Table Of ContentHYM. RES.
j.
Vol. 9(2), 2000, pp. 241-245
Molecular Confirmation of Host Records for Ichneumonoid
Parasitoids of Wood-boring Beetle Larvae
Nina M. Laurenne, Robert Belshaw, Gavin Broad and Donald L. Quicke
J.
(NML) Finnish Museum of Natural History, Zoological Museum, Entomological Division, P.O.
Box 17 (P. Rautatiekatu 13), FIN-00014 University of Helsinki, Finland. (RB, GB, DLJQ) Unit of
Parasitoid Systematics, CABI Bioscience UK Centre (Ascot), Department of Biology, Imperial
College at Silwood Park, Ascot, Berkshire SL5 7PY, U.K., (GB, DLJQ) Centre for Population
Biology, Imperial College at Silwood Park, Ascot, Berkshire SL5 7PY, U.K., and (DLJQ)
Department of Entomology, The Natural History Museum, London SW7 5BD, U.K.
—
Abstract. Field observations in Sabah of a large braconine wasp, Shelfordia sp., investigating
and ovipositor-probing at a frass hole in an exposed tree root suggested the possible location of
a host. Investigation of the substrate revealed a paralysed and partly consumed larva of an an-
thribid beetle that had a 1st instar parasitic wasp larva on it. Both adult and larval wasps were
sequenced, in separate laboratories, for the D2-D3 expansion region of the nuclear 28S rDNA
gene. The sequences were identical and consideration of their unique features compared with
many other sequences from ichneumonoids leads to confirmation that the hosts of Shelfordia spp.
include Anthribidae living in tree roots. The implications of DNA sequencing for constructing
quantitative food webs are discussed.
Host records for parasitic Hymenoptera cedures requiring much skill and at least
are notoriously unreliable as hasbeenwell some luck. The development of molecular
documented by Shaw (1994) and Noyes techniques, in particular DNA sequencing,
(1994). Errors in the literature derive from has opened new and in some respects eas-
several sources including misidentifica- ier ways to solve these problems.
tion of the parasitoid, misidentification of The braconine genus Shelfordia Cameron
the host, misidentification of both, and is relatively common from India, through
through the wrong association of a para- the Indo-Australian Region, to N.E. Aus-
sitoid with a putative host because of con- tralia, often being found in local collec-
tamination of the rearing system. These tions, no doubt because its species are
problems are particularly true for con- rather large by parasitic wasp standards.
cealed hosts such as wood-borers, gall Its identification has not been without
makers, etc., because these substrates can problems though, and since its original
contain many potential host species apart description (Cameron 1902), nothing had
from the one that may be the focus of at- been published on it under that name un-
tention. Simply rearing a parasitoid and a til it was discovered to be a senior syno-
potential host from a given piece of sub- nym of Sigalphogastra Cameron (Quicke
strate has consequently often led to incor- 1982). The genus name Sigalphogastra had,
rect conclusions about what is parasitising however, been very inconsistently ap-
what. Although it is sometimes possible plied, and few of the older publications
carefully to dissect substrate and to iden- citing this name (Shenefelt 1978) actually
tify any host and parasitoid remains, or to refer to taxa congeneric with the type spe-
isolate and rear the host and its parasitoid cies. In 1984, Quicke described a new ge-
in isolation, these are both difficult pro- nus Rostraulax, based on a species similar
242 Journal of Hymenoptera Research
to Shelfordia sensn stricto, but which had an be searching. However, after several hours
elongate labio-maxillary complex and of observation, the wasps were never seen
partly fused apical flagellomeres (Quicke near this tree, but only near the path. The
1984a). Although Rostraulax is recognisa- wasps were very cautious; they remained
ble by these autapomorphies, Shelfordia is, stationary on the low vegetation for long
as far as we can tell at present, left para- periods, and were easily disturbed by tour-
phyletic with respect to Rostraulax, and the ists passing by. After some while, however,
letter was formally synonymised with we observed one and then another fly to
Shelfordia by van Achterberg (1993). Prior land on a small (approximately 5cm diam-
to now, there have been no available host eter) tree root that was partially exposed by
data for the genus Shelfordia, although the the path. Againthewasps remainedstation-
especially long ovipositor of one Indian ary for about 20 minutes when one ofthem
species, S. longicaudata van Achterberg, approached a boring from which fresh-
suggests that it is potentially a parasitoid looking wood particles were exuded. After
of a host living deeply within wood (van antennating the site for several minutes, she
Achterberg 1993). Since its original de- raised her metasoma and probed into the
scription, some 35 species have been re- frass hole with her ovipositor and sheathes,
classified into it (or its synonym, Rostrau- After a few moments she was observed
lax) (Quicke 1983, 1984b, 1985, 1988, 1991, making marked twisting movements with
Quicke and van Achterberg 1990, Quicke the apex ofher metasoma and she was then
and Koch 1990, van Achterberg 1993, van collected.
Achterberg and O'Toole 1993), of which METHODS
11 are from the island of Borneo, all from —
Sarawak. No species-level keys are avail- Collection. The apparently-ovipositing
able for Shelfordia, and proper taxonomic adult female Shelfordia was collected with
revision is required before the species re- a net and placed into a clean vial contain-
ferred to here can be properly identified. ing 95% ethanol. Other adult wasps re-
ferred to in this paper were collected in
FIELD OBSERVATIONS me same way or in Maiaise traps contain-
In August 1999, DLJQ and NML had the ing 95% ethanol. The tree root with frass
opportunitytocollaborate with thegroupof hole was dissected the same day with a
Dr Maryati Mohamed of the Tropical Bio- saw, hammer and chisel, and a boring lo-
diversity and Conservation Unit, Universiti cated below the frass hole which con-
Malaysia, Sabah, and to observe some large tained a paralysed and partly deflated
braconid wasps in lowland tropical rain for- beetle larva upon which was a single
est at Poring (Kinabalu National Park), small (<lmm long) parasitoid larva. The
Along a short stretch of one popular forest beetle and parasitoid larvae were handled
trail, some six or seven conspecific females with watch-makers' forceps and trans-
of the large, entirely tropical, braconine ferred to a clean tube—with 100% ethanol.
wasp genus Shelfordia, were seen flying or Laboratory protocols. For adult insects,
sitting on low vegetation over a period of DNA was extracted in the U.K. from sin-
several days. As no host records are known gle individuals stored in 100% ethanol by
for this genus we decided to observe them incubation at 37°C in Proteinase K for ap-
to see what they were attacking. Large bra- proximately 18 hours, followed by sodium
conine wasps are typically thought to be acetate/ethanol precipitation and re-sus-
parasitoids of wood-boring beetle or lepi- pension in 20|xl TE buffer. PCR reactions
dopteran hosts, and a large dead tree with were carried out in 50fxl volumes contain-
DNA
abundant signs of borer activity nearby ing 0.5(xl extract, 0.5|xl Boehringer
seemed to be the obvious place for them to Taq, 1.25 fxl 20|xM primer, 1.25 |xl lOmM
Volume 9, Number 2, 2000 243
dNTPs and 5|xl buffer. PCR conditions of the D2 region that was readable for
were 30 cycles of 98°C denaturation (15 both (the small larva gave a weak se-
seconds), 48°C annealing (30 seconds) and quence). These sequences were aligned by
72°C extension (40 seconds) with an initial eye to each other and to those of a range
denaturation of 3 minutes at 93°C and a of other S.E. Asian Braconinae, including
final extension of3 minutes. PCR products a similarly-sized species of the related ge-
were purified with Pharmacia Amersham nus Diamblomera Enderlein, collected in a
PCR purification kit and then sequenced similar site approximately 150 meters
directly using Amplitaq FS on an ABI 373 away (Quicke et al. 2000), and several oth-
automated sequencer. er braconines from Poring. Part of the
The parasitoid larva was stored in 95% alignment is shown in Figure 1, in which
DNA
ethanol and extraction and sequenc- several features that are shared by both
ing was carried out in Helsinki. The larva the female Shelfordia and the parasitoid
was dried and ground in 50li1 TNE-buffer larva found are indicated in bold italics.
M M M
(I1liI prTortise,in5ase KNa(CSl,igm0.a5 ChemEiDcTaAl)Coa.n)d. DISCUSSION
The samples were then incubated at 37°C The present findings of an identical 28S
overnight followed by sodium acetate D2 DNA sequence for both the adult Shel-
and ethanol precipitation, and resuspen- fordia and the parasitic wasp larva found
sion in 20 |jl1 TE-buffer (as TNE but with- on its anthribid host (Fig. 1) can only be
out NaCl). PCR reactions were carried out considered in the light of our knowledge
in 50 fxl volume reactions, 5 |xl 10X Buffer of interspecific variation of this gene re-
II (Perkin-Elmer), 5 |xl of 25 nM MgCL, 2 gion within the Braconidae, and more pre-
nM
|xl 10 llM primer, 3 llI of 10 dNTP, 0.25 cisely, the Braconinae. In the laboratory at
DNA
|xl Amplitaq Polymerase, 31.75 luI Silwood Park, this gene region has been
H2 and 1 jxl DNA template. PCR condi- sequenced for more than 250 species of
tions after an initial denaturation at 94°C Braconidae and for 98 species of Braconi-
(2 min), were denaturation at 96°C (15 s), nae (Belshaw et al. 1998, in preparation),
annealing at 55°C (30 s), extension at 72°C On no occasion were any two species
(1 min) for 35 cycles and a final extension found to have identical sequences, even
72°C (7 min). congeneric species always differing by at
The larval PCR product was purified us- least two or three bases, and often by the
ing Nucleospin PCR Purification kit and presence of species-specific insertions or
then sequenced in both directions using Big deletions (the above-mentioned Braconi-
Dye terminators on an automatic sequencer nae data set includes 7 species each of Di-
ABI PRISM 377 (Perkin-Elmer). gonogastra Ashmead and of Bracon Fabri-
The beetle larva was identified as an cius). Note also that there are several dif-
anthribid by reference to Lawrence and ferences between the sequences of the two
Britton (1991). Specimens are deposited Nesaulax Roman species from Sabah se-
in The Natural History Museum, Lon- quenced (Fig. 1). Contamination of the
DNA
don. Full sequences are in the samples is considered highly improbable
EMBL/GenBank/DDBJ databases; acces- because the specimens were not handled
sion numbers AJ231540, AJ231541 and by the same equipment, were placed in
DNA
AJ277499-AJ277504. separate clean vials, and extraction
and sequencing was carried out in differ-
ent countries. This study emphasises the
The parasitoid larva and the putatively potential for the use of DNA sequence
conspecific Shelfordia adult produced iden- technology for making firm parasitoid/
tical sequences for the 480 base pair length host associations that would not otherwise
244 Journal of Hymenoptera Research
ShelfordiaAD TAATTGTAAGATGTTGTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGT
ShelfordiaLA TAATTGTAAGATGTTGTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGT
DiamblomeraS TAATTGTAAGATGTTGTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGT
Nesaulax sp 1 TAATTGTAAGATGTTGTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGT
Nesaulax sp 2 TAATTGTAAGATGTTGTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGT
Pachybracon TAATTGTAAGATGTTGTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGT
Nedinoschiza TAATTGTAAGATGTTGTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGT
Cratobracon TAATTGTAAGATGTTGTCGGCGTGCACTTCTCCCCTAGTAGGACGTCGCGACCCGT
Hybogaster TAATTGTAAGATGTTGTCGGCGTGCAcTTCTCCCCTAGTAGGACGTCGCGACCCGT
ShelfordiaAD TGAGTTTTTTTGTT--GGTCTACGGCCCAAGTGGAAGCTTTTAATAAATT-
ShelfordiaLA TGAGTTTTTTTGTT--GGTCTACGGCCCAAGTGGAAGCTTTTAATAAATT-
Diamb1omeraS TGAAT GTT--GGTCTACGGCCCAAGTGGTAGCTTTTAGTGAATT
Nesaulax sp 1 TGAGT GTTTCGGTCTACGGCCCAAGTGGAAGCTTTTAATGAATT
Nesaulax sp 2 TGAGT GTTTCGGTCTACGGCCCAAGTGGAAGCTTTTAATGAATG-AATT-
Pachybracon TGAGT TGTT--GGTCTACGGCCCAAGTGGGAGCTTTTAATGAATT
Nedinoschiza TGAGT GTT--GGTCTACGGCCCAAGTGGAAGCTTTTAGTGAATGAAATTT
Cratobracon TGAGTAC GTT--GGTCTACGGCCCAAGTGGTAGCTTTTAATGAATA
Hybogaster TGAGT TGTT--GGTCTACGGCCCAAGTGGGAGCTTTTAATGAATT
ShelfordiaAD TTATTTATTAAAAA-CCCTTGGTGTT TCCTGACTGGCACTCGTCGGTATATAC
ShelfordiaLA TTATTTATTAAAAA-CCCTyGGTGTT TCCTGACTGGCACTCGTCGGTATATAC
Diamb1omeraS TTATTCATTGAAAA-CCCTTGGTGTT TCCTGACTGGCATTCGTCGGTAT-T-C
Nesaulax sp 1 TTATTTATTGAAAA-CCCTTGGTGTT TCCTGACTGGCACTCGTCGGTAT-T-C
Nesaulax sp 2 TTATTTGTTGAAAA-CCCTTGGTGTT TCCTGACTGGCACTCGTCGGTAA-T-C
Pachybracon TTATTCATTGAAAA-CCCTTGGTGTT ACCTGACTGGCACTCGTCGGTAT-T-C
Nedinoschiza TTATTCATTGAAAA-CCCTTGGTGTT TCCTGACTGGCACTCGTCGGTAT-T-C
Cratobracon TTATTCATTGAAAA-CCCTTGGTGTTGTTTCCTGACTGGCACTCGTCGGTAT-T-C
Hybogaster TTATTCATTGAAAAACCcTTGGTGTT TCCTGACTGGCGCTCGTCGGTAT-T-C
ShelfordiaAD
Volume 9, Number 2, 2000 245
by the Natural Environment Research Council. We gian Journal ofAgricultural Science Supplement 16:
are grateful to Professor Maryati Muhamed and Dr 59-69.
Homathevi Rahman, Tropical Biodiversity and Con- Quicke, D. L. J. 1982. The genus Shelfordia Cameron
servation Unit, UMS forall theirhelp and advice. Dr (Hymenoptera: Braconidae): Discover)' of type
Mark Shaw provided many helpful suggestions in specimen, reclassification of species, new svn-
the preparation ofthis MS. onymy and notes on related genera. Oriental In-
sects 15: 227-233.
LITERATURE CITED Quicke, D. L. J. 1983. Reclassification of twenty spe-
ciesoftropical, Old World Braconinaedescribed
Achterberg, C. van. 1993. A new speciesofthegenus by Cameron, Strand and Szepligeti (Hvmenop-
gSwihisetclhhfeorvMdeieradyedCleaolnmigengroeovnin,poL(seiHitydoemrnenf6o7r:potm3e6rN5a-E:37I3Bn.rdaiac.onZiodoaleo)- QuickzAteeiurn,saet:rD1a.1Bl9ri:aLa.c8no1Jn-.iB8dr31aa.9ec8)4o.an.iEnnTatheormeo(elHovgnmiesetnw'ospgteMenorenart:ahloyBfraMIcanogdnaoi---
Achterberg, C. van and C. O'Toole 1993. Annotated dae). Entomologist's Monthly Magazine120:73-79.
tceartaa)loinguteheofOxtfheortdypUensivoefrsBirtaycoMnuisdeaeum(.HvZmooelnoogips-- Quickter,opiDc.alL.aJn.d19I8n4db.o-AFuusrttrhaelriarenclBasrsaicfoincaitniaoen o(fHAyfmreo--
che Verhandelingen, Leiden 287: 1^48. noptera: Braconidae). Oriental Insects 18: 339-353.
Agusti, N., M. C. DeVicente and R. Gabarra. 1999. Quicke, D. L. J. 1985. Reclassification of some Indo-
Development of sequence amplified character- Australian and Afrotropical Braconinae (Hyme-
ized region (SCAR) markers of Helicoi'erpa armi- noptera: Braconidae). Entomologist's Monthly
gera: a new polymerase chain reaction-based Magazine 121: 215-216.
technique for predator gut analysis. Molecular Quicke, D. L. J. 1988. Reclassification of twentv-four
Ecology8: 1467-1474. speciesofOld World Braconinae(Hym., Bracon-
Belshaw, R., M. Fitton, E. Herniou, C. Gimenoand D. idae). Entomologist'sMonthlyMagazine124:77-79.
L.J. Quicke. 1998. A phylogeneticreconstruction Quicke, D. L. J. 1991. The Braconinae typespecimens
of the Ichneumonoidea (Hymenoptera)based on ofG. Szepligeti in Budapest (Hvmenoptera, Bra-
the D2 variable region of 28S ribosomal RNA. conidae). Annals Historico-Naturalis Museum Na-
Systematic Entomology23: 109-123. tionalis Hungarici83: 169-186
Cameron, P. 1902. On the Hymenoptera collected by Quicke, D. L.J.andC.vanAchterberg. 1990.Thetype
Mr. Robert Shelford at Sarawak, and on the Hy- specimensofEnderlein's Braconinae(Hymenop-
menoptera of the Sarawak Museum, journal ofthe tera: Braconidae) housed in Warsaw. Tijdschrifl.
Straits Branch ofthe Royal Asiatic Society37: 29-131. voor. Entomologie 133: 251-264.
Greenhsytbornidei,saMt.ionH.praonbdefMo.reJn.dEodpawraarsdist.is1m99b8y.MDicNroA- Quickmea,n.D.20L0.0J..,FGi.rstBrpooasds,ibNl.eMho.stLaruerceorndnefoarntdheJ.bNraaic--
plitis croceipes (Hymenoptera: Braconidae). An- onidwaspgenusDiamblomeraEnderlein(Bracon-
4n2al1s.oftheEntomologicalSocietyofAmerica91:415- Quickiena,e)D..JoLu.rnJ.alanofdHyF.meKnoocpht.er1a99R0e.seDairechB9r:ac4o3n0i-n4a3e1.-
LaurCehnacpe,terJ. 3F5..aTnhde EI.nseBc.tsBroifttAouns.tra1l9i9a1.(2C,oulleedoipttieorna).. ZTSeyaiptmsemcnhlruidfnetgr3eb7n:ei2dd1ee3rn-2bD2e7Dd.Re.uteDenudtsstcehneHEvnmteomnoolpotgiesrcehne
CSIRO, Melbourne.
Memmott, J. and H. C. J. Godfray. 1993. Parasitoid ShawH,awMk.inR.s1a9n9d4.WP.arSahseiteohiadnh(oEsdts).ranPagreass.itIoni:dBC.omA-.
webs. In J. LaSalle and I. D. Gauld eds, Hyme- munity Ecology. Oxford University Press,Oxford,
noptera and Biodiversity, pp. 217-234. CABI Inter- pp. 111-144.
national Press. VVallingford. Shenefelt, R. D. 1978. Hymenopterorum Catalogus (Nova
Noyes, J. S. 1994. The reliability of published host- Editio). Braconidae It). Junk, The Hague, pp. 1425-
parasitoid records: A taxonomist's view. Norwe- 1872.