylogeneti- obtained enough coverage of its genomic reads (approximately
cally clustered within the ‘DPANN’ candidate superphylum 40-fold)toassembleasinglechromosome.AfterthelossofMia14
(abbreviated after candidate divisions ‘Diaphetotrites’, ‘Parvarch- from the enrichment culture, we performed additional sampling
aeota’, ‘Aenigmarchaeota’, ‘Nanohalarchaeota’ and the only of the acidic streamer (from the same site in Parys Mountain
validly described phylum Nanoarchaeota)12. Recently, a number where the isolate PM4 was derived from), and detected Mia14
of uncultured ‘DPANN’ archaea with almost complete initially by PCR using specific primers, then by the de novo
genomes were predicted by Castelle and co-authors13 to be sequencing of environmental DNA, and ultimately, by catalysed
symbiotic and/orto have a lifestyle based on fermentation. To reporter deposition fluorescence in situ hybridisation (CARD-
summarise, all experimentally validated examples of interactions FISH).
between co-cultured small (or ‘nanosized’) archaea and their Analysis of metagenomic contigs showed that the most
partners are limited to Crenarchaea being the hosts. All of abundant group (up to 57%) was Thermoplasmatales–related
them (except Ignicoccus sp.) are acidophiles, while so far no archaea. Small-genome archaeal lineages (‘Candidatus Parvarch-
associations have been co-cultured or characterised for aeota’ and ‘Ca. Micrarchaeota’) were also detected at 0.31% and
Euryarchaeota, except those from the recent report on a four- 3.84%, respectively (Fig. 1).
memberconsortiumcontainingafungus,twostrainsofThermo- Interestingly,bothmediancontigcoverageandcoverage-based
plasmatales and ARMAN-1-related organism with, due to the abundance calculation indicate that the amount of Cuniculi-
complexity of this enrichmentculture, only a partially sequenced plasma cells in the Parys Mountain acidic streamer is nearly
genome14. equal to the amount of ‘Candidatus Mancarchaeum’ cells
Here,wereporttheco-cultivationandanalysisoftheungapped (Figs. 1 and 2). Also, analysis of read coverage vs. GC content
genome of an ARMAN-like organism, the ‘Candidatus of metagenomic contigs reveals that ‘Ca. Mancarchaeum’ and
Mancarchaeum acidiphilum’ Mia14, which was enriched in the C.divulgatum-relatedcontigsformaverycompactclustersimilar
laboratory binary culture with Cuniculiplasma divulgatum both in coverage and GC content (Fig. 2). Notably, we also
PM4, a recently described representative of the family observedanotherThermoplasmatales,‘Ca.Micrarchaeota’contig
CuniculiplasmataceaewithinThermoplasmata15.Afteradditional cluster,intheParysMountainmetagenome,suggestingthatthere
sampling campaigns and de novo metagenome sequencing of are several stable two-member microbial associates in the
the microbial community of the acidic streamer of Mynydd community at this site.
2 NATURECOMMUNICATIONS|8: 60 |DOI:10.1038/s41467-017-00104-7|www.nature.com/naturecommunications
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/s41467-017-00104-7
4.79% Taxon Contig length (kb)
8.89% Parvarchaeota 25
Micrarchaeota
100
Euryarchaeota
Cuniculiplasma 400
3.74% All other
Mia
18.74%
0.85% 1.79% 100
0.99%
0.31%
0.77%
3.09% e
g
a
0.75% er
v
o
C
55.29% 10
Euryarchaeota* Cuniculiplasma divulgatum
Terrabacteria group ‘Candidatus Micrarchaeota’**
Firmicutes ‘Candidatus Manarchaeum acidiphilum’
Proteobacteria ‘Candidatus Parvarchaeota’ 30 40 50 60 70
Nitrospirae Viruses GC content (%)
Acidobacteria PVC group
Fig.2DistributionofParysMt.metagenomiccontigsbycoverageandGC
Not assigned content.ClustersofcontigsrelatedtoC.divulgatum—‘Ca.Mancarchaeum’
Fig.1GeneralstructureofParysMountainacidicstreamercommunity. anduncultivatedThermoplasmatales—‘Ca.Micrarchaeota’excluding
Abundancevalueswerecalculatedusingmediancoverageofmetagenomic ‘Ca.Mancarchaeumacidiphilum’microbialconsortiaareshownwithdotted-
contigsofeachbinwithnormalisationtoaveragegenomesizeofbin lineovals
representatives.AbundancevaluesforC.divulgatumand
‘Ca.Mancarchaeumacidiphilum’arehighlightedwithgreen.*excluding
sequence identities with the thaumarchaeon Nitrosospaera
C.divulgatum.**excluding‘Ca.Mancarchaeumacidiphilum’
viennensis and euryarchaeon Methanosaeta consilii are observed.
Among candidate status holders (Supplementary Fig. 1), the
FluorescencemicroscopyshowsinteractionofMia14andthehost. nearest relative was inferred to be ARMAN-2 (‘Candidatus
Microbial cells from enrichment cultures set-up with the Micrarchaeum acidiphilum’1, 5) originally detected in acidic
environmental sample from 2014 were either hybridised with environmentsandsharing92%16SrRNAsequenceidentitywith
probe EUB338(I-III) mix or probe ARCH915 to target Bacteria Mia14. Other similar sequences (92% sequence identity) belong
or Archaea, respectively. The following CARD-FISH analysis to PCR-amplified and cloned SSU rRNA genes from fumarolic
revealed dense populations of Archaea and the almost complete thermal and acidic green biofilms, Mexico, Michoacan,
absence of bacterial cells. Pleomorphic morphologies of cells of LosAzufres(KJ907762).Interestingly,bothabovesequencesand
various size, typical for Cuniculiplasma/Thermoplasmatales16, the sequence of Mia14 possess introns in their 16S rRNA genes.
wereconfirmedwithhybridisationswithCuniculiplasma-specific In addition, sequences with a lower sequence identity and
probe Clpm-1100R. Besides bright signals, the CARD-FISH coverage (91%, 58%) were detected in a PCR-amplified SSU
microphotography retrieved numerous debris-like structural rRNA clone from Rio Tinto (FN865418)18, acidic hot springs
forms, which likely could be referred to as either dying or (JF280243; 91%, 58%)19 and a number of other AMD and
metabolically dormant cells. This observation is typical for volcanicenvironments.Furthermore,similarsequenceshavebeen
both natural samples and initial enrichments, where the retrieved from southern Appalachian peatlands (PF82012)20 and
cells of different metabolic states coexist. Noteworthily, wetlands in Finland (AM905392, AM905420)21. The two latter
parallel hybridisations with ‘Ca. Mancarchaeum’-specific siteswereoligotrophic,withtemperaturesintherangefrom0to
probe ARM-MIA1469R and Thermoplasmata-specific probe 15°C and slightly acidic pH (4–5.6 and 3.9–4.3, respectively).
Thpmt680R showed quite similar images (Fig. 3), suggesting Along with wetland clones, similar signatures (BioProject
thattheorganismsliveinatightassociation.Cross-hybridisation PRJNA279923) have been found in metagenomic data from
of ARM-MIA1469R probe with pure Cuniculiplasma culture another oligotrophic environment, the pH-neutral groundwater
was controlled at specific hybridisation conditions and no from Fennoscandian terrestrial deep biosphere22. All these
positive signals were retrieved. Side-by-side comparisons of recordssuggestawidedistributionoforganismssimilartoMia14
‘Ca. Mancarchaeum’ vs. Cuniculiplasma cells revealed that the and ARMAN-2 in natural settings with various pH character-
former are slightly smaller in size and only a minor fraction istics, not necessarily tied to acidic environments.
of cells do not overlap in each frame. Detailed view of some The placement of Mia14 on the phylogenetic tree constructed
double-hybridisedcellformationsrevealedsinglecoccoid-shaped with concatenated ribosomal proteins is presented in Fig. 4.
Cuniculiplasma cells were surrounded by ARM-MIA1469R In agreement with previous observations12, the position of
probe-labelled organisms (Fig. 3f). Mia14 within the ‘DPANN’ superphylum is strongly supported.
Phylogenetic position of Mia14 and related organisms. Based
on 16S ribosomal RNA (rRNA) gene sequence, Mia14 was Genome statistics. The genome of Mia14 is a single, circular
found to be only distantly related to organisms with chromosome with 952,257bp, with the molar G+C% of 39.36%
established taxonomic status. Less than 75 % SSU rRNA gene (Fig. 5). The coding density in the genome is of 1.032 genes per
NATURECOMMUNICATIONS|8: 60 |DOI:10.1038/s41467-017-00104-7|www.nature.com/naturecommunications 3
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/s41467-017-00104-7
a b
Thmpt-660R ARM-MIA1469R
10 µm 10 µm
c d e
1 µm 1 µm
f
10 µm
1 µm
Fig.3ArchaealcellsvisualisedbyCARD-FISH.HybridisationwithaprobeThpmt680RandbprobeARM-MIA1469RtotargetCuniculiplasmaspp.and
‘Ca.Mancarchaeum’,respectively.cSide-by-sidecomparisonof‘Ca.Mancarchaeum’vs.Cuniculiplasma.‘Ca.Mancarchaeum’cells(magenta)localisedon
greenCuniculiplasmaspp.).Panelsd,eandfarethemagnifiedimagesofyellow-boxedfieldsofpanelsa,bandc,respectively.Theimagewascorrectedwith
Daltonizetool(https://github.com/joergdietrich/daltonize)toimproveperceptionofdeuteranopicpersons.Scalebarsare10µminpanelsa,bandcand1
µminpanelsd,eandf
kbp(968basespergene).About~150–200hypotheticalproteins contains41genesandspans36.5kbp(Fig.5).Acloserinspection
were present. The genome encodes 45 transfer RNAs. Three of this island reveals that the integration occurred in the gene
introns were detected across the chromosome. All these traits for zinc-binding pyruvate-formate lyase-activating enzyme
are typical for small archaeal genomes, e.g., in Nanoarchaeum (MIA14_0850), splitting it in two parts: MIA14_0850 and
equitans (491kbp)23, ‘Candidatus Nanobsidianus stetterii’, MIA14_0891, with the latter located in the immediate vicinity
Nst1 belonging to the phylum Nanoarchaeota (592kbp)10, of23SrRNAgene.About50%ofgeneswithinthisGIcouldnot
ARMAN-2 (~1Mbp)5 and other host-associated or symbiotic be assigned to known arCOGs and represent small proteins that
microorganisms. often contain transmembrane segments, which is typical
forarchaeal‘darkmatter’.Inturn,thegenesassignedtoarCOGs
Lateral gene transfer between Thermoplasmatales and Mia14. (i.e.,MIA14_0898,theDNAinvertasePinhomolog,MIA14_0894
ComparativeanalysisofinsilicoproteomesofMia14andstrains (similar to those from other Thermoplasmatales), ParA family
S5 and PM4 with ProteinOrtho24 revealed several clusters of chromosomepartitioningATPaseandMIA14_0890,integraseof
orthologous genes shared between Mia14 and C. divulgatum S5, XerD family) were shown to be strongly associated with ‘dark
but absent in C. divulgatum PM4 (Supplementary Data 1, matter’ islands in archaeal genomes and could be specifically
Supplementary Fig. 2). These genes encode several membrane- attributed to integrated mobile elements26.
associatedproteins(MIA14_0876,_0886,_0893and_0478),two Among GI-associated genes, we also found cation transport
SAM-dependent methyltransferases (MIA14_0883 and _0885), ATPase/copper-transporting P-type ATPase(MIA14_0877),
sulfocyanin (MIA14_0884) and peroxiredoxin (MIA14_0479). which may have significance for the fitness of this organism in
It should be noted that the majority of these proteins have the harsh conditions of Parys Mountain AMD. Phylogenetic
homologues in PM4, but are more distant to those from both analysis of this ATPase showed that its close homologues are
Mia14and S5and havedifferent genecontext. FewMia14 genes widely distributed amongacidophilic Thermoplasmatales. Atthe
from these clusters have no homologues in PM4. sametime,thecopper-transporting ATPaseof ARMAN-2seems
Analysis with IslandViewer325 showed that altogether only quite distantly related to MIA14_0877 (Fig. 6, Supplemen-
five genomic islands (GIs) are present; the largest GI tary Table 1). Gene neighbourhood of MIA14_0877 included
4 NATURECOMMUNICATIONS|8: 60 |DOI:10.1038/s41467-017-00104-7|www.nature.com/naturecommunications
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/s41467-017-00104-7
Euryarchaeota
100 Nanoarchaeote Nst1 GCA 000387965.1
Nanoarchaeota
Nanoarchaeum equitans Kin4 M GCA 000008085.1
100
Archaeon GW2011 AR15 GCA 000830295.1
Archaeon GW2011 AR17 GCA 000805995.1 “Ca. Woesarchaeota”
100
Archaeon GW2011 AR20 GCA 000830315.1
100
Archaeon SCGC AAA011 G17 GCA 000402515.1
100 94 Archaeon JGI OTU 1 GCA 000494105.1 Nanoarchaeota
100
Archaeon SCGC AAA011 L22 GCA 000380905.1 “DPANN”
Mia14
100
“Ca. lainarchaeum andersonii” SCGC AAA011
E11 GCA 000402355.1 “Ca. Diapherotrites”
100 Archaeon GW2011 AR10 GCA 000830275.1
19 Archaeon GW2011 AR5 GCA 000806115.1 “Ca. Aenigmarchaeota”
99 100 “Ca. Nanosalinarum” J07AB56 GCA 000220355.1
100 “Ca. Nanohaloarchaea” B1 Br10 U2g1 GCA 001563875 “Ca. Nanohaloarchaeota”
72 “Ca. Haloredivivus” G17 GCA 000236195.2
100 Candidate phylum “Lokiarchaeota” GC14 75 GCA 000986845.1
Candidate phylum “Thorarchaeota” SMTZ1 83 GCA 001563325.1
100
Thaumarchaeota
100
100100 Crenarchaeota
99
Korarchaeota
0.1
Fig.4PhylogeneticpositionofMia14withinArchaea.AnapproximateMaximumLikelihoodtreebasedontheconcatenatedalignmentof56ribosomal
proteinsuniversallyconservedinArchaea.Intotal,285genomeswereanalysed.TaxaarenamedaccordingtotheNCBItaxonomy.Candidatephylaare
showninquotationmarks.Lineageswithcultured/co-culturedrepresentativesarehighlightedinblue.NCBIGenomeAssemblyIDsareshownforindividual
genomes.Scalebarreflects0.1substitutionsperamino-acidposition
an Lrp-AsnC family transcriptional regulator and a copper Detailed analysis of de novo metagenome sequencing data
chaperone,resemblingfunctionalcopperfitnessislandsdescribed fromParysMountainsamplesshowsthatgeneclusterssimilarto
for ‘Ferroplasma acidarmanus’27. This gene cluster was found the abovementioned copper fitness island of Mia14 are widely
tobeconservedinCuniculiplasma-relatedarchaea.Furthermore, presentindifferentmetagenomiccontigs(SupplementaryData2).
C. divulgatum S5 genome possessed two copies of this copper- It indicates that this highly mobile gene set is important for
fitness island (Fig. 6). Interestingly, one of the C. divulgatum heavy metal resistance in microbial communities inhabiting
S5 copper fitness islands was adjacent to genetic loci for acidic environments with high concentrations of dissolved
SHOCT family and DUF 302 family proteins as in the Mia14 metal ions.
coppergenecluster,whileanotherC.divulgatumS5coppergene Other smaller GIs of Mia14 (Fig. 5) contain defence systems
island had a high level of gene synteny with C. divulgatum PM4 (toxin/antitoxin and type III restriction-modification proteins),
(Figs. 5 and 6). The above observation supports the lateral gene 2-oxoacid dehydrogenase multienzyme complexes, 2-oxoacid
transfer from ancestral Cuniculiplasma-related lineage(s) to decarboxylase (E1) component subunits α and β, glycosyltrans-
Mia14.Inthatcase,itismorelikelythatLCAofCuniculiplasma ferases and numerous hypothetical proteins. Interestingly, the
hadtwocopiesofthisgenecluster,oneofwhichwaslostduring lamininG-encodinggenelocusisalsosituatedontheGI(seethe
the evolution of C. divulgatum PM4 and ‘G-plasma’. section ‘Secretion systems’).
NATURECOMMUNICATIONS|8: 60 |DOI:10.1038/s41467-017-00104-7|www.nature.com/naturecommunications 5
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/s41467-017-00104-7
Carbohydrate metabolism. The Mia14 genome has no genes further conversion of glycerate, e.g., to glycerate-2-phosphate or
for central carbohydrate metabolism pathways such as glycolysis glycerate-3-phopshate were found. The pyruvate released during
andgluconeogenesis,pentosephosphatepathwayortricarboxylic the action of 2-dehydro-3-phosphogluconate aldolase, could be
acid (TCA) cycle. A detailed manual inspection suggested that carboxylatedtomalateandoxaloacetateinthereactioncatalysed
the genome encodes a complete set of enzymes for glucose by NAD-dependent malic enzyme (MIA14_0243/EC 1.1.1.38).
oxidation via the non-phosphorylating Entner-Doudoroff (ED) Characterised homolog of scfA from E. coli (or maeA29) was
pathway28: a glucose dehydrogenase (MIA14_0575), D-gluconate reversible despite the carboxylation reaction being 28 times
dehydratase (MIA14_0298), 2-dehydro-3-phosphogluconate slower than the forward reaction. Other enzymes found to
aldolase (MIA14_0299) and NAD-dependent D-glyceraldehyde catalysepyruvateconversionsarephosphoenolpyruvatesynthase/
dehydrogenase (MIA14_0297). Surprisingly, no enzymes for pyruvate phosphate dikinase (MIA14_0437, EC 2.7.9.2 and
MIA14_0462) and pyruvate kinase (MIA14_0326, EC 2.7.1.40).
It is worth mentioning that ARMAN-2, one of the most closely
Legend
relatedorganismstoMia14amongthosewithpartiallysequenced
900 kb 0 kb 100 kb CrtGGRRDeCNNnS AAcoo mannitced ti snnltcaRndNsA gcgoeennmoepsmarefioss,ronegxlthyocibosilitybssliisnagirnleilnaAetiaRvgeMelsyAANsRc-aM2rcAeanNdr-e4paearntnodeira-er5-.cooOfmngplyelentaeesfesiewnt
of genes in ARMAN-4 and -5 were predicted. TCA, which is
GC skew
800 kb bbllaassttnn vvss CC.. PSM54 dcoymsfupnlectteioinnalailnl AMRiMa1A4,Nwacslurseteprorotregdantoismbescmomenptlieotneeodraablmovoes5t.
Furthermore, central metabolic pathways in Mia14 starkly
200 kb contrast with AR10 assembly representing ‘Ca. Diapherotrites’,
but to some extent resemble those predicted for a more
‘Ca. Mancarchaeum phylogenetically distant AR20 (‘Ca. Woesarchaeota’)13. Further-
700 kb acidiphilum’ more, the inspection of amino-acid biosynthetic pathways in
Mia14 found them to be either incomplete or entirely missing.
However,thetotalnumberofproteinsinthisfunctionalcategory
300 kb is higher in comparison to N. equitans and Nst110,23.
600 kb Cfoorfacctooernsz,yvmitaemiAn,s,pforloastteh,etliicpgoricoupasciadn,dNpiAgDmenatns.dNoNgAenDePs
40 cofactor, pyridoxin (Vitamin B6), heme and siroheme, thiamin
0 kb 0 kb biosynthesis and riboflavin, FMN and FAD metabolism were
0 present in the entire genome of Mia14. The lack of functional
5
pathwaysforcofactorsandaminoacidsisquitecharacteristicfor
Fig.5GenomicfeaturesandGIsin‘Ca.Mancarchaeumacidiphilum’.Rings organisms with reduced genomes10,23.
fromoutsidetoinside:genomiccoordinates(greycolour);plus-strandCDS
(blue);minus-strandCDS(blue);genomicislands(green)andRNA(red);
GC-content(orange);GC-skew(green/magenta);blastnhitswithe-value Protein metabolism. Protein processing and modification-related
cutoff10−5vs.C.divulgatumPM4;blastnhitswithe-valuecutoff10−5vs. genes(G3EfamilyofP-loopGTPases,peptidemethioninesulfoxide
C.divulgatumS5 reductase and Rio family of protein kinases, amino- and
Candidatus Micrarchaeum acidiphilum ARMAN-2
99 Ferroplasma acidarmanus fer1
93 Ferroplasma sp. Type II
99 Acidiplasma sp.
43 Picrophilus torridus DSM 9790
Thermoplasma acidophilum
40
99
Thermoplasma volcanium GSS1
Thermoplasmatales archaeon A-plasma
99 Candidatus Parvarchaeum acidophilus ARMAN-5
97Cuniculiplasma divulgatum S5 (CIB 0948)
18 99 Thermoplasmatales archaeon Gpl
Cuniculiplasma divulgatum PM4
0.2 41 Uncultured archaeon
Thermoplasmatales archaeon E-plasma
68
Protein coding gene Mia 14
arCOG01576 97
Thermoplasmatales archaeon I-plasma
arCOG04507 86
arCOG01585 91 Cuniculiplasma divulgatum S5 (CIB 0082)
arCOG05383 99 Thermoplasmatales archaeon A-plasma
Fig.6PhylogenyofMIA14_0877andtheneighbourhoodofitsgene.GeneneighbourhoodofCDSforcationtransportATPase/copper-transportingP-type
ATPaseMIA14_0877isshownontheright.CationtransportATPasesareshowningreen,TRASH/YHS-likeprotein,metallochaperones(arCOG04507)
areshowninpurple,Lrp-AsnCfamilytranscriptionalregulators(arCOG01585)andconservedhypotheticalproteins(arCOG05383)areshownincyan.
Otherproteincodinggenesareshownasdarkgreypentagons.Sizeofpentagonsisproportionaltosizeofcorrespondingproteins.Thelistofproteins
includedintheanalysiswithproteinIDsisprovidedinSupplementaryTable1
6 NATURECOMMUNICATIONS|8: 60 |DOI:10.1038/s41467-017-00104-7|www.nature.com/naturecommunications
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/s41467-017-00104-7
carboxy-terminal intein-mediated trans-splice, and ribonucleotide were identified coding for electron donating type I NADH
reductase of class III (anaerobic), large subunit (EC 1.17.4.2) dehydrogenase or succinate dehydrogenase or other known
weremissinginMia14.Altogether,wehaveidentified35large-and respiratory complexes (III and IV).
26small-subunitsofribosomalproteins;L37E(arCOG04126),S17e
(arCOG01885)andS27e(arCOG04108)wereabsent.Allthreeand,
Transporters. ABC transporters, amino-acid permeases, Major
correspondingly, two former proteins were found in N. equitans
Facilitator Superfamily and others have been predicted in Mia14
and Nst1 (Supplementary Data 3).
(Supplementary Table 3) to notably outnumber those in
nanoarchaeal genomes11.
Secretionsystems.Wehaveidentifiedanumberofgenesaffiliated
withsecretionprocessesinthegenomeofMia14(Supplementary
Table 2). Two distinct type IV pili systems are present in the Evolutionary patterns. Overall, compared to other ‘DPANN’
genome: one belongs to Methanococci/Methanothermobacteria/ group members, the Mia14 genome experienced an unusually
Thermococci group (MIA14_0170-_0177) and another is more high level of gene flux (Fig. 7). In addition to the 226 genes
similar to a euryarchaeal group (MIA14_0252-_0260)30. No that do not belong to known arCOGs (a large fraction of
archaellum-related genes were found, in agreement with the loss suchgeneswasprobablyalsoacquiredattheterminalbranchesof
of motility in most of ‘DPANN’ species. Only one FlaK-like the ‘DPANN’ tree), Mia14 has lost determinants for over 400
prepilinpeptidase(MIA14_0570) wasfound.Keycomponentsof arCOG families from the genome of its common ancestor with
both systems are shared by many ‘Ca. Micrarchaea’ species. ‘Ca. Iainarchaeum’/AR10 lineage (46% of the ancestral set),
Additionally, the genome encodes Sec translocon genes for pre- but also gained over 130 arCOGs (21% of its current arCOG
protein translocase subunits SecYE (MIA14_0832, _0132) complement). Gains and losses of comparable scale exist within
and Sec61beta (MIA14_0736), SecDF (MIA14_0121 and_0122), the ‘DPANN’ group tree (e.g., the loss of 49% of the ancestral
signal peptide peptidase and signal recognition particle subunits genomeinthelineageofAR17oracquisitionof18%ofthegene
and receptors. The presence of Sec-independent Tat pathway complement in the lineage of G17-L22-OTU1), but not on
genes, suggests this system is operational for secretion of folded the same tree branch. Gene gains and losses seem to affect
proteins. all functional groups equally with a notable exception of the
The Mia14 surface layer deserves special attention. Besides a ‘Cellmotility’groupwheremoregainsthanlosseswerepredicted
protectionfunction inarchaea,thiscompartmentoftenregulates (Fig. 7). This functional group includes components of secretion
both cell adhesion and cell–cell interaction. We identified at systems,whichmightplayakeyroleininteractionofMia14with
least eight different proteins that eventually account for its host. Moreover, as mentioned before many of the unique
the architecture of the surface layer. It contains strain-specific genes in Mia14 belong to GI, many of which encode membrane
secreted proteins with polycystic kidney disease (PKD) super- proteins and are associated with potential conjugative elements
family fold and β-propeller repeat domains fused to CARDB whichmightbeinvolvedintheextensivegeneexchangebetween
(cell adhesion related domain found in bacteria)-like adhesion Mia14 and its host.
module.Proteinsoftheβ-propellerfoldareubiquitousinnature Analysing the trajectory of evolution of Mia14 from
and widely used as structural scaffolds for ligand binding and LACA through the prism of losses and gains of functional
enzymatic activity. This fold comprises between four and twelve genes, a few interesting facts became apparent. Genes for the
four-stranded β-meanders,the so-calledbladesthatarearranged majorityofenzymesoftheTCAcyclewerealreadylostduringthe
circularly around a central funnel-shaped pore. transition from LACA to the ‘DPANN’ ancestor, together with
Another observation is the expansion of genes encoding many genes involved with amino acid, vitamin and cofactor
jellyrollfoldLamG-likeproteinsintheMia14genome,whichare biosynthesis along with the CRISPR-Cas system. Glycolysis
onlydistantlysimilar tootherLamGproteinsfromarchaeawith and gluconeogenesis were present in all ascendants of Mia14
Candidatus status and from bacteria, but generally abundant in (i.e., in LACA, ‘DPANN’-and Mia14-‘Ca. Nanohaloarchaeota’-
‘DPANN’superphylumspecies.Thisfindingsuggestsanassocia- ancestors). However, many genes of these pathways were lost en
tion of these proteins with laminin (glycoprotein)-containing route to the extant Mia14 species. Pathways for pyrimidine
extracellular matrix and their key role in host cell interactions. andpurinebiosynthesisandsalvagewerealsolostattheverylast
SomeofthemarelinkedtoaforementionedtypeIVpililociand (and long) step of evolution from Mia14/‘Ca. Ianarchaeum’
are localised in GI (Fig. 5). ancestortothemodernMia14,with414geneslostandonly131
gained (Fig. 7a and Supplementary Data 4).
Analysis of the taxonomic affiliations of the ‘DPANN’ group
Respiration. The Mia14 genome encodes all typical subunits K,
species(SupplementaryData5and6)showsthat,incontrastwith
E, C, F, A, B, D, G, H and I of V/A Na+- and H+-transporting
the other group members, the genome of Mia14 was and
typeATPsynthases,inthisparticularorder(MIA14_0355-0364),
continues to be involved in extensive gene exchange with the
whereasthegenomeofN.equitansencodesonlyfivesubunitsof
Thermoplasmata lineages. Unsurprisingly, the most common
ATP synthase23. The analysis of conserved motifs supported source of the acquired genes is identified as Cuniculiplasma
H+-translocating V-type ATPase31.
divulgatum, the Mia14 host.
All genes coding for cytochrome bd quinol oxidase were
identified. Subunits I and II are encoded by MIA14_0653-0654.
This type of oxidoreductase could generate proton motive force Etymology. ‘Candidatus Mancarchaeum acidiphilum’
(PMF) by transmembrane charge separation, but do so without Mancarchaeum (Manc.archaeum M.L. mancus (adj.) crippled,
being a ‘proton pump’. The main electron acceptor for them is maimed, referred to the absence of many pathways in the
oxygen, but cytochrome bd oxidoreductases are usually induced genome; N.L. neut. n. archaeum (from Gr. adj. archaios -ê -on,
in response to low oxygen concentrations and serve for oxygen ancient),ancientone,archaeon;N.L.neut.n.Mancarchaeum,an
detoxification32.Theroleofthecytochromebdoxidoreductasein archaeon with absence of many pathways in the genome.
Mia14ispuzzling,astheorganismcompletelylacksanygenesfor a.ci.di’ phi.lum. M.L. neut. n. acidum from an acid; Gr. adj.
biosynthesis of isoprenoid quinones, which are the only electron philos from loving; M.L. neut. adj. acidiphilum means acid-
donorsforthiselectrogenicenzymecomplex.Moreover,nogenes loving.
NATURECOMMUNICATIONS|8: 60 |DOI:10.1038/s41467-017-00104-7|www.nature.com/naturecommunications 7
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/s41467-017-00104-7
a
TPPeNAFpeCefruecionoAmXh/t F oaN,eg esePreAaeplonlDsu rpteemArHhsa)) ; on; dp( NsrsPereppoahuahotpyrecariFdntittnir eeosFos nyegpbssreaio1rtntees,ha mdy2wson,sae xt5yh isn- e8(u,As )bNi;Rs uPo nA(ryGiVDtrsu u FrvoilabaAtuve, loo PorsuuxerbidS r5ae)-tdpioohnxo isn(PphfeaDte, 4- PdPeyDcr-ua(Dvrbo/Eoylx)-XydleKaps seeun (pdPeevrnflaAt mragriDglyiGC nni)uncealeianses SeRBD(MppuieNiorsiegcmAtmiAdan eiram/ c rRstpaticyesehshndmcoe t BrhsAaep aTtprchsePaheacai r torBes eAme ipiTo,sb aBPoMiinrmau aseetseLnre azMysmuet/eS familly PoGsGRCyxyeyllunyirtdccouctBohoocvre ashseftaytaradeomlmtsu:mrfeicaeilnyetnrae r seces fx6 eedbo-,ropi anoPxhsugionoecerslAnepe-ahDssaieste CcdA
Amino acids, vitamins and cofactor biosynthesis PIastocyanin/azurin/halocyanin
CRISPR-Cas system related proteins family protein
530 Fructose-1,6-bisphosphatase
+25 –405 Nanoarchaeote Nst1 (435 +47 –142) Glycogen synthase
+4 9–1100 Nanoarchaeum equitans Kin4 M (378 +33 –185) Gisolumcoesraes-6e-phosphate
Archaeon GW2011 AR15
Archaeon GW2011 AR17 (447 +40 –390)
Archaeon GW2011 AR20
796
+22 –123 Nanoarchaeota archaeon SCGC AAA011 G17
L1A4C86A 916 +258 –827 627 Nanoarchaeota archaeon JGI OTU 1
+112 –252 Nanoarchaeota archaeon SCGC AAA011
Mia14 619 +131 –414
903 +13 –31 Candidatus lainarchaeum andersonii SCGC AAA011 E11
837 Archaeon GW2011 AR10
921 +9 –4 +60 –125
Archaeon GW2011 AR5 (566 +59 –393)
Candidatus Nanosalinarum J07AB56
781 Nanohaloarchaea archaeon B1 Br10 U2g1
+59 –177 Candidatus Haloredivivus G17
0.2
Pentose Phosphate pathway (Rpe, RpiB, TalA) Losses Ccoymtopclherxo Qmcer Bb subunit of the bc
GPPPyyulyrrrcuiimnovealiyd tssienai seolv/ xgasiladgulaecvt oai(onPgneeu o r(()AgNecrnedeFA,s )Aisc (oGAm, AbAco, Bph)oE, Pgi) TdMroaamnlicsa cienrni,p zAtyiromsnRea lf( arSemfgciuAlyl)ator containing HTH HMHAmeAorlDmAe c oshuunelapialirec pracfehasreammpileeyra ohsnyede Ar HomlSatsPBe20 family MGDDNNlFySAAco /fmRsayNmol dAihliy fyhi cdpeareloticrilomaansse eema fsseaeutmhspyiellyra fsa1em5ily II
NADH dehydrogenase subunits Transcription elongation factor NucA NUDIX family hydrolase Beta-propeller repeat-containing protein
NADH-FMN oxidoreductase RutF beta-Iactamase fold exonuclease (RNA GTP cyclohydrolase II RecA-superfamily ATPase
Succinyl-CoA synthetase processing) Phd family antitoxin HerA helicase
b
60
50
40
30
20
10
0
C E F G H M P I Q J L O D K T N V R S
Gain Loss
Fig.7GainsandlossesofarCOGfamiliesintheevolutionof‘DPANN’group.aReconstructionofgenelossandgainalongthe‘DPANN’subtree.Tripletsof
numbersindicatetheestimatesforthearCOGcomplement,arCOGgainsandarCOGlosses,respectively,fortheselectedextantorancestralgenomesand
adjacenttreebranches.Estimatesfortheterminalbranchesareshownnexttotheextantgenomenames.Thenumberatthebaseofthetreeindicatesthe
arCOGcomplementwithgains(+)andlosses(−)estimatedforthelastarchaealcommonancestor(LACA)49,‘DPANN’ancestor(bluerectangle),common
ancestorof‘Ca.Nanohaloarchaea’-‘Ca.Micrarchaea’(greyrectangle),commonancestorof‘Ca.Micrarchaea’(magentarectangle)andMia14
(yellowrectangle).Lossesandgainsofselectedproteinfamiliesincourseofevolutionatabovetime-pointsareindicatedintextboxesofsamecolours,with
gainsindicatedintextboxeslocatedaboveandlosseslistedinboxesbelow(seeSupplementaryData4forfurtherdetails).bNumberofarCOGspredicted
tobegainedorlostinthecourseofevolutionofMia14lineagewithrespectiveCOUNTprobability>50%byarCOGfunctionalcategories.Thefunctional
classificationofthearCOGsisshownfortwo4majorgroups:C-Q—metabolicgenes;J-N—informationalgenes;V—defencegenes;R-Spoorly
characterisedoruncharacterisedgenes(fordetailsseeftp://ftp.ncbi.nih.gov/pub/wolf/COGs/arCOG/funclass.tab)
Discussion uncultured archaea distantly related with ARMAN-2. Due to its
Inthepresentwork,theenrichmentculturefromParysMountain high numbers in the enrichment, we were able to produce the
AMD system was set-up to grow acidophilic members of the fullyassembledgenomeofthe‘ARMAN’-relatedorganism.Based
order Thermoplasmatales. The culture was eventually highly onthegenomeannotationandexperimentaldata(co-existencein
enriched in archaea from the genus Cuniculiplasma, and anenrichmentcultureandfluorescencemicroscopy),weinferred
incidentally, with the significant (ca. 10% genomic reads or 20% that the metabolic needs of this sentinel of Cuniculiplasma spp.
of total population) community component belonging to yet termed ‘Ca. Mancarchaeum acidiphilum’ resemble to some
8 NATURECOMMUNICATIONS|8: 60 |DOI:10.1038/s41467-017-00104-7|www.nature.com/naturecommunications
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/s41467-017-00104-7
extent those of other archaea co-occupying the environment themembraneofCuniculiplasmasp.,consideringtheassumption
(e.g., reliance on external proteinaceous compounds and amino of mutualistic interactions between Mia14 and this organism.
acids). However, the incompleteness or absence of the central Indeed, the QH oxidising cytochrome b in the Mia14
2 558
metabolic pathways (e.g., TCA, glycolysis, quinone biosynthesis, cytochrome bd complex is localised on the surface of the cell
etc.) and reduced genome size support an obligate partner- membrane, as inferred from topology prediction and alignment
dependent (or ‘ectoparasitic’) lifestyle. Our data (Fig. 3) further of MIA14_0653 amino-acid sequence with its extensively char-
suggestthatsizesofMia14cells(andlikelyotherARMAN-related acterised homolog from E. coli31. As both Cuniculiplasma spe-
archaea) have a broad range, usually larger than the diameter cies15 lack cell walls and their cells are usually found in
of membrane filter pores (0.22μm) used to enrich for these tight contact with Mia14 (Fig. 3), we can speculate that the
organisms.Thepenetrationofcellsthroughthe0.22μmporesof latter organism utilises a broad diversity of Cuniculiplasma
membrane filters observed previously3 may also be explained by membranequinones(eitherfromlivingordeadcells)aselectron
the lack of rigid cell walls in these organisms. For example, the donors for energy conservation. However, no genes of canonical
majority of 1–2µm, cell wall-deficient Thermoplasmatales may heme biosynthesis, heme import pathways38 or an alternative
squeeze through pores of this diameter. pathway for the formation of heme39 have been found in the
The occurrence of laterally transferred genes and GIs from Mia14 genome.
Cuniculiplasma spp. in Mia14 highlights the relative connection Besidesthepossibilityofacompletelynovelhemebiosynthesis
between these organisms co-existing in one environment. It is, pathway in this archaeon, the only way for proper assembly of
furthermore, likely that extracellular structures such as pili or the cytochrome bd complex is the incorporation of exogenous
pili-like organelles might be present in Mia14. One may also hemes. Accumulation of exogenous hemes in the membrane,
speculate on massive exchange of DNA through some cell pores whichiscapableofcomplementingthegrowthofheme-deficient
or by using the Type IV pili system and numerous membrane organisms, has been demonstrated for pathogenic bacteria40.
proteins encoded within GIs, the likely conjugative elements. Considering that hemes b and d bind covalently to apoproteins
Under our experimental conditions, the preferred partner and that the heme-binding amino acids are localised close to
of Mia14 was Cuniculiplasma divulgatum (previously known as thesurface of thecellmembraneincytochromebdcomplexes31,
‘G-plasma’16), which is an abundant inhabitant in AMD. it seems possible for Mia14 to acquire exogenous hemes
However, the distribution of archaea related to Mia14 (or to from Cuniculiplasma spp. to assemble its only PMF-generating
ARMAN-2 cluster) in diverse, sometimes non-acidic environ- complex. It should be noted that the complete set of genes
ments, emphasises their higher plasticity and ability to adapt to for canonical or non-canonical heme biosynthesis pathways is
the broader range of environmental conditions. This broader also absent in Cuniculiplasma strains PM4 and S5, although
distribution of ‘ARMAN’-related organisms in other environ- these aerobically respiring organisms possess heme-containing
mentsalsosuggeststhatCuniculiplasmaspp.maynotnecessarily enzymes of the electron transfer chain16. It, therefore,
be the exclusive partner (host) for ARMAN-2-like organisms. seemspossiblethatCuniculiplasma,andprobablyMia14,possess
Mia14 is characterised by a very rudimentary metabolic yet unknown mechanisms of heme biosynthesis.
capability. It iseven devoid of minimal setsof enzymes required In many archaea, the surface layer is the only cell envelope
for biosynthesis of both types of nucleotides (purine and componentprovidingallfunctionsnormallyassociatedwithacell
pyrimidine)andof12outof20aminoacids(lysine,methionine, wall,i.e.,actingastheprotectivebarrierandmaintainingthecell
arginine, asparagine, alanine, aspartate, leucine, isoleucine, shape.However,insomecasesthesurfacelayerproteinsmayalso
threonine, phenylalanine, tyrosine and tryptophan). Biosynthetic help in cell–cell association41,42. The Mia14 surface layer likely
pathways for vitamins and cofactors (B1, B2, Coenzyme A, possessesaverycomplexanduniquearchitecture,consistingofat
CoenzymePQQ,B6,B12,heme,methanopterin,andubiquinone/ least eight strain-specific secreted surface proteins. It is note-
menaquinone) are incomplete. worthy that only four of these surface proteins (MIA14_0152,
In Mia14, all glycolytic enzymes are missing. The majority _0331, _0793 and_0946) require almost 2.5% of the whole
of enzymes for the pentose-phosphate pathway and the genome.Weidentifiedtwodomaintypesinsurfacelayerproteins
entire TCA cycle are also absent. On the other hand, the displaying the PKD superfamily fold and beta-propeller Kelch
non-phosphorylatingEDpathwayofglucoseoxidationispresent. and YVTN β-repeat domains fused to CARDB (cell adhesion
Additionally, fatty acid metabolism and beta-oxidation, folate related domain found in bacteria)-like adhesion module. Six of
cycle, phospholipid biosynthesis, aminosugar metabolism, these surface layer proteins are predicted to be gained from
glycine and serine catabolism pathway, urea cycle and amino various methanogenic and acidophilic euryarchaea and the
group metabolism, nicotinamide, pyruvate metabolism and membersof‘TACK’superphylum.Aspreviouslyhypothesised42,
interconversion of pyruvate and acetyl-CoA, trehalose biosynth- the expansion of proteins containing PKD and YVTN
esis, glycogen metabolism and biosynthesis, propionate domains indicates their function in cell–cell interactions. Thus,
metabolism, heme biosynthesis, pentose-phosphate pathway we propose that the very rudimentary metabolic capability of
(non-oxidative phase) and lipopolysaccharides (LPS) synthesis Mia14 indicates a Cuniculiplasma-associated lifestyle and that
are absent. Furthermore, we have not found any substrate-level numerous systems such as type IV pili, surface proteins
phosphorylation pathways. The Mia14 respiratory chain is also and membrane channels provide an interface for the exchange
absent; no Complex I (NADH:ubiquinone oxidoreductase)33, of metabolites, energy, macromolecules including DNA between
Complex II (succinate:quinone oxidoreductase)34, Complex III Mia14 and its host.
(either cytochrome bc complex35 or ACIII36) or Complex IV
1
(heme-copper oxygen reductases)37 proteins-coding genes were
Methods
foundinthegenome.However,thepresenceofH+-translocating
Sampleproceedings.Samplesfromsedimentsandwaterofacidicstreamer
V-type ATP synthase in the organism suggests the activity of
weretakenfortheestablishmentofenrichmentculturesinMarchof2011from
PMF-generatingcomplexes.Theonlycandidatecomplexforthis copper-containingsulfidicores,ParysMountain,Anglesey,NorthWales,UK
roleisthecytochromebdquinoloxidase,whichwasfoundinthe (53°23′13.6′′N4°20′58.6′′W).Theenrichmentculturesweresupplementedwith
genome.Thelackofappropriateendogenouselectrondonorsfor yeastextractandglucoseeachatconcentrationsof0.1%(w/vol)andgrownatpH
this complex in Mia14, which is deficient in isoprenoid quinone 1–1D.2NaAndw3a7s°eCxtirnacAteBdmbyedGiu’NmO15M.EDNAKit(MPBiomedicals).Forthe
biosynthesis,couldbecompensatedbyexogenousquinonesfrom metagenomicstudyandsecondseriesofenrichmentculturesset-upfor
NATURECOMMUNICATIONS|8: 60 |DOI:10.1038/s41467-017-00104-7|www.nature.com/naturecommunications 9
ARTICLE
NATURECOMMUNICATIONS|DOI:10.1038/s41467-017-00104-7
CARD-FISHexperiments,sedimentsandwaterwerecollectedinJuly,2014from (LinarisGmbH,Wertheim-Bettingen,Germany).Atleast200DAPI-stainedand
thesamesamplingspotasinMarch,2011.ThemetagenomicDNAwasisolated Alexa-positivecellswerecountedinaminimumof10fieldsunderanAXIOPLAN
withDNAPowerIsolationKitforSoil(MoBio). 2Imagingmicroscope(Zeiss,Germany).
DNAconcentrationsinallcasesweremeasuredusingVarianCaryEclipse
fluorescencespectrophotometerusingQuant-iTDNAAssayBroadRangeKit
Sequenceanalysisandevolutionaryreconstructions.Proteincodinggenesof
(LifeTechnologies).
Mia14wereassignedtoarchaealClustersofOrthologousGroups(arCOGs)as
follows:PSSMsderivedfromarCOGalignmentswereusedasPSI-BLASTqueries
Genomesequencingandannotation.Thegenomesweresequenced,assembled inasearchagainstadatabaseofarchaealproteinswithe-valuecutoffof10−4.
andannotatedatFidelitySystems,Inc.(Gaithersburg,MD),aspreviously Proteins(fragments)wereassignedtoarCOGswiththehighest-scoringhits55.
reported16.Finalassembliesprovidedca.564and561-foldcoveragesforstrainS5 Also,sequencesofthe56ribosomalproteinsuniversallyconservedinarchaea56
andPM4,respectively16,whileMia14genomewascovered42-fold.GIswere from285organismswithcompletelyoralmostcompletelysequencedgenomes
inspectedusingIslandViewer325usingtwodifferentalgorithms:IslandPath- werealignedusingtheMUSCLEprogram57.Alignmentswereconcatenated;the
DIMOB,basedontheanalysisofmobileelement-relatedgenesanddinucleotide phylogenetictreewasreconstructedusingtheFastTreeprogram58withWAG
distributionbiases43,andSIGI-HMM,exploitingbiasesofcodonusage evolutionarymodelandgamma-distributedsiterates.
implementingahiddenMarkovmodelapproach44.Inmostcases,aftermanual Manualcurationofautomaticfunctionalpredictionswasperformedaccording
inspectionoftaxonomicaffiliationofbestblasthitsofpredictedhorizontally totherecentprotocol59.Inparticular,theproteinsofcentralcarbohydrate
transferredproteins,bothpredictionswereconsideredasGIs.Analysisofproteins pathways(Embden-MeyerhoffandGluconeogenesis,ED,pentose-phosphate,
sharedbetweenMia14andC.divulgatumS5,butabsentinC.divulgatumPM4,was TCA)includingcurrentlyknownarchaealmodifications60weresearchedby
performedbyProteinOrtho23V5.15usingdefaultparameters(10−5blastpe-value, BLAST(withaconsciouslylowe-valuecut-off=1.0toavoidlossofdistantly
50%minimalquerycoverageand25%minimalpercentidentity). relatedsequences)ofsets,includingseveralamino-acidsequencesofbiochemically
Basedonthegenomicdata,thespecificprimersforthedetectionof characterised(mainly,thatwith‘Evidenceatproteinlevel’inSwissprotdatabase)
Mia14-relatedorganismsinenrichmentcultureswere:5′—3′FMicr archaealandbacterialproteinsagainstthegenome(tBLASTn)orinsilico
(GCTTGGCGAATAAGTGCTGGGC)andRMicr(ATCTTGCGACCGTACTC translatedproteome(BLASTp)ofMia14.Ifnohitswithallquerieswerefoundthe
CCCAG). proteinwasregardedasabsent.Ifall/manyofproteinsofthepathwaywereabsent
thepathwaywasregardedasabsent.IfanyBLASThitswereobtained,these
sequenceswereBLASTedagainstUniprotandSwissprot(e-valuethreshold=0.01)
MetagenomesequencingofParysMountaincommunity.Forsequencingofthe andresultedhitsanalysed.Theco-localisationofgenesforaparticularpathway
ParysMountainacidicstreamermetagenome,bothpaired-endandmate-paired wasalsotakenintoaccount.
DNAlibrarieswereused.Pairedendlibrarywaspreparedfrom400ngof arCOGphyleticpatternsofthe15‘DPANN’groupgenomeswereanalysed
enviromentalDNAwithNEBNextUltraDNAlibrarypreparationkit usingtheCOUNTprogram61asdescribedpreviously62.Amatrixwiththe
(NewEnglandBiolabs,Ipswich,USA)accordingtothemanufacturer’sinstructions
numbersoforthologsinthegivenarCOGinthegivenorganismandthetreeofthe
toobtainmeanlibrarysizeof500bp.Mate-pairedlibrarieswerepreparedwith
correspondinggenomeswereusedtoestimatetheparametersofaphylogenetic
NexteraMatePairLibraryPrepKit(IlluminaInc.,SanDiego,CA,USA)usinggel- birthanddeathmodelwithgamma-distributedgain,lossandduplicationrates61.
freeprotocolsuppliedbymanufacturer.Bothlibrariesweresequencedwith
Thesolutionproducesposteriorprobabilitiesforthepresenceorabsenceofagene
2×250bpreadswithMiSeqPersonalSequencingSystem(IlluminaInc.,
inancestralgenomesaswellastheprobabilitiesofgenegainsandlossesonalltree
SanDiego,CA,USA).Aftersequencing,allreadsweresubjectedtostringent branches,providingacomprehensivepictureoftheseeventsintheevolutionary
qualityfilteringwithCLCGenomicsWorkbench8.5(Qiagen,Germany).After historyofthe‘DPANN’group.Thereconstructed‘DPANN’groupancestorwas
filtering,overlappingpaired-endlibraryreadsweremergedwithSeqPreptool comparedtothepreviouslyreconstructedlastcommonancestorofallArchaea63.
(https://github.com/jstjohn/SeqPrep)resultingin4,110,617singlereadsand
ToidentifyactualarCOGsinthreegroups(likelypresent,lost,gained)probability
7,539,176readpairs.MatepairedreadsweretreatedwithNextCliptool45,resulting
ofeacheventmoreorequal50%hasbeenchosenforeachlineageofinterest.
in663,171readpairswithmeaninsertsizeof2170bp.Readswereassembledwith Taxonomicaffiliationsforproteins,encodedinthe10outof15‘DPANN’
metaSPADES46,resultinginmetagenomicassemblyofabout200Mboftotal
genomes(totheexclusionofthethreegenomesintheNanoarchaeotaarchaeon
lengthconsistingof93,342contigswithN50of3295. SCGCAAA011-G17lineageandtwogenomesinthe‘CandidatusHaloredivivus’
ForthebinningformetagenomiccontigstheywerealignedagainstNCBI lineagethathavecloserelativeswithinthe‘DPANN’group)wasassessedby
non-redundantproteindatabaseusingDIAMONDin‘blastx’mode47withe-value
of10−6.ResultsofthealignmentwereimportedtoMEGAN6.4.2248withdefault r7u0n4n,5i9n1gpprrootteeiinnsBfrLoAmST28s6eacrochmpoltehteeraanrdchnaeeaarllygecnoommpelse.teTharechdaaetaablagseencoomnetas,ined
settingsadjustedasfollows:minscore—80,toppercent—10,minsupport—20.
availableatGenBankandtheproteinsetencodedbyMia14.ThetopBLASThit
BinningbyMEGANwasperformedusingdefaultsettings.Aftertheinitial (e-valuethresholdof10−6)outsideoftheselfgenomewasrecordedasan
automaticbinningstep,additionalmanualinspectionwasperformed.Inparticular, approximateindicationofthetaxonomicaffiliationoftheprotein.
contigswithambiguoustaxonomicaffiliation,characterisedbymixedblastxhits
wereeitherreassignedtoabinofahighertaxonomiclevelormovedtothe
‘Unassigned’bin.Cuniculiplasmasp.—relatedandMia14-relatedcontigswere Dataavailability.SequencedatadeterminedinthisstudyareavailableatNCBI
identifiedmanuallyusingblastingtheirgenomesequenceswithblastnagainstthe underBioProjectAccessionPRJNA353339.Genomesequencingandassemblyare
depositedintheGenBankunderAccessionCP019964.Metagenomicreadsand
localParysMountainmetagenomiccontigsnucleotideblastdatabase.
contigsweresubmittedtoMG-RASTandcanbeprovidedfromthecorresponding
Forthecalculationofthetaxonabundance,allmetagenomicreadswere
mappedtothecontigswithBowtie249.Totallengthofallsequencingreads authoruponrequest.
mappedtoeveryparticularbinwascalculatedwithsamtools50.Abundancewas
calculatedasaratiobetweentotallengthsofallsequencingreadstotheaverage Received: 8 March2017 Accepted: 31May 2017
genomesizeofthecorrespondingtaxon(basedonNCBIgenomesdatabase).
RelativeabundancevaluewhichwasusedfortheFig.1wascalculatedasratioof
binabundancetothesumofbinabundances.
CARD-FISH.Sampleswerefixedfor1hatroomtemperaturewithpre-filtered
formaldehyde(finalconcentration2%vol/vol).Sample(dilutedfrom10−1to10−3, References
accordingtocellconcentrations)wasfilteredthrough0.22μm(Ø25mm)
1. Baker,B.J.etal.Lineagesofacidophilicarchaearevealedbycommunity
ppoerlymceaarbboilnisaatteiomnewmabsrpaenrefsor(mNeedwbTyecinhcnuobloatgiioensGforrou1phSwrli,thNlTysGo)z.yCmeell(10mgml−1 genomicanalysis.Science314,1933–1935(2006).
2. Méndez-García,C.etal.Microbialdiversityandmetabolicnetworksinacid
inTEbufferpH8.0)followedbyincubationwithachromopeptidasefor30min
(5mgml−1),bothat37°C.Filterswerecutintosectionsandcellswerehybridised minedrainagehabitats.Front.Microbiol.6,475(2015).
withuniversalhorseradishperoxidase(HRP)-labelledoligonucleotideprobesfor 3. Comolli,L.R.,Baker,B.J.,Downing,K.H.,Siegerist,C.E.&Banfield,J.F.
Eubacteria(EUB338I,II,IIIprobemix)51,52tocheckforbacterialpresenceand Three-dimensionalanalysisofthestructureandecologyofanovel,ultra-small
forArchaea(Arch915)53.Absenceofunspecifichybridisationwascontrolledby archaeon.ISME.J.3,159–167(2009).
implicationofthenonspecificprobeNON338.TheCARD-FISHprobesspecificfor 4. Golyshina,O.V.Environmental,biogeographic,andbiochemicalpatternsof
membersoforderThermoplasmatales(Thpmt-680R),offamilyCuniculiplasma- archaeaofthefamilyFerroplasmaceae.Appl.Environ.Microbiol.77,5071–5078
taceae(Clpm-1100R)andof‘Ca.Mancarchaeumacidiphilum’Mia14 (2011).
(ARM-MIA1469R)weredesignedthroughthisstudy.Detailedinformationabout 5. Baker,B.J.etal.Enigmatic,ultrasmall,uncultivatedArchaea.Proc.NatlAcad.
theprobesisgiveninSupplementaryTable4.Intracellularperoxidasewas Sci.USA107,8806–8811(2010).
inhibitedbytreatmentwith1%HO atroomtemperaturefor20min.Forsignal 6. Petitjean,C.,Deschamps,P.,López-García,P.&Moreira,D.Rootingthe
2 2
amplificationtyramide-Alexa488and-Alexa594wereused54.Thefiltersections domainArchaeabyphylogenomicanalysissupportsthefoundationofthenew
werecounter-stainedwith4′,6-diamidino-2-phenylindole(DAPI)(2μgml−1)ina kingdomProteoarchaeota.GenomeBiol.Evol.7,191–204(2014).
four-to-oneratioofCitifluor(CitifluorLtd,Leicester,UK):Vectashield 7. Forterre,P.Theuniversaltreeoflife:anupdate.Front.Microbiol.6,717(2015).
10 NATURECOMMUNICATIONS|8: 60 |DOI:10.1038/s41467-017-00104-7|www.nature.com/naturecommunications
Description:Cytochrome c biogenesis CcdA. PIastocyanin/azurin/halocyanin family protein. Fructose-1,6-bisphosphatase. Glycogen synthase. Glucose-6- . implementing a hidden Markov model approach44. In most cases, after manual inspection of taxonomic affiliation of best blast hits of predicted horizontally.