Table Of Contentviruses
Article
Almond Skin Extracts Abrogate HSV-1 Replication
by Blocking Virus Binding to the Cell
CarloBisignano,GiuseppinaMandalari,AntonellaSmeriglio ,DomenicoTrombetta ,
MariaMusarraPizzo,RosamariaPennisi andMariaTeresaSciortino*
DepartmentofChemicalBiologicalPharmaceuticalandEnvironmentalSciences,UniversityofMessina,
Messina98166,Italy;[email protected](C.B.);[email protected](G.M.);[email protected](A.S.);
[email protected](D.T.);[email protected](M.M.P.);[email protected](R.P.)
* Correspondence:[email protected];Tel.:+39-090-676-5217
AcademicEditor:CurtHagedorn
Received:7June2017;Accepted:28June2017;Published:10July2017
Abstract:Theaimofthepresentresearchwastodeterminetheeffectofalmondskinextractsonherpes
simplex virus 1 (HSV-1) replication. Drug-resistant strains of HSV frequently develop following
therapeutictreatment. Therefore,thediscoveryofnovelanti-HSVdrugsdeservesgreateffort. Here,
wetestedbothnatural(NS)andblanched(BS)polyphenols-richalmondskinextractsagainstHSV-1.
HPLCanalysisshowedthattheprevalentcompoundsinNSandBSextractscontributingtotheir
antioxidantactivitywerequercetin,epicatechinandcatechin. Resultsofcellviabilityindicatedthat
NSandBSextractswerenottoxictoculturedVerocells. Furthermore,NSextractsweremorepotent
inhibitorsofHSV-1thanBSextracts,andthistrendwasinagreementwithdifferentconcentrationsof
flavonoids. Theplaqueformingassay,Westernblotandreal-timePCRwereusedtodemonstrate
thatNSextractswereabletoblocktheproductionofinfectiousHSV-1particles. Inaddition,theviral
bindingassaydemonstratedthatNSextractsinhibitedHSV-1adsorptiontoVerocells.Ourconclusion
isthatnaturalproductsfromalmondskinextractsareanextraordinarysourceofantiviralagentsand
provideanoveltreatmentagainstHSV-1infections.
Keywords: herpessimplexvirus1;flavonoids;antiviralactivity;bindingmechanisms;almondskin
1. Introduction
Almondskins(alsoreferredasalmondbran)represent4–8%ofthetotalshelledalmondweight.
Inpeeledalmonds,theyareindustriallyremovedbyhotwaterblanching,whichresultsinasubstantial
loss of bioactive compounds in the blanch water [1]. Specifically, almond skins are rich in dietary
fiber,consistingofintrinsicplantcell-wallpolysaccharides,whichexertbeneficialeffectsinthelarge
bowelthroughcolonicfermentation[2,3]. Furthermore,almondskinsrepresentasourceofphenolic
compounds,suchasflavonols,flavanonesandflavan-3-ols,whosehealth-promotingpropertiesdepend
ontheirbioaccessibilityintheuppergastrointestinaltract[4]. Wehavepreviouslydemonstratedthat
polyphenols from almond skin are bioaccessible in the gastric and small intestinal compartment
invitro,andtheirreleaseisaffectedbythefoodmatrix,wheretheskinisincorporated[5]. Although
theamountofpolyphenolsandtheantioxidantpropertiesofalmondskinsareaffectedbyindustrial
processing[6],severalreportshaveindicatedmodificationsofthehumanurinarymetabolomeafter
intake of almond skin polyphenols [7,8]. The activity of almond polyphenols for scavenging free
radicalsandinducingquinonereductasehasalsobeendocumented,withadose-dependenteffect
related to the extraction methodologies and interaction with vitamins [9]. We have previously
demonstratedneuroprotectiveeffectsofalmondskinsinanexperimentalspinalcordinjurymodel
andareductionofoxidativestressandinflammationinanexperimentalmodelofinflammatorybowel
diseaseaftertreatmentwithnaturalalmondskins[10,11]. Theantimicrobialpotentialofpolyphenols
Viruses2017,9,178;doi:10.3390/v9070178 www.mdpi.com/journal/viruses
Viruses2017,9,178 2of15
extractedfromalmondskinshasalsobeenevaluated: bothnaturalandblanchedalmondskinswere
activeagainsttheGram-positivestrainsofListeriamonocytogenesandStaphylococcusaureus,whereas
the Gram-negative Salmonella enterica was sensitive to natural almond skin [12,13]. The antiviral
effectofnaturalalmondskinshasbeendemonstratedagainstherpessimplexvirustype2(HSV-2)in
peripheralbloodmononuclearcells[14,15]. However,thedatawereobtainedinasemi-permissivecell
systemtoHSV-1andHSV-2[16,17]. Herpessimplexvirusrepresentsapersistenthumanpathogen
that resides in infected hosts for their lifetime. Indeed, following primary infection, the virus can
undergoalyticinfectioninepithelialcellsandalatentinfectioninsensoryneurons[18]. SinceHSV
infectionsareoftensubclinical,theinfectioniswidelybecomingoneoftheworld’smostprevalent
sexually-transmitted infections (STIs). In particular, the incidence and severity of infections have
increasedoverthepastfewdecadesduetotheincreasingnumberofimmunocompromisedpatients,
including HIV seropositive patients [19]. Standard treatment of symptomatic HSV infections are
basedonnucleosideanalogues,suchasacyclovir(ACV),valacyclovir(VCV)andfamciclovir(FAM),
whichtargetviralDNApolymerase. Thesedrugscanbeusedtotreatprimaryorrecurrentinfections.
However, theresistanceofHSVtoacyclovirhasbecomeanimportantclinicalproblem, especially
among immunocompromised patients exposed to long-term therapy [20]. The discovery of new
sourcesofnaturalanti-HSVagentsthatpreventtheestablishmentofinfectionbyinhibitingvirusentry
and/orviralreplicationhasbecomefundamental. Basedonthis,inthepresentstudy,wewantedto
examinetheantiviraleffectofnatural(NS)andblanched(BS)almondskinextractsagainstherpes
simplexvirustype1(HSV-1)usingafully-permissivecellularmodel, suchasVero. Weevaluated
the cellular proliferation index on Vero cells treated with both NS and BS for the antiviral activity
bythereductionplaquesassay. Inaddition,NSwasenrolledtoevaluatewhetheralmondtreatment
interferes with the production of new viral progeny. Therefore, a real-time PCR was performed,
andtheresultswereconfirmed,evaluatingthetreatment-mediatedchallengeintheviralantigens
expressionwhosesynthesisoccursinacascadefashion. Finally,abindingassayandinfectionswith
VP26GFPHSV-1expressingaGFP-taggedcapsidproteinVP26werecarriedout,leadingtoidentifying
themolecularantiviralmechanismoftheNSontheHSV-1replicativecycle.
2. MaterialsandMethods
2.1. Chemicals
Allsolventsused(methanol,acetonitrile,aceticacid,waterandethylacetate)wereHPLC-grade
and were purchased from Merck (Darmstadt, Germany). Protocatechuic acid, 4-hydroxybenzoic
acid, vanillic acid, chlorogenic acid, trans-p-coumaric acid, eriodictyol-7-O-glucoside, eriodictyol,
naringenin, naringenin-7-O-glucoside, kaempferol-3-O-rutinoside, kaempferol-3-O-glucoside,
isorhamnetin-3-O-glucoside, quercetin, kaempferol, isorhamnetin, quercetin-3-O-rutinoside,
quercetin-3-O-galactoside, quercetin-3-O-glucoside, isorhamnetin-3-O-rutinoside, catechin and
epicatechin were purchased from Extrasynthese (Genay, France). Other chemicals were of
analyticalgrade.
2.2. SampleOrigin
Naturalalmonds(MaisieJane’s,Chico,CA,USA)werekindlyprovidedbytheAlmondBoardof
Californiaandstoredinthedark. Naturalalmondskins(NS)werecryo-peeledwithliquidnitrogen
byrepeatedcyclesoffreeze-thawing,manuallyremoved[2]andcrushedinthepresenceofliquid
nitrogenusingananalyticalmill(ModelA11BASICIKA).Blanchedalmondskins(BS),produced
byABCOLaboratories(Almondskinspowder1912)bysoakingbrownskinalmondsinnearboiling
water(90–100◦C)for2–3min,weresuppliedbytheAlmondBoardofCalifornia.
Viruses2017,9,178 3of15
2.3. SamplePreparation
NSandBSwereprocessedaccordingtoMandalarietal.[2]. Briefly,5gofNSorBSwereextracted
threetimeswithn-hexane(10mL)for6hunderconstantagitationinordertoremovethelipidfraction.
Afterfiltration,theresiduewasmixedwith50mLofmethanol/HCl0.1%(v/v)mixtureandsonicated
for15min. Thesamplewascentrifuged(5000×g,10min,4◦C)andthepelletextractedtwomore
times. Themethanolfractionswerecombinedandconcentratedtodrynessbyarotaryevaporator;
theresiduewasdissolvedin20mLofMilliQwaterandextractedfourtimeswith20mLofethylacetate.
TheorganicphaseswerecombinedanddriedwithNa SO for20min. Theyieldsoftheresiduesfrom
2 4
NSandBSwere7.92%and6.72%,respectively. ThedriedextractsofNSandBSweredissolvedin
methanol(stocksolution10mg/mL)forHPLC,totalphenolsandradicalscavenginganalysesandin
DMSO(stocksolution100mg/mL)forantiviralassays.
2.4. TotalPhenolsDetermination
ThetotalphenolcontentofNSandBSwasdeterminedcolorimetricallyusingtheFolin-Ciocalteu
method as described previously [21]. The total phenol content was expressed as mg of gallic acid
equivalents(GAE)/100gofNSandBS.Eachassaywasperformedintriplicateatleastthreetimes.
2.5. RadicalScavengingActivity
The anti-radical activity of NS and BS was determined using the stable 2,2-diphenyl-
1-picrylhydrazylradical(DPPH•)andtheprocedurepreviouslydescribed[22]. Resultswereexpressed
asmgofextractneededtoscavenge50µmolsoftheinitialDPPHconcentration(SE ).
50
2.6. DeterminationofPolyphenolicProfile
Thedeterminationofpolyphenoliccompoundswasperformedbyreversephasehighperformance
liquidchromatographycoupledwithdiodearrayandfluorescencedetectors(RP-HPLC-DAD-FLU)
as described previously with some modifications [23]. An Agilent high performance liquid
chromatography system (1100 series, Agilent, Santa Clara, CA, USA) equipped with a UV-Vis
photodiode-arraydetector(DAD)(G1315)andafluorescencedetector(G1321)coupledwithacontrol
system(G1323)equippedwithanLCpump(G1312)andanauto-injector(G1313)wasused. Separation
wasperformedona5-µmODS3reversed-phaseProdigycolumn(250mm×4.6mm;Phenomenex,
Torrance, CA, USA). A gradient elution consisting of Solvent A (water/acetic acid, 97:2, v/v) and
SolventB(water/acetonitrile/aceticacid,73/25/2,v/v/v)wasappliedataflowrateof1.0mL/min
as follows: 0 min 100% A, 0–55 min 20% A, 55–57 min 10% A, 57–90 min 0% A, 90–95 min 100%
A and equilibrated 15 min for a total run time of 110 min. Samples were filtered before through
a 0.22-µm PTFE filter, and the injection volume was 20 µL. The detection conditions were set at
270nmforphenolicacidsandflavanones,330and370nmforflavonols,isoflavonesandflavones.
TheUVspectraofthedifferentcompoundswererecordedfrom190–400nm. Thewavelengthsusedfor
fluorescencedetectionofflavan-3-olswereλ : 276nmandλ : 316nmrespectively. Dataacquisition
ex em
wasperformedusingChemStationsoftware(versionA.10.01,Agilent,SantaClara,CA,USA).
ThepolyphenolidentificationwasmadeaccordingtoUV-Visspectraandretentiontimewith
respect to commercially-available standards. Quantification was carried out by external standard
calibrationcurves.
2.7. CellsCultureandVirus
VERO cell lines (American Type Culture Collection) were propagated in minimal essential
medium (EMEM), supplemented with 6% fetal bovine serum (FBS) (Lonza, Belgium) at 37 ◦C
under 5% CO . The prototype HSV-1 (F) strain was kindly provided by Dr. Bernard Roizman
2
(University of Chicago, IL, USA). The quantification of viral DNA was carried out by using
TaqManreal-timePCR;theforwardandreverseprimers(For-59CATCACCGACCCGGAGAGGGAC;
Viruses2017,9,178 4of15
Rev-59 GGGCCAGGCGCTTGTTGGTGTA) were designed on the HSV-1 genome, as well as
theTaqManprobe(-596FAMCCGCCGAACTGAGCAGACACCCGCGC-TAMRA),where6FAMis
6-carboxyfluoresceinandTAMRAis6-carboxytetramethylrhodamine. Viralstockswerepropagated
and then titered in Vero cells. The viral infection was performed by exposure of Vero cells to
theHSV-1virusatthemultiplicityofinfectionMOIof1. Aftertheinfection, thesupernatantwas
replacedwithfreshculturemediumandcollectedattheestablishedtimesoftheexperimentaldesign.
VP26GFP-HSV-1virusexpressingaGFPtaggedcapsidproteinVP26waspropagatedandtiteredin
Verocellsasdescribedpreviously[24].
2.8. CellProliferationAssay
Verocellsweregrowninwellsof96-wellplatesandtreatedwiththreedifferentconcentrationsof
almondextracts(0.4mg/mL,0.2mg/mLand0.1mg/mL).Thecellviabilitywasdeterminedwith
acytotoxicitybioassaykit(LonzaGroupLtd.,Basel,Switzerland)accordingtothemanufacturer’s
instructions.TheGloMax®MultiMicroplateLuminometer(PromegaCorporation,2800WoodsHollow
Road,Madison,WI,USA)incombinationwiththeViaLight™pluscellproliferationandcytotoxicity
bioassay kit quantified the emitted light intensity related to ATP degradation. The measured
luminescence value was converted to the cell proliferation index (%) according to the following
Equation(1):
(cid:18)A−B(cid:19)
Cellviability%= % (1)
C−B
whereAdenotestheaverageoftreatedsample,BrepresentsbackgroundluminescenceandCrepresents
theaverageofuntreatedsamples.
2.9. PlaqueReductionAssay
Theantiviralactivitywasevaluatedbyplaquereductionassay. Theviruswasdilutedtoyield
60 plaques/100 µL. Samples were inoculated on monolayers of Vero cells in 24-well dishes and
incubatedfor1hat37◦C.Aftertheincubationtime,theinoculumwasremoved,andthemonolayers
were covered with Dulbecco’s Modified Eagle’s Medium containing 0.8% methylcellulose in
the presence of NS and BS extracts at three different concentrations (0.4 mg/mL, 0.2 mg/mL and
0.1mg/mL),separately. After3days,thecellswerefixed,stainedwithcrystalvioletandvisualized
withaninvertedmicroscope(LeicaDMIL,Nuβloch,Germany)forplaquedetection. Thedatawere
analyzedasthemeansoftriplicates±SDforeachdilution.
2.10. ProteinExtractionandImmunoblotAnalysis
VerocellsweremockinfectedorinfectedwithHSV-1(F)atMOI1at37◦Cwithgentleshaking.
Aftertheincubationtime,theinoculumwasremoved,andthecellswereincubatedat37◦C,under
5%CO ,for24hininfectionmedium,whichincludeddifferentconcentrationsofNSandBSextracts
2
(0.4mg/mL).After24h,cellsweresubjectedtoproteinextractionforWesternblotanalysis.Theprotein
samples were resolved by SDS-PAGE and transferred to the nitrocellulose membrane. The HSV-1
antigensexpressionwasanalyzedbyWesternblotting. Themembraneswereincubatedwithaprimary
antibodyagainstviralantigens;ICP0(sc-56985)fromSantaCruzBiotechnology(SantaCruz,CA,USA);
ICP8andanti-US11werekindlyprovidedbyDr.BernardRoizman.Horseradishperoxidaseanti-rabbit
andanti-mouseantibodieswerefromSantaCruzBiotechnology. GAPDH(sc-32233)waspurchased
fromSantaCruzandusedastheloadingcontrol. Thechemiluminescentsignalsweredetectedwith
SuperSignal™WestPicoChemiluminescentSubstrate(ThermoFisherScientific,Waltham,MA,USA).
2.11. DNAExtractionandQuantitativeReal-TimePCR
VerocellswereinfectedwithHSV-1(F)atMOI1for1hat37◦C.Afterincubation,theinoculum
wasreplacedbyfreshgrowthmediumwitheitherNSorBSextract(0.4mg/mL),separately. Samples
Viruses2017,9,178 5of15
were collected and resuspended in of TRIzol reagent (Invitrogen, Carlsbad, CA, USA) and used
for DNA extraction, according to the manufacturer’s instructions. The DNA was precipitated,
andquantificationwascarriedoutaspreviouslydescribed[25]. Brieflyreal-timePCRwascarriedout
ina25-µLreactionmixturecontaining1µLofDNApreparation,0.5µMeachforwardandreverse
primer (For-59 CATCACCGACCCGGAGAGGGAC; Rev-59 GGGCCAGGCGCTTGTTGGTGTA),
300nMTaqManprobe(596FAMCCGCCGAACTGAGCAGACACCCGCGC-TAMRA,where6FAMis
6-carboxyfluoresceinandTAMRAis6-carboxytetramethylrhodamine),and12.5µLofMaximaProbe
qPCR Master Mix (2X) (Maxima Probe qPCR; Fermentas Life Sciences, Burlington, ON, Canada).
TheamplificationwascarriedoutwiththeaidofaCepheidSmartCyclerIISystem(CepheidEurope,
Maurens-Scopont,France)underthefollowingconditions: incubationfor10minat95◦C,followedby
40cyclesof30sat95◦C,30sat55◦Cand30sat72◦C,withafinalcycleof5minat72◦C.Therelative
quantitationofHSV-1DNAwasgeneratedbycomparativeC method.
t
2.12. TheBindingAssay
Thebindingassaywasperformedat4◦C,atemperaturethatallowsthevirustobindtocellular
receptors,butnotenterthecells. Thus,theonlymechanismthatapotentialinhibitorcandisruptinthis
assayisvirusbindingtothecell. Viralsuspensionwasincubatedwith0.4mg/mLNSfor1hpriorto
performingtheassayandincubatedinice. Verocellswereplatedin6-wellplatesandallowedtoreach
confluence. Theplateswerethenremovedfromtheincubatorandleftatroomtemperatureforabout
15min,afterwhichtheywereincubatedat4◦C.ThecoldinoculumcontainedNSinthepresenceof
virusesorcontrolviruseswereusedtoinfectthecells.Plateswerethenincubatedat4◦Cfor1htoallow
thevirustobindtothecells. Theunboundviruseswereremovedbywashingtheplates3timeswith
coldPBS.Plateswereoverlaidwithcompletemediumandincubatedat37◦C.Thecytopathiceffect
(ECP)wasdetectedby:(i)directobservationofECPbyinvertedmicroscope;(ii)relativequantitationof
HSV-1DNAusingreal-timePCR.Separately,thebindingassaywasperformedbyusingVP26-HSV-1
virusandmeasurementoftheauto-fluorescenceofVP26-taggedprotein.Todetecttheautofluorescence
oftheVP26-taggedvirus,samplesobtainedfromthebindingassaywerecollected24hp.i. andlayered
onpolylysinatedslides. Then,sampleswerefixedwith4%paraformaldehyde(PFA4%),washedthree
timesandstainedwithHoechst33342. Evan’sbluewasusedasacellcounter-stain. Sampleswere
analyzedonafluorescencemicroscope(Leitz,Wetzlar,Germany).
2.13. StatisticalAnalysis
Thestatisticaldifferencesbetweenseveralsampletypeswereanalyzedwithone-wayanalysisof
variance(ANOVA)usingPrismsoftware(GraphPad). Asterisks(*,**and***)indicatethesignificance
ofp-valueslessthan0.05,0.01and0.001,respectively.
3. Results
3.1. TotalPhenolContentandRadicalScavengingActivityofNSandBSExtracts
ThetotalphenolcontentandradicalscavengingactivityofNSandBSextractsarereportedin
Table1.
Table 1. Total phenol content and radical scavenging activity in natural (NS) and blanched (BS)
almondskins.
Sample (mgofSkin*) mgGAE/100gFW
NS 0.032±0.001 4228.52±265.19
BS 0.117±0.003 3841.16±18.56
*ActivityisexpressedasSE50(amountneededtoscavenge50µmoloftheinitialDPPH•solution).
Viruses2017,9,178 6of15
In agreement with total phenolic content, NS showed the highest radical scavenging activity.
AlthoughthetotalphenoliccontentandtheamountofpolyphenolsidentifiedbyHPLCinNSwere
similartoourpreviousinvestigation[2],theradicalscavengingactivityisnearly10-timesstronger
withthecurrentextract. Thistrendreflectstheamountofphenolspresentinthealmondskins,aswell
asthedifferentphenolicprofileofthesamples(Tables2and3).
Table2.Polyphenoliccompoundsidentifiedinnatural(NS)andblanched(BS)almondskins.
PeakNo. Compound *RT(min) λmax(nm)
1 Protocatechuicacid 13.081 259;294
2 p-Hydroxybenzoicacid 20.442 255
3 Catechin 23.616 278
4 Chlorogenicacid 26.510 296;326
5 Vanillicacid 26.892 261;292
6 Epicatechin 32.561 278
7 trans-p-Coumaricacid 38.015 310
8 Eryodictiol-7-O-glucoside 45.933 284
9 Quercetin-3-O-rutinoside 47.434 256;354
10 Quercetin-3-O-galactoside 47.757 256;354
11 Quercetin-3-O-glucoside 48.892 256;354
12 Kaempferol-3-O-rutinoside 53.395 265;347
13 Kaempferol-3-O-glucoside 54.279 265;347
14 Naringenin-7-O-glucoside 54.555 284;338
15 Isorhamnetin-3-O-rutinoside 54.937 256;354
16 Isorhamnetin-3-O-glucoside 56.650 254;354
17 Eriodictyol 66.052 288
18 Quercetin 70.367 256;372
19 Naringenin 73.018 288
20 Kaempferol 88.516 264;366
21 Isorhamnetin 93.060 254;370
Boldvaluescorrespondtothepeaknumberpresentinthechromatograms.*RT=Retentiontime.
Table 3. Polyphenolic compounds in natural (NS) and blanched (BS) almond skins. Values are
expressedasµg/100gandrepresenttheaverage(±SD)ofthreeindependentexperiments(n=3).
Compound NS BS
Hydroxybenzoicacids
Protocatechuicacid 3862.97±124.52 878.24±22.65
p-Hydroxybenzoicacid 7094.27±224.10 696.21±32.41
Vanillicacid 5652.08±236.54 709.027±11.35
Hydroxycinnamicacids
Chlorogenicacid 1144.54±84.25 375.41±8.54
trans-p-Coumaricacid 791.62±22.45 142.19±5.24
Flavanones
Eriodictyol 2777.23±78.65 364.8±12.54
Eryodictiol-7-O-glucoside 57.9±1.26 8.33±0.221
Naringenin 5802.51±185.44 474.54±20.85
Naringenin-7-O-glucoside 34,020.11±654.22 2148.22±62.35
Flavonols
Kaempferol-3-O-rutinoside 8062.45±261.33 1037.64±52.14
Kaempferol-3-O-glucoside 29,530.44±854.22 522.84±21.47
Isorhamnetin-3-O-glucoside 16,597.37±546.31 908.86±18.95
Quercetin 3474.03±105.62 2035.8±68.54
Kaempferol 5573.6±88.65 998.84±22.64
Isorhamnetin 3513.47±112.35 230.4±9.87
Quercetin-3-O-rutinoside 1067±55.62 299.55±8.03
Quercetin-3-O-galactoside 1400.8±37.45 123.56±4.42
Quercetin-3-O-glucoside 1219.53±24.89 108.67±2.89
Isorhamnetin-3-O-rutinoside 17,620.45±495.65 1526.53±23.98
Flavanols
Epicatechin 26,948.72±554.25 1900.8±62.74
Catechin 47,998.32±956.54 4210.91±88.54
Totalamount 224,209.41 19,701.36
Viruses2017,9,178 7of15
Viruses 2017, 9, 178 7 of 15
Catechinandepicatechinappearedatmuchhigherconcentrationsinthepresentextract. Itiswell
Catechin and epicatechin appeared at much higher concentrations in the present extract. It is well
knownthatanumberoffactors,includingvariety,cultivationandenvironmentalconditions,aswell
known that a number of factors, including variety, cultivation and environmental conditions, as well
asextractioans emxteratchtoiodns mheathvoedas shiagvne iafi sciagnnitfiicmanpt aimctpoanct tohne thpeo plyoplyhpehnenoolliicc ccoommppoosistiiotino nof othfet hexetreaxcttrs a[c26ts] [26]
(Figure1).(Figure 1).
Viruses 2017, 9, 178 8 of 15
rs
Figure1.FRigeuprer e1s. eRnetparteisveentHatiPvLe CHPcLhCro cmhraotmoagtroagmramo fopf phheennoolliicc ccoommppoounudnsd psrepsreenste inn tthine mtheethmaneotlh eaxntroaclte xtract
ofNS:(Ao)f2 N8S0: n(Am) ;2(8B0 )nm33, 0(Bn) m33;0( nCm),3 (7C0) n37m0 namnd an(dD ()Dλ)e λxex2 27766 nnmm,, λλeemm 31361 n6mn.m Th.eT nhuemnbuemrinbge orfi nthge opfeathkse peaks
refers to Table 2.
referstoTable2.
3.2. Cytotoxicity of Almond Extracts on Cells Cultures
To examine the cytotoxicity effect of NS and BS extracts, we incubated Vero cells in the presence
of different concentrations of almond extracts for 24 h. Samples were then collected, and the
quantification of the emitted light intensity, related to ATP degradation as a cellular proliferation
index, was measured. The results showed that treatment with NS and BS extracts at the
concentrations of 0.4, 0.2 and 0.1 mg/mL did not exhibit cytotoxicity (Figure 2).
Figure 2. Viability assay in Vero cells treated with natural and blanched skin extracts. The cell
viability was determined on the basis of ATP levels using the ViaLight™ plus cell proliferation and
cytotoxicity bioassay kit (Lonza Group Ltd., Basel, Switzerland). Vero cells were treated with three
different concentrations of NS and BS almond extracts (0.4 mg/mL, 0.2 mg/mL and 0.1 mg/mL). 24 h
post-treatment, they were collected, and the luminescence value was converted into the cell
proliferation index (%) as described in the Materials and Methods. The assay was performed as the
means of triplicates ± SD, and * indicates significant changes (p ≤ 0.001).
3.3. Antiviral Activity of the Almond Extracts
To further investigate whether treatment with NS and BS interferes with viral replication, the
plaque reduction assay was performed as described in the Materials and Methods. The results of
standard plaque reduction assay showed a significant decrease in the viral titer after incubation with
NS almond extract at the concentration of 0.4 mg/mL (*** p < 0.001) (Figure 3a). At the concentration
Viruses 2017, 9, 178 8 of 15
rs
Figure 1. Representative HPLC chromatogram of phenolic compounds present in the methanol extract
Viruseso2f 0N17S,: 9(,A1)7 8280 nm, (B) 330 nm, (C) 370 nm and (D) λex 276 nm, λem 316 nm. The numbering of the peaks8 of15
refers to Table 2.
33..22.. CCyyttoottooxxiicciittyy ooff AAllmmoonndd EExxttrraaccttss oonn CCeellllss CCuullttuurreess
TToo eexxaammiinnee tthhee ccyyttoottooxxiiccitityye efffefecctto offN NSSa annddB BSSe xextrtarcatcst,sw, weein icnucbuabtaetdedV eVreorcoe cllesllisn itnh ethper epsreensecencoef
odfi ffdeirfefnetrecnotn cceonntrcaetniotrnastioofnasl moof nadlmexotnradc tsexfotrra2c4tsh .foSar m2p4 lehs. wSearmetphleens cwolelerec tetdh,eann dcotlhleecqtuedan, taifincda ttiohne
qofutahnetiefmicaitttieodnl iogfh tthine teemnsiitttye,dre lliagthedt itnotAenTsPitdye, grrealadtaetdio ntoa AsaTcPe ldluelgarrapdraotliiofenr aatsi oan cineldluexla,rw parsomlifeearsautrioedn.
Tinhdeexr,e swulatss smheoawsuedredth. aTthtere artemsuelntst wshitohweNdS tahnadt tBrSeaetmxternact tswaittht hNeSc oanncde nBtrSa tieoxntsraoctfs 0a.4t, t0h.2e
caonndc0e.n1trmatgi/onmsL odf i0d.4n, o0.t2e axnhdib 0it.1c ymtogt/omxLic idtyid( Fniogtu erxeh2i)b.it cytotoxicity (Figure 2).
Figure 2. Viability assay in Vero cells treated with natural and blanched skin extracts. The cell
Figure 2. Viability assay in Vero cells treated with natural and blanched skin extracts. The cell
viabilitywasdeterminedonthebasisofATPlevelsusingtheViaLight™pluscellproliferationand
viability was determined on the basis of ATP levels using the ViaLight™ plus cell proliferation and
cytotoxicitybioassaykit(LonzaGroupLtd.,Basel,Switzerland). Verocellsweretreatedwiththree
cytotoxicity bioassay kit (Lonza Group Ltd., Basel, Switzerland). Vero cells were treated with three
differentconcentrationsofNSandBSalmondextracts(0.4mg/mL,0.2mg/mLand0.1mg/mL).
different concentrations of NS and BS almond extracts (0.4 mg/mL, 0.2 mg/mL and 0.1 mg/mL). 24 h
24 h post-treatment, they were collected, and the luminescence value was converted into the cell
post-treatment, they were collected, and the luminescence value was converted into the cell
proliferation index (%) as described in the Materials and Methods. The assay was performed as
proliferation index (%) as described in the Materials and Methods. The assay was performed as the
themeansoftriplicates±SD.
means of triplicates ± SD, and * indicates significant changes (p ≤ 0.001).
3.3. AntiviralActivityoftheAlmondExtracts
3.3. Antiviral Activity of the Almond Extracts
To further investigate whether treatment with NS and BS interferes with viral replication,
To further investigate whether treatment with NS and BS interferes with viral replication, the
theplaquereductionassaywasperformedasdescribedintheMaterialsandMethods. Theresultsof
plaque reduction assay was performed as described in the Materials and Methods. The results of
standardplaquereductionassayshowedasignificantdecreaseintheviraltiterafterincubationwith
standard plaque reduction assay showed a significant decrease in the viral titer after incubation with
NSalmondextractattheconcentrationof0.4mg/mL(***p<0.001)(Figure3a). Attheconcentrationof
NS almond extract at the concentration of 0.4 mg/mL (*** p < 0.001) (Figure 3a). At the concentration
0.2and0.1mg/mL,NSdidnotshowarelevantviraltiterreduction;however,adecreaseinthesizeof
p laques(micro-plaques)wasobservedat0.2mg/mL(Figure3c,IV).BStreatmentshowedaviraltiter
reductionat0.4mg/mL(**p<0.01)only,butnotat0.2or0.1mg/mL.Therefore,theseresultssuggest
a direct association between increasing concentration of the NS almond extract and the antiviral
activity. Indeed,theincreasedconcentrationoftheNSextractwasaccompaniedbyatotalreductionof
thevirusreplication.
Viruses 2017, 9, 178 9 of 15
of 0.2 and 0.1 mg/mL, NS did not show a relevant viral titer reduction; however, a decrease in the
size of plaques (micro-plaques) was observed at 0.2 mg/mL (Figure 3c, IV). BS treatment showed a
viral titer reduction at 0.4 mg/mL (** p < 0.01) only, but not at 0.2 or 0.1 mg/mL. Therefore, these
results suggest a direct association between increasing concentration of the NS almond extract and
the antiviral activity. Indeed, the increased concentration of the NS extract was accompanied by a
Viruses2017,9,178 9of15
total reduction of the virus replication.
FFiigguurree 33.. PPllaaqquuee rreedduuccttiioonn aassssaayy ttoo vveerriiffyy tthhee aannttiivviirraall aaccttiivviittyy ooff CCaalliiffoorrnniiaann nnaattuurraall aanndd bbllaanncchheedd
sskkiinn aallmmoonndd eexxttrraaccttss:: VVeeroro ceclelsll swwereer einfinecfteecdte wdiwthi tHhSHV-S1V (-F1) (aFn)da nindcuibnactuebda tfeodr 1f ohr a1t 3h7 a°tC3. 7Af◦tCer.
Athfete irncthuebaitniocunb taimtioen, thtiem ine,octhueluimno wcualsu rmemwovasedr,e amnodv tehde, manondotlhayeemrso wneorlea yoevresrlwaiedr ewoitvhe Drlauildbewccioth’s
DMuoldbeifciecod’ sEaMgoled’sifi MededEiuagmle c’sonMtaeidniiunmg 0c.8o%nt amineitnhgyl0ce.8ll%ulomseet ihny tlcheel lpurleosseenicne tohfe NpSr easnedn cBeSo efxNtraScatsn adt
BdSiffeexrternatc tcsonatcedniftfrearteionntsc (o0n.4c emntgr/amtiLo,n 0s.2(0 m.4gm/mgL/ manLd, 00..21 mmgg//mmLL). aTnhde 0p.l1atmesg w/merLe )i.nTcuhbeapteladt east w37e °rCe
ianncdu b5a%te CdOat2 3fo7r◦ tChraened d5a%ysC, aOn2df othret hprleaequdeasy sw,earned vtihseuaplliazqeude bsyw setareinvinisgu acelilzlse dwbityhs ctrayinstinalg vcieolllestw. Tithhe
cDryMstSaOl vwioalse tu.sTedh einD MtheS OHSwVa-s1 ucsoendtrionl.t hReesHulStVs -a1rec otnhter oml.eaRne s±u lStDs aorfe ttrhipelmicaetaen e±xpSeDrimoefntrtsip, laicnadt e*
einxpdeicraimtees nstisgnanifdicaanstte crihsaknsg(e**s a(np-dva**lu*)ei n≤d 0i.c0a0t1e)s. iIgnn (ifiAc,aBn),t tchhea npglaeqsuoef pre-vdaulcuteiolne sasstshaayn w0.a0s1 paenrdfo0r.m00e1d,
rfeoslploewctiinvgel yN.SIn a(nad,b B),St haelmploanqdu eexretrdaucctsti otrneaatsmsaeynwt, arsesppeercfotirvmeleyd. f(oCl)l oSwhionwgsN thSea npdlaBqSuea lmmoornpdheoxlotrgaicctasl
tcrheaatnmgee ndtu,ere tsop NecSti vtreelayt;m(ce)nsth 0o.4w mstgh/empLl avqsu. e0.m2 morgp/hmoLlo. gNicoa rlecdhuacntgioend wueasto oNbsSertvreeadt mate 0n.t1 0m.4gm/mgL/.m L
vs.0.2mg/mL.Noreductionwasobservedat0.1mg/mL.
3.4. Inhibition of HSV Replication by NS and BS Extracts
3.4. InhibitionofHSVReplicationbyNSandBSExtracts
To determine whether treatment with the almond extracts interferes with active viral replication,
two Tdoiffdeeretenrtm aipnperowahcehtehse wrterreea temnreonlltewd:i t(hi) tdheetaeclmtinogn dvieraxlt rDacNtsAi nbtye rufesriensg wreitahl-taicmtiev ePCviRra; l(irie) pdleicteactitoinng,
tvwiroald pifrfoetreeinnts acpapscraodaech beys Wweerseteernnr oblloletd a:n(ai)lydseiste. cFtiirnsgt ovfi raalll, DthNeA dibffyeruesnint glevreealsl- toifm toetPalC vRi;ra(ili )DdNeAte cwtienrge
vainraallypzreodt efionlslocwasincagd NeSb yanWde sBtSe renxtbrlaoctt atnreaalytmsies.nFt icrosmtopfaarleld,t htoe udniftfreeraetnetdl eHvSeVls-1o fatto 2ta4l hv ipra.il. DThNeA rewsuerltes
asnhaolwyzeedd thfoaltl NowS ianngdN BSS aanlmdoBnSde exxtrtraaccttstr aeta tthmee cnotnccoemntpraatrieodn toof u0.n4t rmeagt/emdLH wSeVr-e1 aabtle2 4toh bplo.ic.kT vhierarle DsuNltAs
sahcocuwmedultahtaiotnN, Stoa nddiffBeSreanlmt doengdreeexst,r awcthseant cthoemcpoanrceedn ttroa ttihoen uonft0r.e4amtedg/ imnfLecwteedr ecealblsle (t*o**b plo c<k 0v.0ir0a1l)
D(*N* pA <a c0c.0u1m),u rleastpioenct,ivtoeldyi f(fFeirgeunrte d4eag).r eInehs,ibwithioenn ocof mvipraalr reedptliocathtieonu naltsroea wteads imnfeeacstuedredce bllys (q*u**anpt<ifi0ca.0t0io1n)
(o**f vpi<ra0l .p01ro),tereins peexcptriveseslyio(nF iogfu rreep4reas)e.nIntahtiibviet iαo nICoPf0v,i rβa lICrePp8l iacnadti oγn Ualss1o1 wviarsalm peraosteuirnesd. Tbhyeq vuiarnalt ipfircoatteioinns
ocfhvoisreanl parroet erienpreexspernetsastiiovne ogferneepsr eosfe tnhtea titvhereαe IcClaPs0s,eβs oICf Pv8iraanl dgeγnUess 1tr1avnisrcarlibperodt einin sa.nT ohredveirreadl pcraostceaidnes.
cThhoesreenfoarere, irmepmruesneonbtlaotti vaenagleynsiess wofast hpeerthforremeecdla sinse Vseorfov cierlalls ginefneecstetdra wnsitchr iHbeSdVi-n1, aenithoerrd etrreeadtecda socra ndoet.
Twhiethre NfoSre a,nimd mBSu enxotbralocttsa sneaplyasraistewlya sanpde rifnocrumbeadteidn fVoer r2o4 che.l lDsaintafe dcetemdownsitthraHteSdV t-h1a,te tihthe earctcruematuedlatoironn ootf
wICitPh0N, ISCaPn8d anBdS Uexst1r1a cvtisrsael pparroateteinlys awnads icnocnusbidateerdabfloyr r2e4dhu.ceDda tina dNeSm-torenastterdat iendfetchtaetdt hceellasc icfu cmomulpaatiroend otof
ICP0,ICP8andUs11viralproteinswasconsiderablyreducedinNS-treatedinfectedcellsifcompared
to the untreated infected cells. Infected cells treated with BS displayed less decrease of all three
differentviralproteins,confirmingthedataobtainedbyviralDNAquantification(Figure4b). Western
blotbandintensitiesofthetreatedornotinfectedcellswerenormalizedwithrespecttotheuntreated
HSV-1infectedcontrolusingT.I.N.A.software(version2.10,Raytest,Straubenhardt,Germany).
Viruses 2017, 9, 178 10 of 15
the untreated infected cells. Infected cells treated with BS displayed less decrease of all three different
viral proteins, confirming the data obtained by viral DNA quantification (Figure 4b). Western blot band
intensities of the treated or not infected cells were normalized with respect to the untreated HSV-1
Viruses2017,9,178 10of15
infected control using T.I.N.A. software (version 2.10, Raytest, Straubenhardt, Germany).
Figure4.EffectofalmondextractstreatmentontheHSV-1replicationandonviralantigens’expression.
(a)TheFvigiruarleD 4N. AEwffeacst exotfr aacltmedonfrdo mexVtrearoctcse ltlrse2a4tmhepnots to-Hn StVh-e1 HinSfeVc-ti1o nreapsldiceastciorinb eadnidn tohne Mviartaelr iaanlstigens’
andMeextphroedsss.ioRne.l (aAti)v eThqeu avnirtaizl aDtiNonA owfavsi reaxltDraNctAedw fraosmp eVrfeororm ceeldlsu 2s4i nhg proesatl--HtimSVe-q1 uinanfetcittaiotinv easP dCeRscribed
andaninal ythzee dMbaytetrhiaelsc oamndp aMraettivheodCst. mReeltahtoivde( ∆qu∆aCntt)i.zVatailoune sofr evpirreasl eDnNt±AS wDaosf ptherefoarvmereadg euosifntgh rreeeal-time
sampleqsunanotrimtaatilvizee dPCagRa ainnsdt tahneaGlyAzePdD bHy ctohpei ecsomnupmarbaetriv;e(b C)tI mmmetuhondob (lΔoΔtaCnt)a. lVysailsuwesa srepperrefsoernmt e±dSDin of the
VerocealvlserHagSeV -o1f itnhfreecete sdamanpdletsr enaoterdmwaliitzhedn aatguarianls(tN thS)e aGnAdPbDlaHnc hcoepdie(Bs Sn)usmkibneerx. t(rBa)c tIsm(m0.4unmogb/lomt La)n.alysis
Equalwamaso puenrtfsoormfpedro itnei nVserwoe creellsse pHaSrVat-e1d inbfyecpteodly aancrdy ltaremaitdede gweilthe lencattruorpahl o(NreSs)is a,ntrda nbslafenrcrheedda (nBdS) skin
probedexwtritahctssp e(c0ifi.4c amntgib/modLy).t oEαqu(IaClP 0a)m,βou(InCtPs 8)oafn dpγro(tUeiSn1s1 )wvierrael prsoetpeainrast.eGdA PbDy Hpporloytaecirnyslawmeriede gel
usedfoerlehcotruospehkoeerepsiinsg, .trBaannsdfedrreendsi taynwd apsrdoebteedrm winitehd swpeitchiftihc eaTn.tIi.bNo.dAy. ptroo gαr a(ImCPa0n)d, wβ a(sICePxp8)r easnsedd γa s(US11)
thefolvdircahla pnrgoeteoivnesr. GthAePaDppHr opprroitaetienhs owuesreek ueespedin fgorg ehnoeuss.eAkesetepriinskgs. B(*a*n*)di nddenicsaittey swigans idfiectaenrtmcihnaendg wesith the
ofp-vaTlu.Ie.Ns.lAes.s ptrhoagnra0m.00 a1n.d was expressed as the fold change over the appropriate housekeeping genes.
3.5. H3S.V5. AHtStaVc hAmtteancthtmoeTnatr gtoe tTCaregllestI CsePlrlse vIesn PterdevbeyntAedlm boyn AdlEmxotnradc Etsxtracts
SinceStihnece0 t.4hem 0g.4/ mmgL/mcoLn ccoenncternattriaotnioonf oNf NSSr erseusultleteddi nin aa >>9900%% ddeeccrreeaasese ofo vfivrairl atlitetirt earnda nwdasw faosund to
foundbteo nboenn-toonxi-cto txoi VcetoroV ceerlolsc, ewlles ,fowceusfeodcu osne dthoen 0.t4h me0g./4mmL gc/omncLenctorantcieonnt oraf tNioSn inof sNubSsienqusuenbts eeqxpueernimt ents.
experIinmdeenetds,. tIon bdeetetedr, utondbeertstetarnudnindge rtshtea nmdoilnegcutlhaer mmeoclehcaunliasmrms mecehdainatiesdm bsym NedS iaaltmedonbdy eNxtSraacltms oonn dHSV-1
extracrtespolincaHtioSnV,- w1ree epxlaicmatinioend, wwheeethxearm NinSe adffwechteedth tehre NcaSpaabffielicttye odf tHheSVca-1p atob ibliintyd otof HthSeV c-e1lltuolabri mndemtobrane.
theceTllhuela eramrlieemstb srtaangee .oTf htheee HarSliVes itnsfteacgtieono fist htheeH bSinVdiinnfge ctoti othnei scetlhluelbarin mdienmgbtroanthee recespllounlasribmlee fmorb trhaen erelease
responofs icbolree afonrd tthegeurmeleenats perootfeicnosr ientaon tdhet ecygtuompleansmt aptrioc tceoimnspainrttmoetnhte. Tchyet oapbloavsem daattiac wcoerme poabrtatmineendt b.y NS
The atbroeavtemdenatta owf ienrfeecotbedta icneellds abfyteNr vSirtarel aintmoceunltumof. iBnafesecdte donc etlhlessaef tceornvsiidrearlaitniooncsu, lua mbi.ndBiansge dasosany was
theseccaornriseidd eorautti oton sa,lalobwin tdhien gviarsussa ytow bainsdc atror iecedllouulatrt oreaclelpowtortsh, ebvuitr unsott otob ienndtetro tcheel lucelallrs.r eActetpactohresd, viral
butnoptatrotiecnletse rcathne lacetellrs .enAttetra cchelelsd avfitrearl ipnacrutbicalteisonca ant l3a7te °rCe,n atnerdc tehllesya cftaenr cinocmupblaettieo nthaet l3y7ti◦cC c,yacnled. Tthheeyrefore,
cancovmirpall estuestpheenlsyitoincsc ywceler.e Tinhceurebfaotreed, voirr anlostu wspitehn sNioSn (s0w.4 emregi/nmcuLb),a atendd oinrfneocttiowni twhaNsS c(a0r.r4iemd go/umt iLn) ,ice as
andinrefepcotriotend wina sSceactriroined 2.o uTthein siacmepaslerse wpoerrtee dsuibnjeScetecdti otno: 2(.i)T lhivees admetepclteisonw oerf ecsyutobpjeacthteicd etoff:ec(it) (lCivPeE); (ii)
detectrieoanl-otifmcey tPoCpaRt hsiecpeafrfaetcetly(C, tPoE i)n;v(iei)striegaalt-et imwheePtCheRr sNepS atrraetaetlmy,etnot ipnrveevsetingtast ethwe hveirtahle ratNtaSchtrmeaetnmt eton ta host
prevenmtesmthberavnirea. lTahteta rcehsumltesn sthtoowanh ions Ftimguerme b5raa inned.icTahteedr ethsuatl tNsSsh woawsn abinleF tiog iunrheib5iAt thined iincfaetcetdivitthya; tinNdSeed no
wasabcyletotpoaitnhhici bietfftehcet inwfaesc tivviistuya;liinzdedee dbyn oincvyetortpeadt hmiciecrffoescctowpya sivni stuhael iztreedatbeyd ininvfeerctteedd mcieclrlso. scMopoyreover,
intheqtureaantteifdiciantifoenct eodf vcierlalls .DMNoAre boyv erre,aql-utiamneti fiPcCaRti odnemofovnsirtraaltDedN tAhabt yinrceuabl-attiimone PofC tRhed vemiraol nssutsrpateendsion at
thatinlocwub taetmiopneroaftuthree wviirtahl NsuSs epxetnrasciotsn eaffticloiewnttlyem inpheibraittsu vreirawl iDthNNAS aeccxutrmacutlsateifofinc i(e**n*t ply <i n0.h0i0b1i)t sif vciormalpared
DNAtaoc tchuem inufleacttieodn u(*n*t*repa<te0d. 0c0el1l)s i(fFcigoumrep a5rbe)d. Ttoo ctohnefiinrmfe cttheedseu dnatrtae,a wteed ecmelplslo(yFeigdu ar ere5cBo)m.Tboincaonnt fivrirmus able
thesetdoa teax,pwreesse ma psltoryuecdturaarl eVcoPm26b intaagngtevdi rwusitha bglereteone xflpuroersesscaesnttr upcrtoutreainl V(GP2F6P)t.a gVgPe2d6GwFitPh-HgSreVe-n1 viral
fluoressucespnetnpsriootnesin w(eGrFe Ps)u.bVjePc2te6dG FtoP -tHheS Vbi-n1dviinrga lassussapye annsdio nussewd etroe isnufbecjet cVteedrot ocethllse. bFiingduirneg 5acs dsaeymaonndstrated
usedttohei nafceccutmVuerlaoticoenll so.f Fthigeu aruet5oC-fludoermesocnesntcrea toefd vtihrael apcrcouteminu VlaPti2o6n doufrtihnge athuet ola-flteu sotraegsec eonf cveiroafl vreipralilcation
proteionnVlyP i2n6 ldesusr i5n%g othf ethlae tetresatategde ionffevcitreadl rceeplllsi ciaf tcioonmopnarlyedi ntol etshse5 u%ntorfeathteedt rineafetcetdedin cfeelclste. dIncdeelelsdi, fin the
comparedtotheuntreatedinfectedcells. Indeed,intheuntreated-infectedgreendotscorresponding
toVP26viralproteinaccumulation,VP26GFP-positivecellswereobserved. Inthetreated-infected
cells,thegreendotsdecreasedsignificantly(Figure5C,I).
Description:Keywords: herpes simplex virus 1; flavonoids; antiviral activity; binding undergo a lytic infection in epithelial cells and a latent infection in sensory