Table Of ContentPROTOCOL
Virulence3:6,539–542;October1,2012;G2012LandesBioscience
Multiple locus VNTR fingerprinting (MLVF) of Streptococcus pyogenes
Katarzyna Obszańska, Anna L. Borek, Waleria Hryniewicz and Izabela Sitkiewicz*
DepartmentofEpidemiologyandClinicalMicrobiology;NationalMedicinesInstitute;Warszawa,Poland
Streptococcus pyogenes (GAS) is a within S. pyogenes genome (PP, phage
human pathogen that causes mil- profiling).1-3 Nevertheless, both methods
lions of infections worldwide. aremorefocusedonmobileportionofthe
Comparison between GAS strains iso- genome. To improve and balance the
lated in different laboratories all over the typing scheme developed for GAS and to
world is often difficult. Three usually reflect variability of a core (non-MGE
used methods have either low resolution related) genome, we recently proposed a
(emm typing), are expensive (MLST) or new typing method.4
time- and labor-consuming (PFGE). Our Multilocus variable tandem repeat ana-
laboratory recently developed new, inex- lyses (MLVA and MLVF) are methods
pensive methods of GAS typing—VF based on the detection of repeated
(virulencefactorprofiling)andPP(phage sequences within bacterial genomes.
profiling).Toimprovethetypingscheme MLVF (multiple locus variable number
developedforGAS,werecentlyproposed tandem repeat fingerprinting) is based on
a new typing method. Here we present the amplification of several loci of variable
detailed protocol for MLVF analysis. size and comparison of generated band
patternswithareference.MLVA(multiple
locus variable number tandem repeat
analysis)isbasedonthesameprinciples as
Introduction MLVF, but instead of pattern analysis,
number of repeated sequences within each
Streptococcus pyogenes (GAS) is a human locus is used to generate unique code that
pathogenthatcausesmillionsofinfections can be stored in the database. Both
worldwide. Comparison between GAS methodsarecheap,fastanddonotrequire
strains isolated in different laboratories all specialized equipment, except a thermo-
overthe world isoften difficult.Currently cyclerandelectrophoresistank.Informative
threemajormethodsareusedtodetermine results, comparable with PFGE analysis,
relationships between GAS strains: canbeavailableinlessthan10h.
(1) emm typing, which allows for clas- The method we developed is based on
sification of strains into ~150 serotypes, the size variation within seven loci. The
(2) multilocus sequence typing (MLST) number of the size variants varies from
and (3) restriction analysis combined with severaltotensfortestedgenes.Asaresult,
pulse field gel electrophoresis (PFGE). All about 40,000 MLVF patterns can be
Keywords: MLVF, typing, Streptococcus
three methods have either low resolution generated4.Themethodisusedforroutine
pyogenes, multiplex PCR, PCR detection
(emm typing), are expensive (MLST) or work and S. pyogenes typing in our
Submitted: 06/15/12 time- and labor-consuming (PFGE). Our laboratory. We analyzed over 700 strains
laboratory recently developed new, inex- using the procedure described below and
Revised: 10/03/12
pensive methods of GAS typing. The first observed that homogenous populations,
Accepted: 10/04/12
method (VF), allows detection of 20 which belong to the same M type and
http://dx.doi.org/10.4161/viru.22459 virulence factors, the second method is exhibitthesamePFGEpatternandMLST
based on PCR detection of the mobile profile, can be further differentiated using
*Correspondenceto:IzabelaSitkiewicz;
Email:[email protected] genetic elements (MGE) integration sites MLVA typing.4
www.landesbioscience.com Virulence 539
Table1.StartersusedforMLVAtyping lysozyme, 5 ml of RNase and 2.5 ml of
Primer Primerdesignation Primersequence mutanolysin for about 30–45 min at
number 37°C. Purified DNA used as a template
1 Spy1_MLVA_F AGTTGCGGTGTCAGCATCAG should be diluted 10(cid:1) to a ~10 ng/ml
concentration. We usually run multiple
2 Spy1_MLVA_R AGCGCAGCAGCTGTAAAGAA
analyses in 96-well plate format, so we
3 Spy4_MLVA_F CCTGATCACTATTAGTAACAGACTTAAC
dispensedilutedDNAtostandard96-well
4 Spy4_MLVA_R ACTGCATGATGACTGGGTACAC
plate and use it in further reaction setup.
5 Spy2_MLVA_F CAGCTGCTGAAGATGGCTTATCAG Diluted template DNA should be kept at
6 Spy2_MLVA_R GCGTTGGGGTAACGAGTATAGC 4°C to avoid freezing/thawing cycles.
7 Spy3_MLVA_F AGGTGCAAGTGCGGTTAAGG Starters. Because the amplification
efficiency of designed starters varies, we
8 Spy3_MLVA_R GTCGTGAGCTGCCGGTGTTTTTG
combine various amounts of individual
9 Spy6_MLVA_F CTCACGTAAGCCGCTGATGA
100 mM primers stocks to prepare
10 Spy6_MLVA_R CTCCCAAAGACCAGTCGTCTC
primer mastermix that used in the PCR
11 Spy7_MLVA_F TAAATTCTCAAACATCTTATCAGTTTCATTTTGAG reaction will yield products of compar-
12 Spy7_MLVA_R CTCAAACAACTGATGATGCTGACAGAGACTATG able intensity. We mix 1 volume of
13 Spy5_MLVA_F GCCAACTAAGGGTTCAGGTCAG primers 1–6, 0.5 volume of primers 7–
10, 2 volumes of primers 11 and 12 and
4 volumes of primers 13 and 14. For
Reagents Equipment example:30mlofprimers1to6,15mlof
primers 7 to 10, 60 ml of primers 11 and
(1) RNase 10 mg/ml (Sigma-Aldrich, (1) Veriti PCR cycler (Life Technologies). 12 and 120 ml of primers 13 and 14.
R5503) (2) Gel electrophoresis tank (BioRad, Primer mix should be aliquoted into 25–
(2)Lysozyme20mg/ml(Sigma-Aldrich, 170-4511) with 26 well combs (BioRad, 250mlportionsandstoredat−20°Cuntil
L6876) 170-4525) use. Each primer mix portion should
(3)Mutanolysin10U/ml(Sigma-Aldrich, never be thawed/frozen more than 2
M9901) Setup times. (Problem 1)
(4)1mMstockoffourdNTPprepared Reaction setup. (1) Prepare diluted
from100mMstocksolutionsofindividual Template.AsatemplateforPCRreaction template DNA (as described above),
dNTPs(Sigma-Aldrich,DNTP100) we use chromosomal DNA isolated using preferably in 96-well format, or 8-well
(5) Taq polymerase (Fermentas, commerciallyavailablekits.Wehavegood strips. Template DNA dispensed into
EP0402) results with columns Genomic Mini wells/strips can be easily transferred to
(6) 10(cid:1) Taq buffer with (NH ) SO produced by A&A Biotechnology (116- reaction wells with a multichannel
4 2 4
(Fermentas, B33) 250), but kits available from other man- pipette.
(7) 25 mM MgCl stock solution ufacturers may be used as well. S. pyogenes (2) Mix together all reagents for PCR
2
(Fermentas, R0971) cells for DNA isolation are grown on half mastermix according to Table 2.
(8) Starters (Table 1; Genomed, www. oftheagarplate(Columbiawith5%sheep (3)Dispense9mlofpreparedmastermix
genomed.pl) blood, multiple manufacturers). Prior toeachofthereactionwellsorPCRtubes.
(9) 2.5% wt/vol NuSieve agarose purification bacteria are scraped from the (4) Transfer 1 ml of DNA template
(Lonza, 50094) (in 1(cid:1) TBE) plate and re-suspended 200 ml of TE from template DNA plate to the reaction
(10) 1(cid:1) TBE electrophoresis buffer buffer. Bacteria are treated with 10 ml of plate with multichannel pipette.
Table2.CompositionofPCRmastermix
PCRmastermix 1(cid:1)persinglereaction(ml) 55(cid:1)perhalfof96wellplate(ml) 110(cid:1)per96wellplate(ml)
Primermix 2.5 137.5 275
Buffer10(cid:1) 1 55 110
25mMMgCl 1.6 88 176
2
1mMdNTP 1.6 88 176
Taqpolymerase 0.1 5.5 11
H O 2.2 121 242
2
540 Virulence Volume3Issue6
reference strain (size or present/absent)
(Problem 2).
Timing
(1) DNA isolation ~90 min
(2) Reaction setup ~15 min
(3) PCR ~4 h
(4) Electrophoresis ~3.5 h
Problem Handling
Problem 1. We sometimes observe low
yield of PCR products. This is a result of
non-efficient PCR amplification that is
caused either by low quality of primers or
template.Primersandthetemplateusedin
the reaction are often degraded after
multiple freezing/thawing cycles. To max-
Figure1.ResultsofroutineMLVFanalysisof17GASstrains.Eachstrainismarkedwithemmtype,
imize PCR efficiency primer mastermixes
VFprofile1,2andPPprofile,1,3eachnumericaldesignationdenotesuniquepatternwithinthe
analyzedgroupofstrains,strainswiththesamedesignationhaveidenticalprofiles.Identical arekeptat−20°Cinsmallportionsandare
patterns6and7representtwostrainsofthesameserotype(M89),thesameVFprofile(3)andthe neverfrozen/thawedmorethantwotimes.
samePPprofile(2).Patterns14–17representfourM117strains.MLVFpatternsofstrains15–17,as AlsodilutedchromosomalDNAiskeptin
wellasVFandPPprofiles,areidentical,strain14hasdistinct,butrelated,MLVFandVFprofiles.
thefridgetoavoidmultiplefreezingcycles.
Lane1:GeneRuler50bpstandard(Fermentas).
Problem 2. In some patterns, very
strong bands can be observed among
(5) Close tubes or seal the plate. electrophoresis cell for 3.5 h. Gels are weaker ones. It is a result of multiple
(6)Mixwellandspinfor15sec(tubes) visualizedunderUVlightandphotographed. bands of similar size. Double, more
or 1 min at 500 rpm (plates). (3)Gelanalysis.Patternanalysiscanbe intense bands are often observed for M1
(7)Placethepreparedplate/tubesinthe performed on multiple levels. (1) When (about 750 bp in size) and M28 (about
thermocycler and run the program. MLVF is simply used to check if two or 630 bp) serotype strains. Depending on
Equipment setup. No special setup more strains are identical, visual band the electrophoresis equipment, for better
is required. We usually store saved matching of two or multiple patterns can separation of PCR products, time of
PCR amplification program listed be performed. (2) In case of multiple electrophoresis could be extended.
below. samplesthatgeneratevariablepatterns,we
recommend more detailed analysis. Anticipated Results
Procedure Usually, based on the photograph, we
estimate size of the amplified products The gel presented in Figure1 shows
(1) PCR amplification. Initial with the imaging software that allows typical results of MLVA analysis of
denaturation, 95°C, 5 min automatic determination of the product multiple strains. MLVA patterns in lanes
40cyclesof:denaturation,95°C,15sec; size (in our case Molecular Imaging 6–7 are identical and represent two
annealing,64°C,30sec;elongation,72°C, Software by Kodak, supplied with the strains of serotype M89 with identical
4 min 30 sec GelLogic 2000 imaging system). It is virulence factor profiles (VF) and phage
Final elongation, 72°C, 7 min mucheasiertocompareproductsizesthan profiles (PP), patterns 8 and 9 are related
(2)Gelelectrophoresis.Theproductsof patterns on the gel photograph. (3) To and represent two M95 strains with
multiplex PCR reactions are analyzed by compare MLVF patterns of samples run identical virulence factor profile (VF).
electrophoresis in 2.5% (wt/vol) NuSieve on multiple gels we use BioNumerics Patterns 7 and 8 are not related. All
agarose gel with ethidium bromide, in software.Thesoftwareallowstonormalize bands in these patterns differ in size or
standard TBE buffer. We usually use 50 patterns between multiple gels/runs, com- are not present.
bpand100bpladder(Fermentas,SM0371, pare them to each other, and cluster
SM0321), which allows precise fragment similar patterns. Acknowledgments
sizedetermination. We consider two strains as closely The work was financed by the grant from
Electrophoresis is performed with con- related if they differ by no more than National Center for Science (NCN)
stantcurrent100mAinSub-CellModel192 single band within the profile from the number NN401 536140.
www.landesbioscience.com Virulence 541
References 3. BorekAL,ObszańskaK,HryniewiczW,SitkiewiczI.
TypingofStreptococcuspyogenesstrainsusingthephage
1. Borek AL, Wilemska J, Izdebski R, Hryniewicz W, profiling method. Virulence 2012; 3:534-38; PMID:
SitkiewiczI.Anewrapidandcost-effectivemethodfor 23076280;http://dx.doi.org/10.4161/viru.21887
detectionofphages,ICEsandvirulencefactorsencoded 4. ObszańskaK,BorekAL,Izdebski R, Hryniewicz W,
byStreptococcuspyogenes.PolJMicrobiol2011;60:187- SitkiewiczI.Multilocusvariablenumbertandemrepeat
201;PMID:22184925 analysis(MLVA)ofStreptococcuspyogenes.JMicrobiol
2. BorekAL,ObszańskaK,HryniewiczW,SitkiewiczI. Methods2011;87:143-9;PMID:21920391;http://dx.
DetectionofStreptococcuspyogenesvirulencefactorsby doi.org/10.1016/j.mimet.2011.08.017
multiplex PCR. Virulence 2012; 3:529-33; PMID:
23076284;http://dx.doi.org/10.4161/viru.21540
542 Virulence Volume3Issue6