Table Of ContentScherholzetal.BMCEvolutionaryBiology (2017) 17:81
DOI10.1186/s12862-017-0919-x
RESEARCH ARTICLE Open Access
Ancestral and novel roles of Pax family
genes in mollusks
Maik Scherholz1, Emanuel Redl1, Tim Wollesen1, André Luiz de Oliveira1, Christiane Todt2
and Andreas Wanninger1*
Abstract
Background: Paxgenesaretranscriptionfactorswithsignificantrolesincellfatespecificationandtissuedifferentiation
duringanimalontogeny.Mostinformationontheirtempo-spatialmodeofexpressionisavailablefromwell-studied
modelorganismswherethePax-subfamiliesPax2/5/8,Pax6,andPaxα/βaremainlyinvolvedinthedevelopmentofthe
centralnervoussystem(CNS),theeyes,andothersensoryorgans.Incertaintaxa,Pax2/5/8seemstobeadditionally
involvedinthedevelopmentofexcretionorgans.Dataonexpressionpatternsinlophotrochozoans,andinparticularin
mollusks,areveryscarceforalltheabove-mentionedPax-subfamilies,whichhampersreconstructionoftheirputative
ancestralrolesinbilateriananimals.Thus,westudiedthedevelopmentalexpressionofPax2/5/8,Pax6,andthe
lophotrochozoan-specificPaxβintheworm-shapedmolluskWireniaargentea,amemberofAplacophorathattogether
withPolyplacophoraformstheAculifera,theproposedsistertaxontoallprimarilysingle-shelledmollusks(Conchifera).
Results:AllinvestigatedPaxgenesareexpressedinthedevelopingcerebralgangliaandintheventralnervecords,
butnotinthelateralnervecordsofthetetraneuralnervoussystem.Additionally,Pax2/5/8isexpressedinepidermal
spicule-secretingorassociatedcellsofthelarvaltrunkandintheregionofthedevelopingprotonephridia.Wefound
noindicationforaninvolvementoftheinvestigatedPaxgenesinthedevelopmentoflarvaloradultsensoryorgans
ofWireniaargentea.
Conclusions:Pax2/5/8seemstohaveaconservedroleinthedevelopmentoftheCNS,whereasexpressioninthe
spicule-secretingtissuesofaplacophoransandpolyplacophoranssuggestsco-optioninaculiferanskeletogenesis.The
Pax6expressionpatterninAculiferalargelyresemblesthecommonbilaterianexpressionduringCNSdevelopment.
AlldataavailableonPaxβexpressionargueforacommonroleinlophotrochozoanneurogenesis.
Keywords:Mollusca,Aculifera,Lophotrochozoa,Tetraneuralnervoussystem,Paxgenes,Geneexpression,
Neurogenesis,Development,Evolution,EvoDevo
Background Neomeniomorpha or Solenogastres and Chaetodermo-
The morphological diversity of the phylum Mollusca is morphaor Caudofoveata)and the primarilysingle-shelled
represented by eight recent clades, including the well- Conchifera (Monoplacophora, Gastropoda, Cephalopoda,
known gastropods, bivalves, and cephalopods. This Scaphopoda, Bivalvia) [1–3]. The vermiform Neome-
bodyplan plasticity renders mollusks an ideal target for niomorpha represents one of the least investigated
evolutionary and developmental studies. Although nu- molluscan taxa, although recent comparative studies
merous aspects of intra-molluscan relationships are still have demonstrated its importance to reconstruct
controversially discussed, recent phylogenomic analyses ancestral aculiferan traits [4, 5].
show a basal dichotomy comprising the monophyletic The adult neomeniomorph nervous system reflects the
Aculifera (including the eight-shelled Polyplacophora specific molluscan condition of an esophageal nerve
and the shell-less, spicule-bearing aplacophoran clades ring, which includes a cerebral ganglion as well as a
paired pedal ganglion. Two lateral (visceral) nerve cords
*Correspondence:[email protected] emanate from the cerebral ganglion, while the pedal
1DepartmentofIntegrativeZoology,FacultyofLifeSciences,Universityof
ganglia give rise to a pair of ventral (pedal) nerve cords.
Vienna,Althanstraße14,1090Vienna,Austria
Fulllistofauthorinformationisavailableattheendofthearticle Together, these four longitudinal nerve cords form the
©TheAuthor(s).2017OpenAccessThisarticleisdistributedunderthetermsoftheCreativeCommonsAttribution4.0
InternationalLicense(http://creativecommons.org/licenses/by/4.0/),whichpermitsunrestricteduse,distribution,and
reproductioninanymedium,providedyougiveappropriatecredittotheoriginalauthor(s)andthesource,providealinkto
theCreativeCommonslicense,andindicateifchangesweremade.TheCreativeCommonsPublicDomainDedicationwaiver
(http://creativecommons.org/publicdomain/zero/1.0/)appliestothedatamadeavailableinthisarticle,unlessotherwisestated.
Scherholzetal.BMCEvolutionaryBiology (2017) 17:81 Page2of20
molluscan tetraneural nervous system [6–10] (see also longitudinal neurite bundles emerge simultaneously from
Fig. 1). During early stages of neomeniomorph neuro- boththeanteriorand theposteriorpoleandsubsequently
genesis the subsidence of epidermal cells results in two fuseintheregionoftheprototroch,thelocomotiveciliary
lateral depressions of the anterior larval episphere (often band of the free-swimming larva [13] (Fig. 1a). This for-
termed “ectodermal cerebral depressions”), which give mationofanintermediatestagewithasinglepairofnerve
rise to the anlagen of the cerebral ganglion [11, 12]. cordshasrecentlybeeninterpretedasaputativeancestral
Before the tetraneural condition is established, two featureofspiralianneurogenesis[13].
Fig.1Summaryofneomeniomorphneurogenesisandadultneuroanatomy.aSchematicrepresentationofneomeniomorphneurogenesisfrom
thefreshlyhatchedtestcelllarvauntilthejuvenilestage.Anteriorfacesup.Neuralstructuresaredrawninyellow.ReconstructionbasedonRedl
etal.(2014).bConfocalscan(maximumintensityprojection,colordepthcoding)oftheadultCNS,anteriorregion.Anteriortotheright.Anti-
serotonin(5-HT)staining.cSameconfocalscan(maximumintensityprojection)asin(b),butwithadditionalnucleicacidstaining(DAPI)toreveal
nucleiofthecerebralganglia.dSchematicrepresentationoftheposteriorandanteriormajorelementsoftheadultnervoussystemofWireniaargentea
basedon(b)and(c)aswellasTodtetal.(2008).Abbreviations:vestibular(atrial)senseorgan(vso);basalganglion(bg);buccalcommissure(buc);
buccalganglion(bug);cerebralganglion(cg);dorsoterminalsenseorgan(dts);frontalganglia(fg);innervationofvestibular(atrial)senseorgan(iv);
innervationofpedalpit(ip);lateralganglion(lg);lateroventralcommissure(lvc);mouth(m);pedalganglion(pg);pedalpit(pp);posteriorganglion
(pog);ventralcommissure(vc);ventralneuralplexus(vnp);nervesofpedalpit(arrowhead);lateral(visceral)nervecord(arrow);ventral(pedal)nerve
cord(doublearrowhead);mouthopening(asterisk).Scalebars:100μm
Scherholzetal.BMCEvolutionaryBiology (2017) 17:81 Page3of20
Adult neomeniomorphs lack eyes but do exhibit sev- therecentlydiscoveredPaxα/βsubfamilyandhashitherto
eral sensory organs, including a vestibular (atrial) sense beenexclusively studied in the leech Helobdella austinen-
organ and adorsoterminal sense organ thatis often con- sis [33–35]. Late embryos of H. austinensis show broad,
sideredahomologoftheosphradiumofothermolluscan segmentally restricted mesodermal expression as well
clades [6, 14–16] (Fig. 1b, c, d). Additionally, some neo- as expression in the CNS and eyes during organogen-
meniomorphs exhibit a pedal commissural sac that was esis [33]. So far, the expression pattern of Paxα (the
suggested to serve as a geosensory organ [17]. Similar to deuterostome and ecdysozoan Paxβ ortholog) is ex-
many other spiralians, neomeniomorph larvae exhibit an clusively known from the onychophoran Euperipa-
apical organ with a ciliary tuft [13, 18]. Interestingly, and toides rowelli [35].
in contrast to the aplacophoran clades, representatives Inordertofurtherassessputativeancestralversusnovel
of the Polyplacophora exhibit ventrally positioned roles of these important developmental regulators, we
posttrochal larval eyes, which are lost some time after hereprovidethefirstdetailedstudyofselectedPaxfamily
metamorphosis. genes in a hitherto largely neglected but evolutionarily
Thehighlyconservedpairedbox(Pax)genesencodefor highlyimportantmolluscanclade,theNeomeniomorpha.
a family of metazoan transcription factors, which are
crucial for cell fate specification and tissue differentiation Methods
and are known to be involved in the development of ex- Animalcultures
cretory organs, myogenesis, neurogenesis, biomineralisa- Adult and developmental stages of the neomeniomorph
tion processes (skeletogenesis), and the development of Wirenia argentea Odhner, 1921 were collected, main-
visual and geosensory systems in numerous bilaterians tained, and reared from January to May 2012, November
(e.g., [19–21]). Although neomeniomorph larvae lack a 2012toFebruary2013,andfromNovembertoDecember
number of sensory organs such as eyes and statocysts, 2013, respectively, following Redl et al. [13] with the
theypossess Pax genes whose orthologs havea conserved following modifications during the last season: The sedi-
function in neurogenesis and sensory organ development. ment sample was kept in 20μm-filtered and UV-sterilized
This poses the question as to where these genes are seawaterwithasalinityof35‰(FSSW)precooledto4°C.
expressedduringtheontogenyofneomeniomorphs. Every four days the adult specimens were transferred to
Pax2/5/8 is known to be involved in the development clean plastic jars with fresh FSSW, which increased egg
of excretory systems of certain annelids, onychophorans, laying productivity. The freshly laid eggs were transferred
vertebrates,aswellasintheformationofauditory/geosen- intocleanplasticjarswithFSSWandkeptunderthesame
sory systems and in establishing the midbrain/hindbrain conditions as the adults. After hatching Wirenia develops
boundary of vertebrates as well as the deutocerebrum/ via the so-called pericalymma or test cell larva. Herein,
tritocerebrum boundary of ecdysozoans [22–24]. The age of the larvae isgiven indaysposthatching(dph).We
developmental expression and putative function of Pax2/ fixed four morphologically distinguishable stages: freshly
5/8 has also been studied in a few lophotrochozoan taxa hatched testcelllarva (0–1 dph), early testcell larva(6–7
[25–28].Inmollusks, Pax2/5/8isexpressed duringdevel- dph), mid-stage test cell larva (10–11 dph), and late test
opmentofmultimodalsensorysystemsofgastropods[25], celllarva(14–15dph),wherebyeachstageencompassesa
polyplacophorans, and cephalopods [27]. Furthermore, developmentaltimerangeofapproximately24h.
Pax2/5/8 is expressed in the mantle of gastropods, poly-
placophorans, bivalves, and cephalopods, which is known Immunochemistry
toberichinsensorystructures[25,27].Inthepolychaete Relaxation, fixation, storage as well as all immunocyto-
annelid Platynereis dumerilii Pax2/5/8 expression was chemical procedures followed standard protocols as
found during development of photoreceptor cells of re- described in detail in Redl et al. [13] and Scherholz et al.
generating segments [29], while in the leech Helobdella [5],respectively.
austinensis Pax2/5/8 expression is confined to the neu-
roectoderm of the developing ventral nerve cords and to RNAextractionandfixationofanimals
thedevelopingnephridia[26].ArecentstudyofPax6and All molecular biological procedures, ranging from RNA
Pax2/5/8 in two brachiopods suggested that these genes extraction until the end of the in situ hybridization
have a putative role as regulators of the segment polarity protocol, were conducted using RNase-free (or diethyl-
geneengrailed,althoughfurtherdetailsremainvague[28]. pyrocarbonate (DEPC)-treated) water. Total RNA was
Pax6isgenerallyinvolvedin the developmentofthe bila- extracted from larvae using the Qiagen RNeasy Mini Kit
teriancentralnervoussystem(CNS)andisakeyplayerin (Qiagen,Venlo,The Netherlands) with the QIAshredder
eye gene regulatory networks of most bilaterians, includ- homogenizer (Qiagen). Prior to RNA extraction the
ing cephalopod and polyplacophoran mollusks [30–32]. larval material was either shock frozen on dry ice or
Paxβ represents the lophotrochozoan-specific ortholog of conserved in RNAlater. Additional RNA was extracted
Scherholzetal.BMCEvolutionaryBiology (2017) 17:81 Page4of20
from adult specimens. In order to separate animal tissue Akaike Information Criterion (AIC) as implemented in
from the gut content and to avoid contamination, all ProtTest3[41].Thefollowingparameterswereemployed
adult specimens were starved for at least two weeks in MrBayes: Jones-Taylor-Thornton model of amino-acid
priortoRNAextraction.AdultRNAwasextracted using substitution[42];sixratescategoriesforthegammadistri-
TRI reagent (Sigma-Aldrich) according to the manufac- bution; 30,000,000 generations; sample frequency 1,000.
turer’s instructions with the optional centrifugation step After the removal of25% ofthe sampled trees as burn-in,
after homogenization and the following modifications: the final phylogenetic tree was created and subsequently
The animals were shock frozen with dry ice immediately edited with FigTree v1.4.2 (http://tree.bio.ed.ac.uk/soft-
before homogenization and RNA precipitation was per- ware/figtree/;[43]).Theresultingillustrationwasmodified
formed with a 1:1 mixture of isopropanol and a high salt withAdobeIllustratorCC2015(AdobeSystems,SanJosé,
precipitation solution containing 0.8mol/l trisodium California,USA).
citrate dihydrate and 1.2mol/l sodium chloride. RNA
pelletsweredissolvedinwaterandstoredat −80°C. Genecloningandprobesynthesis
Advancedlarvalstageswererelaxedpriortofixationfor Oligonucleotide primers were designed from contigs
20to30minat4°Cbyaddinga3.2%magnesiumchloride using Geneious, Version 6.1.6 (Biomatters, Auckland,
solution. Developmental stages were fixed for in situ New Zealand). Thus, the defined gene fragments include
hybridization with 4% paraformaldehyde (PFA) in 0.1M the entire sequences of the conserved Paired domain
MOPS buffer (with 0.5M/l NaCl, 2mM/l MgSO , and and its flanking 5′ and 3′ ends in case of War-Pax2/5/8
4
1mM/l EGTA added) for 45 min at room temperature and War-Paxβ, whereas the gene fragment of War-Pax6
(RT). Fixed larvae were stepped into precooled (4°C) or comprises a partial sequence of the conserved prd-class
prechilled (−20°C) 75% EtOH, washed three times for a homeodomain(andtheflanking3′endofthisconserved
total period of 15–30 min in precooled (4°C) or for 45 region), which is entirely lacking in the Paxβ paralog
min to 1.5 h in prechilled (−20°C) 75% EtOH, and stored and partially lacking in the Pax2/5/8 paralog. Specific
infresh75%EtOHat−20°C. primers and fragment lengths of probes are available in
Table 2. Primers were synthesized by Invitrogen, Life
RNAseqandtranscriptomeassembly Technologies. The nucleotide sequences as well as the
Larval and adult RNA samples were pooled and se- amino acid sequences of the amplified fragments have
quenced by Illumina technology (Eurofins, Ebersberg, been deposited at NCBI GenBank (seeTable 1 for acces-
Germany). Sequencing and bioinformatic processing sion numbers). PCR amplification was performed on a
of the resulting paired-end libraries as well as the cDNA library synthesized from combined mixed-stage
transcriptome assembly were performed as described embryonic and adult total RNA. cDNA was synthesized
in Redl et al. [36]. using a 1st Strand cDNA Synthesis Kit for RT-PCR
(AMV) (Roche, Basel, Switzerland). Amplified fragments
Geneidentificationandorthologyassignment were cloned into pGEM-T Easy Vector System I (Pro-
We identified candidate genes in our transcriptome mega, Madison, WI, USA) and the plasmids were used
database by reciprocal BLAST [37] searches using bila- to transform E. coli JM109 Competent Cells (Promega).
terian Pax gene sequences from NCBI GenBank as quer- Plasmids were extracted from minipreps using the QIA-
ies. Nucleotide sequences of the best-fitting contigs were prep Spin Miniprep Kit (Qiagen) and sequenced by
translated into amino acid sequences using Geneious, Microsynth (Vienna, Austria). Obtained sequences were
Version6.1.6(Biomatters,Auckland,NewZealand). comparedtoknownPaxsequencesfromNCBIGenBank
Gene orthology was determined by phylogenetic re- and to the original contigs of the Wirenia argentea tran-
construction. FASTA-formatted files were generated scriptome using the BLAST program and Geneious,
with the inferred amino acid sequences for cloned genes Version 6.1.6. The linear template for probe synthesis
and representative homologs from other bilaterian taxa was generated via standard PCR using GoTaq Flexi
(seeTable 1 for accession numbers). Sequence alignment DNA Polymerase reagents and M13 forward and reverse
was performed with the online version of MAFFT primers (FFW 5′-GTTTTCCCAGTCACGACGTT-3′,
(http://www.ebi.ac.uk/Tools/msa/mafft/; [38]) with the annealing temperature: 60°C; REV 5′-GACCATGATT
following modifications to the standard setting: MAXI- ACGCCAAGCTA-3′, annealing temperature: 60°C).
TERATE→100 (long run); PERFORM FFTS→local- Amplified products were purified using the GeneJET
pair. The resulting alignment was checked and manually PCR Purification Kit (Thermo Fisher Scientific,
edited using BioEdit [39] to remove non-conserved re- Waltham, MA, USA) and subsequently used as tem-
gions. The phylogenetic analysis was carried out with plates for anti-sense RNA probe syntheses. Synthesis
the Bayesian phylogenetic program MrBayes v.3.2.6 [40]. reaction was performed using a DIG RNA Labeling
A specified evolutionary model was determined using Kit (SP6/T7) (Roche Life Science). 2μl of 100mM
Scherholzetal.BMCEvolutionaryBiology (2017) 17:81 Page5of20
Table1GenBankaccessionnumbersofgenesusedinthephylogeneticanalysis
Species Phylum Gene GenBankaccessionnumber
* Wireniaargentea Mollusca Paxβ [KY488206]
* Acanthochitonacrinita Mollusca Paxβ [KY488203]
Aplysiacalifornica Mollusca Paxβ [DAA12510]
Lottiagigantea Mollusca Paxβ [DAA12512]
Capitellateleta Annelida Paxβ [DAA12511]
Helobdellaaustinensis Annelida Paxβ2 [ABQ45871]
Schmidteamediterranea Platyhelminthes Paxβ2 [DAA12514]
Euperipatoidesrowelli Onychophora Paxα [AJG44471]
Triboliumcastaneum Arthropoda Pox-neuro [EFA07416]
Drosophilamelanogaster Arthropoda Pox-neuro [AAA28832]
Saccoglossuskowalevskii Hemichordata Pox-neuro [NP_001158393]
* Wireniaargentea Mollusca Pax2/5/8 [KY488205]
Acanthochitonacrinita Mollusca Pax2/5/8 [ALM30867]
Platynereisdumerilii Annelida Pax2/5/8 [AGC12568]
Crassostreagigas Mollusca Pax2A [EKC36239]
Saccoglossuskowalevskii Hemichordata Pax2/5/8 [ADB22664]
Euperipatoidesrowelli Onychophora Pax2/5/8 [AJG44467]
Gallusgallus Chordata Pax2 [NP_990124]
Branchiostomabelcheri Chordata Pax2 [ABK54277]
Triboliumcastaneum Arthropoda Pax2/5/8 [EFA01334]
Cionaintestinalis Chordata Pax2/5/8 [NP_001027652]
Capitellateleta Annelida Pax3/7 [ABC68267]
Branchiostomabelcheri Chordata Pax3/7 [ABK54280]
Octopusbimaculoides Mollusca Pax3/7 [ACR19857]
Sepiaofficinalis Mollusca Pax3/7 [AHG12548]
Crassostreagigas Mollusca Pax7 [EKC41820]
Cionaintestinalis Chordata Pax1/9 [BAA74829]
Terebrataliatransversa Brachiopoda Pax1/9 [AJV21320]
Ptychoderaflava Hemichordata Pax1/9 [BAA78380]
Branchiostomabelcheri Chordata Pax1/9 [ABK54274]
* Wireniaargentea Mollusca Pax6 [KY488204]
* Acanthochitonacrinita Mollusca Pax6 [KY488202]
Doryteuthisopalescens Mollusca Pax6 [AAB40616]
Euprymnascolopes Mollusca Pax6 [AF513712]
Idiosepiusparadoxus Mollusca Pax6 [BAM74253]
Terebrataliatransversa Brachiopoda Pax6 [ADZ24784]
Lineussanguineus Nemertea Pax6 [CAA64847]
Platynereisdumerilii Annelida Pax6 [CAJ40659]
Saccoglossuskowalevskii Hemichordata Pax6 [NP_001158383]
PaxsequencesofNeomeniomorphaandPolyplacophoraretrievedfromourtranscriptomicdataarelabeledbyasterisk
dithiotreitol (DTT) were added to the transcription re- Protector RNase Inhibitor (Roche Life Science) was
action and, after the reaction, template DNA was re- added after dissolving the RNA pellet in water.
moved by incubation with DNase I, RNase free (Roche RNA probes for in situ hybridization were stored at
Life Science). Precipitation of RNA was done at −80°C. −80°C.
Scherholzetal.BMCEvolutionaryBiology (2017) 17:81 Page6of20
Table2PrimersusedforPCR
Gene Fragmentlength(inbases) Direction Primersequence
War-Pax2/5/8 426 Forward CAGATTTTCTGTCGGACTTCCTCTGATGTC
Reverse GACCCTAACGGTCACGGAGGAGTAAAC
War-Pax6 709 Forward GAATTTGAGAGGACACATTATCCAGAC
Reverse GACATAATATATCCGGATCTCCATATTCG
War-Paxβ 667 Forward GCATGGAAAGGTGAGAGTAGATGATTC
Reverse GTAACAGATTCTAACGTGATCAACCAC
Whole-mountinsituhybridization 0.15M/l sodium chloride and 0.1% Tween 20. Subse-
Samples stored in 75% EtOH were stepped into 4% PFA quently,thesampleswerewashedthricefor5mineachat
in 1x Roti-Stock phosphate buffered saline (pH=7.4; RT in 0.1M maleic acid buffer (MAB) with 0.15M/l so-
PBS; Carl Roth) with 0.05M/l EGTA (PPE) and decalci- dium chloride and 0.1% Tween 20 (pH=7.5). Blocking of
fied in PPE for 1h at RT. Subsequently, samples were unspecific bindingsites wasdonefor 3h atRTwitha2%
washed six times for 5 min eachinPBS with0.1%Tween solution of Blocking Reagent (Roche Life Science) in
20 (PBT; Carl Roth) at RTand then heated to 37°C in a MAB. Anti-Digoxigenin (DIG)-AP, Fab fragments (Roche
water bath during the last washing step. Proteinase K Life Science, Ref. 11093274910) were applied in a
treatmentwasdonewithasolutionof10μg/mlProteinase 1:2,500 or 1:5,000 dilution in 2% block solution for 13–
K(RocheLifeScience)inPBTfor10minat37°Cwithout 16 h at 4°C. After incubation, the samples were rinsed
agitation. The specimens were then washed twice for 5 eight times for 20 min each at RT in PBT, twice for 5
mineachatRTinPBT,twicefor5mineachin1%trietha- min each without agitation in 0.1M Tris buffer with
nolamine (TEA) in PBT, four times for 5 min each in an 0.1M/l sodium chloride (pH=9.5; AP buffer) and 0.1%
instantly made mixture of 0.3% acetic anhydride and 1% Tween 20, and twice for 10 min each without agitation
TEA in PBT, and again twice for 5 min each in PBT. in AP buffer with 50mM/l magnesium chloride and
Afterwards, the sampleswerepostfixed in4%PFA inPBS 0.1% Tween 20. Finally, all samples were transferred into
for 45min atRTand washed fivetimes for 5 min each at stainingbuffer(APbufferwith50mM/lmagnesiumchlor-
RT in PBT. Samples were subsequently stepped into the ide, 7.5% polyvinyl alcohol, and 20μl/ml NBT/BCIP stock
hybridization buffer (HB) consisting of 50% formamide solution (Roche Life Science)). Color reaction took place
with0.075M/ltrisodiumcitrate,0.75M/lsodiumchloride, at 4°C for 3–8 h (depending on probe, probe concentra-
5mM/l EDTA, 50μg/ml heparin sodium salt (Sigma-Al- tion,andDIGconcentration)andwasstoppedbywashing
drich),1xDenhardt’sSolution(CarlRoth),100μg/mlRNA twice in 0.1M glycine in PBT (pH=2.2) followed by add-
from torula yeast, Type VI (Sigma-Aldrich), and 5% itionaltwowashesinPBT,5mineach.Stainedspecimens
dextransulfatesodiumsaltfromLeuconostocspp.(Sigma- werethenfixedfor12–24hat4°Cin4%PFAinPBS,sub-
Aldrich). The samples were then transferred into fresh sequentlyrinsedfourtimesforatleast5mineachinPBT,
HB, heated in a water bath to 56°C (in case of the Pax6 andfinallystoredinPBTat4°C.
probe) or 60°C (in case of Pax2/5/8 and Paxβ), respect-
ively, and prehybridized at these specific temperatures for Mountingandclearing
15–20 h. All RNA probes were diluted in HB to a final Larval stages were stepped into deionized water and
concentrationof1–2μg/ml,denaturedfor10minat85°C, washedfourtimesfor5mineachindeionizedwater.Lar-
and applied to the samples. Hybridization was conducted vaewerethensteppedintoEtOHandwashedthricefor5
for24–26hatthespecifictemperaturesof56°Cand60°C, mineachin100%EtOH.Next,thelarvaeweretransferred
respectively.Then,thesampleswerekeptathybridization into a 1:1 mixture of benzyl benzoate and benzyl alcohol,
temperature and washed three times for 20 min each in andsubsequentlymountedinthismediumonmicroscope
pre-warmed 50% formamide with 0.06M/l trisodium cit- slides. Approximately 250 specimens were processed and
rate, 0.6M/l sodium chloride, and 0.1% Tween 20, twice investigated intotal and 81(25 withPax2/5/8expression,
for20mineachin50%formamidewith0.03M/ltrisodium 31 with Pax6 expression, and 25 with Paxβ expression)
citrate, 0.3M/l sodium chloride, and 0.1% Tween 20, and werescannedwithaconfocalmicroscope.
three times for 15 min each in 50% formamide with
0.015M/l trisodium citrate, 0.15M/l sodium chloride, and Microscopy,3Drendering,andimageprocessing
0.1% Tween 20. The samples were then placed at RT to Specimens were analyzed and light micrographs were
cool down. Afterwards, they were washed thrice for 20 taken on an Olympus BX53 microscope equipped with
min eachat RT in0.015M trisodium citrate solution with an Olympus DP73 camera and the software cellSens
Scherholzetal.BMCEvolutionaryBiology (2017) 17:81 Page7of20
Standard,Version 1.11 (Olympus Corporation, Shinjuku, arrangement of the covering test cells (Fig. 3; see also
Tokyo, Japan). Confocal laser scanning microscopy was Additional file 1). In freshly hatched test cell larvae the
conducted using a Leica DMI6000 CFS microscope posterior hyposphere is composed of two rows of test
equipped with a Leica TCS SP5 II scanning system cellswithtwo additional posteriormost andlaterallypo-
(Leica Microsystems, Wetzlar, Germany) and software sitioned cells (Fig. 2a, b) [12]. The anterior episphere
LAS AF, Version 2.6.0 or 2.6.3. The autofluorescent sig- contains two rows of five test cells each. Both rows are
nal was scanned in fluorescence mode using a 405 nm arranged such that the median Z-axes of the upper cells
laser and gene expression signal was scanned in reflec- align with the cell-cell boundary of the row below
tion mode using a 633nm laser (see [44–47]). The ob- (Fig. 3a, b, c, f). Additionally, the episphere features six
tained confocal image stacks were processed and used to knob-like structures (most likely either small cells or
prepare 3D reconstructions ofthe gene expression signal cell protuberances), two dorsolaterally, two laterally,
as well as 3D renderings of larval tissue with Imaris x64, and two ventrally located,whicharebilaterallyarranged
Version 7.3.1 (Bitplane AG, Zurich, Switzerland). The (Fig. 3f). The epispheric arrangement of bilateral knob-
same software was used to create video files of larval like structures and the two rows of test cells with op-
stagesincluding geneexpressionpatterns.Generatedim- posing configuration always correlates with the ventral
ages were finally processed with Adobe Photoshop CS6 mouth opening of the advanced larval stages. This, in
Extended,Version 13.0.1 x64, and Adobe Photoshop CC combination with the two posteriormost and laterally
2015 (Adobe Systems). Figures and schematic drawings positioned test cells of the freshly hatched test cell lar-
were generated with Adobe Illustrator CS5, Version vae, allows for determining the dorso-ventral axis in
15.0.0 and Adobe Illustrator CC 2015, Version 1.0 larval stages that still lack significant gross morpho-
(Adobe Systems). logical features such as the ventral mouth opening.
Larval development of Wirenia is characterized by the
Results outgrowth of a posterior trunk from the base of the
LarvalmorphologyoftheneomeniomorphWirenia pseudo-blastopore, resulting in a mushroom-like appear-
argentea ance of later stages. The first external indication of this
Wireniaargenteadevelopsviaalecithotrophictrochophore- outgrowing trunk is visible in the early test cell larva, in
like larva, the so-called pericalymma or test cell larva. which the major part of the developing trunk is still
The bell-shaped freshly hatched test cell larva features masked by the outer apical cap (Fig. 3). This mode of
an anterior episphere with an apical tuft and a posterior formationresultsinanepidermalfoldenclosingthe“peri-
hyposhere with posterior invagination, the so-called imaginalspace”(“Peri-Imaginalraum”sensuSalvini-Plawen
“pseudo-blastopore” [12](Fig.2a).Theepisphereissep- [48]), which is lined by the epidermal cell layer of the
arated from the hyposphere by the ciliary prototroch outgrowingtrunk onbothsides (Fig.3d, e). Theearly test
formed by one row of trochoblasts (Fig. 2a). All exam- celllarvaalreadyexhibitsaventralmouthopeningandthe
ined larval stages of Wirenia reveal a characteristic cell developing foregut but lacks the two posteriormost test
Fig.2MorphologyofafreshlyhatchedW.argentealarva.Dorsal(d)–ventral(v),left(l)–right(r),andanterior(a)–posterior(p)axesindicatethe
orientation.aOpticalsectionofanautofluorescencescanofafreshlyhatchedtestcelllarvawithanteriorfacingup.Dashedlineindicatesthe
prototroch,whichseparatestheepisphere(ep)fromthehyposphere(hy).b3Dvolumerenderingbasedonanautofluorescencescan.Posterior
viewonthelarvalhyposphereandtheinvaginationofthepseudo-blastoporeofthesamespecimenasin(a).Abbreviations:cellsoftheapical
organ(ao);episphere(ep);hyposphere(hy);lateraldepression(ld);nucleus(n);pseudo-blastopore(pb);trochoblast(tb);testcell(tc);thetwomost
posteriorlyandlaterallypositionedtestcells(arrowhead).Scalebars:50μm
Scherholzetal.BMCEvolutionaryBiology (2017) 17:81 Page8of20
Fig.3LinedrawingsofgrossmorphologyoftheearlyW.argentealarva.Schematicdrawingofanearlytestcelllarva(6-7daysposthatching)
basedonautofluorescenceconfocalscans.Anteriorfacesupin(a)-(e)andtowardstheviewerin(f).aVentralview.bLateralviewfromtheright.
cDorsalview.dHorizontalsection.eSagittalsection.fAnteriorviewoftheepisphereshowinglateraldepressions.Notethecharacteristiccell
arrangementoftworowsoftestcellsinthehyposphere,tworowsoftestcellswithopposingconfigurationintheepisphere(grey/darkgrey),and
sixbilaterallyarrangedcellsorcellprotuberances(orange)intheepisphere.Dorsal(d)–ventral(v)andleft(l)–right(r)axesindicatetheorientation.
Abbreviations:apicaltuft(at);lumenofforegut(fg);posteriorknob-likestructure(ks);lateraldepression(ld);peri-imaginalspace(pis);prototroch
(pt);trochoblast(tb);testcells(tc);epidermisofthetrunk(te);telotroch(tt)
cells of the freshly hatched test cell larva. The typical (Fig. 4) [50]. Another Pax gene-specific element is a so-
mushroom-like appearance of later stages is recognizable called prd-class homeodomain, which is present in the
in the mid-stage test cell larva, where the trunk is elon- paralogs Pax-eyg, Pax3/7, and Pax4/6/10 as well as
gated. Late test cell larvae are already in the settlement partially present in Pax2/5/8 but absent in all other Pax
phaseandtheapicalcapandthecoveringtestcellsstartto paralogs (Fig. 4).
degenerate. The length of this phase varies individually Our multiple sequence alignment includes bilaterian
andcanlastforseveraldays[12].Atthisstage,theposter- orthologsofall Pax subfamiliesandcomprised,ifpresent,
ior trunkis already thickened,elongated,anddorsally and theconservedN-terminalPaireddomain,theoctapeptide,
laterally covered by spicules. The ventral trunk exhibits a the prd-class homeodomain, and other conserved C-
ventrolongitudinal ciliary band, which marks the develop- terminal domains (Fig. 4). Although our transcriptomic
ingcreepingsole. data revealed only partial sequences of War-Pax6 and
Acr-Pax6, BLAST searches against bilaterian Pax ortho-
Geneorthologsandphylogeneticanalysis logs and the presence of diagnostic conserved domains
Seven bilaterian Pax groups or subfamilies have been (i.e., prd-class and transactivation domain) identified the
identified by the presence or absence of highly con- two aforementioned molluscan sequences as true Pax
served structural domains [49]. All Pax genes exhibit a genes (Fig. 4). The phylogenetic analysis demonstrates
conserved N-terminal Paired domain, whereas the ori- that all translated neomeniomorph and polyplaco-
ginally existing octapeptide was lost in the paralogs phoran Pax amino acid sequences (War-Pax2/5/8, War-
Pax4/6/10, Paxα/β, and Pax-eyg but is still present in Pax6, War-Paxβ, Acr- Pax6, Acr-Paxβ) cluster with
the paralogs Pox-neuro, Pax1/9, Pax2/5/8, and Pax3/7 their corresponding bilaterian orthologs (Fig. 5).
Scherholzetal.BMCEvolutionaryBiology (2017) 17:81 Page9of20
Fig.4AlignmentofW.argenteaPaxgenesandbilaterianorthologs.AlignmentofpredictedaminoacidsequencesofvariousbilaterianPax
genesincludingWar-Pax2/5/8,War-Pax6,War-Paxβ,Acr-Pax6andAcr-Paxβ(labeledwithasterisk).TheconservedN-terminalPAIREDdomain(red),
and,ifpresent,theoctapeptide(green)andthe(partial)prd-classhomeodomain(blue)areshown,whiletheC-terminaltransactivationdomainis
omitted.GenBankaccessionnumbersofallencodinggenesusedarelistedinTable1
Pax2/5/8expression domains (Fig. 6j) shows that the anterior expression do-
The free-swimming, freshly hatched test cell larvae ex- mains are located in cells or compartments of the anlagen
press War-Pax2/5/8 in three pretrochal domains, two of of the cerebral ganglia. Several War-Pax2/5/8-expressing
thembilaterallyorientatedandathirdonelocatedmedio- cells lie close to the region of the cerebral commissure (#1
ventrally(Fig.6a-d;seealsoAdditionalfile2).Thetwobi- in Fig. 6i, j), whereas other War-Pax2/5/8-expressing cells
lateral domains are each expressed in a single ectodermal arelocatedmorelaterallyand adjacenttothesinglerow of
cell, which lies adjacent and anterior to the trochoblasts trochoblasts(#2inFig.6h,i,j).Furthermore,War-Pax2/5/
(Fig.6b)atthebaseofthelateraldepressions.Themedio- 8isexpressedintheepidermalcelllayeroftheoutgrowing
ventral domain likewise lies adjacent and anterior to the trunk,whichalsolinestheperi-imaginalspace(Fig.6f,g,h,
trochoblasts (Fig. 6c) but at the base of a ventral depres- j). This epidermal expression has a ventral gap where the
sion.AdditionalexpressionofWar-Pax2/5/8ispresentin future creeping sole develops. A further bilateral group of
ectodermal cells lining the posterior pseudo-blastopore, War-Pax2/5/8-expressing cells is located ventrally, at the
although the expression is weaker in the ventral ectoder- posteriorpoleofthetrunk(#3inFig.6f,g,j).
malcellsoftheinvagination(Fig.6b,e). Mid-stage test cell larvae express War-Pax2/5/8
Early test cell larvae exhibit two paired bilaterally (Additional file 4) in cells of the anlagen of the cerebral
orientatedpretrochalexpressiondomainsofWar-Pax2/5/8 ganglia.Thiscerebralexpressioncanbesubdividedintwo
(Fig. 6h, i, j), which are herein referred to as “groups” (see pretrochal groups of War-Pax2/5/8-expressing cells. The
alsoAdditionalfile3).Comparingthepositionoftheneuro- mostanteriorgroup liesclosetothe cerebralcommissure
pilandthecorrespondingnucleiofthedevelopingcerebral and adjacent and anterior to the epithelial cells of the de-
ganglia (Fig. 7) with the position of both paired expression veloping foregut (#1 in Fig. 6k, l, n, o). The second group
Scherholzetal.BMCEvolutionaryBiology (2017) 17:81 Page10of20
Fig.5PhylogeneticreconstructionofthePaxgenefamily.TheconsensustreewasinferredthroughBayesianphylogeneticanalysiswithMrBayes
discarding25%ofsamplesasburn-in.ThebranchsupportvaluesareposteriorprobabilityvaluesofBayesianlikelihood.Paxproteinfamiliesare
labeledindifferentcolors.Orthologoussequencesretrievedfromourtranscriptomesaredisplayedinwhiteletters.Notethatoursequences
clusterwithotherappropriatebilaterianorthologs
of pretrochal War-Pax2/5/8-expressing cells is located The pretrochal expression of War-Pax2/5/8 in late test
more posteriorly and lies adjacent to the trochoblasts (#2 cell larvae (Additional file 5) is restricted to a marginal
inFig. 6k-o). A third bilateral groupofWar-Pax2/5/8-ex- expression in the cerebral ganglia, with a more distinct
pressing cells is located posttrochally and ventrally but expressionclosetothecerebralcommissure(#1inFig.6p,
slightly anterior to the invagination of the peri-imaginal q, s). Similar to the expression pattern in mid-stage test
spaceandtheoutgrowingtrunk(#4inFig.6k-o).Twofur- cell larvae another bilateral expression domain of War-
therbilateralexpressiondomainsarelocatedonbothsides Pax2/5/8 is located posttrochally and rather ventrally of
oftheventralmouthopening,whichliesatthebaseofthe themid-horizontalsectionplane,andanteriortotheinva-
invagination of the peri-imaginal space (#5 in Fig. 6o). gination of the peri-imaginal space and the outgrowing
Scattered War-Pax2/5/8 expression is also detected in trunk (#4 in Fig. 6p-s). As in mid-stage test cell larvae,
cells on both sides of and adjacent to the developing War-Pax2/5/8 is expressed in cells on both sides of and
creeping sole, i.e., the region where the paired ventral adjacenttothedevelopingcreepingsole,i.e.,intheregion
nerve cords develop (#6 in Fig. 6l, n, o). As in early test where the paired ventral nerve cords are located (#6 in
cell larvae, mid-stage test cell larvae still express War- Fig. 6q, s). Furthermore, War-Pax2/5/8 is still expressed
Pax2/5/8 in the epidermal cell layer of the outgrowing in the epidermal cell layer of the outgrowing trunk
trunk,whichalsolinestheperi-imaginalspace(Fig.6k-o). (Fig.6p-t).Thus,theectodermalexpressionofWar-Pax2/
A ventral gap of this epidermal expression is still present 5/8 in the epidermal layer of the outgrowing trunk is
incellsofthedevelopingcreepingsole.Asinearlytestcell present throughout all developmental stages investigated
larvae, a bilateral group of War-Pax2/5/8-expressing cells (Fig. 6f, k, p). The same applies to the characteristic
is located ventrally at the posterior pole of the trunk (#3 ventral gap of expression in the region of the developing
inFig.6l,n,o). creepingsole.
Description:(2014). b Confocal scan (maximum intensity projection, color depth coding) of the adult CNS, anterior region. an Olympus DP73 camera and the software cellSens .. was found in the statocysts, eyes, foot, and in putative che-.