H+ Magazine - Issue 4

2009·10.9 MB·English

by  Humanity+

DESIGNER
BABY
m a g a z i n e CONTROVERSY
ISSUE 3 SUMMER 2009
From
X PRIZE to
Singularity U
BIOHACKING
ARRIVES
Legalize
Sports
Doping?
WAS THAT
A BOT OR
CHRIS CONTE’S
MICROBOTIC ART A HUMAN?
TTTTThhhhheeeee LLLLLiiiiifffffeeeee EEEEExxxxxttttteeeeennnnnsssssiiiiiooooonnnnn FFFFFooooouuuuunnnnndddddaaaaatttttiiiiiooooonnnnn iiiiisssss ttttthhhhheeeee nnnnnooooonnnnn-----ppppprrrrrooooofififififittttt ooooorrrrrgggggaaaaannnnniiiiizzzzzaaaaatttttiiiiiooooonnnnn ttttthhhhhaaaaattttt fffffuuuuunnnnndddddsssss aaaaannnnntttttiiiii-----aaaaagggggiiiiinnnnnggggg rrrrreeeeessssseeeeeaaaaarrrrrccccchhhhh
Tahne dL riefep oErxttse mnseidoinc aFlo burnedakattihorno uisg hths ein n doins-epasreo fiptr eovregnatnioizna.t iIonn f athcta,t i ff uynodus’r ea ntatik-ianggin ag l orewse-darocshe
Taahnned dL rrieefepp ooErrxtttsse mmnseeiddoiincc aaFllo bburrneedaakkattthihorrnoo uuisgg hhthss eiinn n ddoiinsse-epaassreeo fipptrr eeovvreegnnattniiooiznna..t iIIonnn ff aathcctta,,t ii fff uyynooduus’’rr eea nttaatkik-iianngggin aag ll oorewws-e-ddaroocsshee
Tdaily aaahannnesdd dpL irrrireeefienppp oo oEtrrroxttttss se h mmmnesleeepidddo iiinpccc raaaFelllo v bbbuerrrnneeetdaaa kkkaatttt hhihhorrrenoooa uuuritsggg hhhathsstst eiiiannn cn kdddo,iiin sssyee-eopaaausssreeeo’r fieppp trrra eeeolvvvrreeeegnnanadtttniiiyoooi znnnba...et iIInIonnnen fifff aaattthcccitttan,,,t giii fff f ufyyyrnooooduuums’’’rrr eeeau ntttsaaat! kkik-Wiiiannngegggi’rn aaaeg lll tooorhewwwes --e-ddodanrooocssesheees
dTdaaiillyy ahaaness dppL iirrirefiiennp oEttrooxt t sehh mneeslleppido inppc rraFeelovv bueernnnettda kaaatt ihhhoreenoaa urrittsg haathttstt eiaan ccn kkdo,,i n syy-eoopauusreo’’rr fieep traa eollvrrreeegaanaddtniyyoi znbba.eet innIoneen fifif attttthciitnan,t ggi f f uffyrrnooodmums’r eauu ntssa!t! ikW-Wiangeegi’’rrn aeeg l ttorhhewees e-oodannroceeshess
ddaaiillyy aassppiirriinn ttoo hheellpp pprreevveenntt aa hheeaarrtt aattttaacckk,, yyoouu’’rree aallrreeaaddyy bbeenneefifittttiinngg ffrroomm uuss!! WWee’’rree tthhee oonneess
wdahiloy araenssdpe airrreicnph o traotn sdh m erleepdp ipocrraetl v nbeernewta kaat nhhdreo aburetg thtaetsrt ia nwc kad,yi ssye otaouse ’rh epe rlaeplvr eyeanodutiy ol inbv.ee nI nhe efifaatltctithn,i gief r f yrloooumn’gr eeu rts,a ! skWoin yeg’or aeu ltcohawen - odtanokesees
wwdahhioloy arraeensssdpee aairrrreiccnphh o taraotnn sddh m errleeepdpp iopocrrratetl v nnbeeernewwta kaaat nnhhddreo abbureetgt thttaeetsrrt i a nwwc kaad,yyi sssye ottaoous e ’rhh epee rllapeplvr yeyeanooduutiy oll iinbvv.eee nI hnhee efifaaatlltcttithhn,ii geief rr f yrllooooumnn’ggr eeeu rrts,,a ! sskWooin yyego’or aueu ltccohaawenn - odttaanokkeseees
wwhhoo rreesseeaarrcchh aanndd rreeppoorrtt nneeww aanndd bbeetttteerr wwaayyss ttoo hheellpp yyoouu lliivvee hheeaalltthhiieerr lloonnggeerr,, ssoo yyoouu ccaann ttaakkee
awddahviloay n rateasspgeaeirr iocnhf ftauont udhr eerlep mp poerrdeti vcneaenlw tb raae nahdke tabhrerto ttauetgrta hwcsk.a,y sy otou ’rhee laplr eyaoduy l ibveen heefiatlttihnige rf rloomng eurs, ! sWo ye’oreu tchaen otankees
aawdddahvviloaay nn ratteaasspggeaeeir r ioocnhff fftauuontt uudhrr eeerle p mmp poeerrddetii vccneaaenllw tbb rraaee naahdkket tahbhrerrtoo ttauuetggrta hhwcssk..a,y sy otou ’rhee laplr eyaoduy l ibveen heefiatlttihnige rf rloomng eurs, ! sWo ye’oreu tchaen otankees
aaddvvaannttaaggee ooff ffuuttuurree mmeeddiiccaall bbrreeaakktthhrroouugghhss..
awdhvoa nrteasgeaer ochf fauntudr ere mpoerdti cnaelw b raenadk tbherottuegr hws.ays to help you live healthier longer, so you can take
awdhvoa nrteasgeaer ochfB fauenctudor mere emp oae rdLti icnfaeel w Eb rxaetnaedkn tsbhierootntue gmr hwesm.aybs etro nhoewlp fyooru j ulisvte $ h4e5a lathnide rg leotn aglel rt, hsios !you can take
advantage ofBB fueecctuoormme eem aae dLLiiicffaeel EEbrxxettaeeknntsshiioroonnu mgmheesmm. bbeerr nnooww ffoorr jjuusstt $$4455 aanndd ggeett aallll tthhiiss!!
BBeeccoommee aa LLiiffee EExxtteennssiioonn mmeemmbbeerr nnooww ffoorr jjuusstt $$4455 aanndd ggeett aallll tthhiiss!!
advantage ofB fuectuorme em ae dLiicfael Ebrxetaekntshiroonu gmhesm. ber now for just $45 and get all this!
Become a Life Extension member now for just $45 and get all this!
■■■■■ F F F F FRRRRREEEEEEEEEE 11111-----YYYYYeeeeeaaaaarrrrr BBSSSSSuuuuueebbbbbccsssssoocccccrrrrrmmiiiiipppppeetttttiiiii oooooaannnnn LLtttttoooooii ffLLLLLeeiiiii fffffEEeeeee xxEEEEEttxxxxxeettttteeeeennnnnnnsssssssiiiiiiiooooooonnnnnnn mmeemmbbeerr nnooCCCCCwwaaaaa lllfflloolllll rr11111 jj-----uu88888ss66666tt 666$$6644-----5555555 99999aa88888nndd-----66666 gg77777ee44444tt 888aa88ll llttttt ttooooohh iijjjjjssooooo!!iiiiinnnnn tttttooooodddddaaaaayyyyy.....
■ MM FRaaEggaEazz i1inn-Yee,,e ajjaarm mSu--ppbaasccckkrieepddt iwwoniitt hhto cc Luuttittfieinn Egg--xeetddegngees i hhoeneaa lltthh Call 1-866-598-6748 to join today.
■■ MMnnMM F FeeRRaawaawEEggggssaaEEaa wwzzzz ii11iioonnnn--rrYYeeeelldd,,,,ee aawwjjjjaaaarriimm mmddSSeuue----pp pp bb((aaaa$$sscccccc55kkkkrr99iieeeepp..dddd88tt ii88wwwwoo nnniiniitttt eehhhhttwwoo cccc ssLLuuuussttttttiiaattttffiieeiinnnnnn ddEEgggg ----xxvveeeettaaddddeelluuggnnggeeeeeess )ii )hhhhoo..eenneeaaaa lllltttthhhh MMMMMCCeeeeeaannnnnlltttttlliiiiiooooo 11nnnnn --cccccooooo88ddddd66eeeee 66AAAAAVVVVV--55BBBBB9999999000008866666AAAAA--66..... WWWWW77eeeee44’’’’’lllll88lllll uuuuu ssssstteeeeeoo yyyyy ooooojjuuuuuoorrrrr iisssssnnpppppeeeee cccccttiiiiiaaaaaoolllll dd$$$$$44444aa55555yy ..
■■■■■■■■■■ n Fntn Fnt Fntt Fnttn Fntn FntMn FnMn Fn FMn FhhhohohheueuuRRRueueueueueRRRRRRR eee eeewwaaawwwwwrrr1rrrrr1EEEsssEEEEEEEssssssgggssssseee eee ssssssseeeeeeeeaEEEaEEEEEEEaaa sssssssswwHHHwwwww.HHH.zzz ,,, ,,,,,mmPPP 1PPPPPP iiiooooooonnnnnnnneeennneee-.hhh.hhhhhhrrrrrrraaaaaauuuuuuuu,Y,eeelllllll ooooooooolllllldddddddttt,,,tttttfeftttttt rrrorrrrronnnnnnnnnawwwwwwwhhhhhhjjjiiiiiiiiaaarrrttteeettttteeeeee iiiiiii mmmiiiiiiiiAAAAAA dd adddddSaooooooooaaaaaaaaanneeueeeeedddnnnddd---nnnnnccccccccc ppp ssbcccvvviiiccccccvvviiiii(((((((wwssssssssaaa$$eee$$$$$seeeeeeiiiiiittttttttsssccccssssssesssssse55sss55555sssssooooookkkrsssssssss,,,r,,,,,r9999999 i s srrreeerrreeepeeeeettttttttt.. ..... ssssssdddvvvooo88tvvvvvoooooo88888tt oo eeeieeeeetttttt88 88888 wwwoooodddooo ddddddnnn nnnnn yynnnlllooonnnnnllliiioooooo olllollltttpppppppp ---cccee---cccccceeeeehhhtuufffeeefffeeeeetttwwttttttwwwwworrr rrrooorrrroooooorrrrrrccceeeeee sssss ssssssssssrrrrrrrrLruuuheeeheeeooossooooossssssssssssss tt ttttttttiee,,,nnn,,,,,,nnnnnaaaaaaaaaaaaa tttf aannnnnnnnnnnnaaannneiiiaaaaannnnnnnllnnnlll llllltaaayyytaaaaaayyyddddddd E hggghtttttttttttt ttttt ddduuurrrddduuuuuurrrrr---x vv vvvvvaaaqeeeaaaaaqaaarrrtaaarrrrrraaaaaaaiiidddiiiiioooeuoooooouyyyyyylllllllnnnnnnnnuuuuuuun,,,ggg,,,pppppppppee eee eeeeeeeeeeeeeee777s777ssaaaaaaaaarrrrrrrrt))ti )))))ttt:::ssstttttt:::ssssshhhiio.......333333hhhhhhhhh........oo neee000000sssCCCssssssCCCCCnnaaa,,,,,,,,, s slllaaaaaaaaaaaaaa ttt ...lll...lllllhhhmmmlllmmmlllll ...... mryomryomryomryomryoMmryoMmryMmryCMmreeeeeeeeeooooooooffffffsssssssssfffeeefffeeeeeeuuueeeeuuuuuaeeeeeeeeeeeeeeemmmmmmmmmnnnn aaarrr aaaaaarrrlnnnnnnnn rrrttttrrrrrrbbbbbbbbbeeeleeeiiiiccccccccceeeeeeeeooooxxxeeexxx eeeeeehhhhhhhhheeeeeeee1rrrpppnnnnrrrrrrpppdddddddd.........sssssssss iiiiii hhh hhhhhhRRR-RRRRRRrrrccccrrrtttttttteeeeeeiiioooooooiiiiii8oooooeeeeeeeeepppppppppssssss dddd sssssssss hhh hhhhh 6111eee111eeeeeefffeeeeffffffeeeaaaeeeeeeeeaaaaaaeeeeee222 2226AAAAlllrrreeelllllrrrrrreeeeee///ppp///pppppccccccccc VVVV333333-(((((((((hhh hhhhhh rrryyyrrrrrryyyyy1111115BBBB eeeeeeeeeoooooooottt///tttttt///ggggggggg9999hhhhhhhhh0009000uuuuuuuuuuuuuuuuuaaa0000aaaaaa999999 8llleeelllllleeeeettttttttt6666......aaaaaaaaa xxx xxxxxcccrrrccccccrrrrrrAAAA-ttttttttllllllllloooooooooeeeeeeee6yyyyyyyyy....uuunnnuuuuuunnnnn WWWW$$$$$$$$$7lllllllllddddddddddddddddd777777777 eeee4 yyyyyyyy555555555yyyyyyyyy’’’’ooollllooooo)))))))))iii8iiiiiilllleee uuueeeeee uuuuu tttttttttuuuulllllllll rrrrrrrrooooooooodddddddddssss t llleeeelllll fffffffffiiioiiiiittttttttt uuufffuuuuuufffffhhhhhhhhhyyyyeeeeeeeennn nnnnnnooooeeeeeeeee jiiiiiiii ddd dddddduuuunnnnnnnniiiiiiiiionnn nnnnnn rrrrddddddddaaaaaaaaa fffiffffffnnnssssnnnnnneeeeeeeeooooooooonppppfifififififififitttttttttrrrrrrrrriiieeeeiiiiiimmmnnnmmmmmmnnnnn ---------ccccaaaaaaaaatiiiiiiiiiiiitttaaatttttaaaaaagggggggggaaaaoeeeeeeeetttttttttiiiiiiiiillllllliiillllliiiiiinnn nnnnnndyyyoooyyyyyoooooo$$$$ggg...gggggg.....nnnnnnnnn4444 a TTT TTTTT 5555yhhhhhhhh .iiiiiiiissssssss
to 1 a.m., for answers to your health questions
ttaatttnooohhnnu eedd11r1sss ee hheaaa s..eHH.e,mmmll ppnee... aau,,,ii nllntfffttooro hhiccrrrt uu iAAaaaossnnntddtnoosssvviwwwmmsiitsseeesiioorr,rzz sssrriie nnssttvt oogogett oo nyyyyyll ooooollp--uuuuufferrrrrrrree sdhhdheeo iieeenaaeeaaannattlll,,ltttyy hhheet ddrxx qqaqeeaaiuururyyncc,,eee eiiss77sssrtttee::siii33 .oooaa 00Cnnnnn sssddaaa ..l mml .. ooyoffffuee rrn eeexxeppdii rrteeoss h11e22l//p33 y11o//00u99 e..xtend your life indefinitely. This
and help in customizing your diet, exercise and
aassatttuoohunnn pepddd11spp e hhhaall eeeeH..emmmmlllpppe..ee a,,iiinn nnlnfftttoo h cccrrrr uuuee Aaaggsssnnttdtiioomomssvwwmmmieeseenniiiorrzzz..ssriii nnnstt ggoogt o yyyyyloooool-uuuuufrrrrrre dddhhe iiieeaeeeaantttll,,,tty hheee dxxx qqeeearruuryccc,ee iii7ssssstteee:ii3 ooaaa0nnnnn ssddda . m. SSSoftttfaaaeryyy ehhhxpeeeaiaarlelltttshhh 1iii2eee/rrr3 1fffooo/0rrr9 mmm. aaannnyyy yyyeeeaaarrrsss tttooo cccooommmeee!!!
supplement regimen. SSttaayy hheeaalltthhiieerr ffoorr mmaannyy yyeeaarrss ttoo ccoommee!!
ssatuuon ppd1pp hallee.emmmlp.ee ,inn nftto crrruee aggsntiimmoswmeeennirz..si ntog yyoouurr dhieeatl,t hex qeurceisstei oannsd Stay healthier for many years to come!
saunpdp hleemlpe innt cruegstiommeniz.ing your diet, exercise and
■■■■■ B B B B Bssauuniiiiippgggggdpp ssssshllaaaaaeeevvvvvmmlpiiiiinnnnnee inngggggnsssttss crroooooueennnnnggst iibbbbbommmllllloooeeoonnioooooz..dddddin tttttgeeeee sssssytttttosssssu fffffrooooo drrrrr ippppperrrrrteeeee, vvvvveeeeeexnnnnnetttrttiiiciioooooisnnnnne wwwwwaniiiiitttttdhhhhh ooooouuuuurrrrr SSttaayy hheeaalltthhiieerr ffoorr mmaannyy yyeeaarrss ttoo ccoommee!!
■■■■■■■■■■■■■ m 2(sm 2(sm 2(sm 2(sm 2(s Bm 2(s Bm 2(s Bm 2(ss Bm 2(svvvuuuvvvvvvuuuuuuu555555555iiiiiiiiiiiiiaaaaaaaaappppppppppggggttt%%%tttttt%%%%%%iiiiiiiiiaaapppaaaaaappppppp lllllllllssss---mmm------mmmmmmllllllllll–––––––––oooaaaaooooooeeeeeeeeee555555555vvvvmmmrrriiimmmmmmmrrrrrriiiiiinnnnnnnnnddddddddd000iiii000000nnnneeessseeeeeeesssssseeeeeeeee%%%%%%%%%,,,,,,,,,nnnnnnnnnnrrrrrrrrrgggg mmmmmmmmmttttttttttsssslll llllll ssssssss saaaoooaaaaaaoooooo r)))))))))ooooiiiiiiiiibbbbbbbbbfffeffffff nnn nnnnnnnnnnfffdddffffffdddddd.........geee eeeeee eee eeeeeeippppppppprrrrrrrrrbbbbmvvvvvvvvvaaaaaaaaarrrrrrrrr111llll11eeeeeeeeellllllllleeeeeeeeeeoooossssssssslllllllllmmmmmmmmmooo,,,noooooo,,,,,,-----oooo ppphhhpppppphhhhhh.88888ddddiiiiiiiiieeeuuuoooeeeeeeuuuuuuoooooo 66666dddddddddttttrrrrrrrrrmmmmmmmmmeeeemmmmmmmmm 66666tttttttttssss---------hhhhhhhhhttttoooooooooqqqqqqqqq---ssss--rrrrrrrrrnnnnnnnnnuuuuuuuuu ooooooooo55555ffffeeeeeeeeeaaauuuaaaaaaoooouuuuuusssssssss99999lllllllllrrrrggggggggg iiiiiiiii&&& &&&&&&hhhttthhhhhhttttttpppp88888yyyyyyyyy rrrr ooooooooo ---nnneeee--nnnnnnnnnnnnnnnuuuuuuuuuvvvv66666uuuuuuuuuuuuuuuuuurrreeeerrrrrrttttttttt tttnnnn777tttttt77rrrrrrrrrrrrrrrrrrrrrrrrrrriiiiiiiiieeetttteeeeee44444aaatttaaaaaattttttiiiisssssssssiiiiiiiiiooooccccccccceeeeeeeeeooooooooo88888eeennnneeeeeeaaaaaaaaannnnnnnnnuuuuuuuuurrrrrrrrr aaaaaaaaacccwwwwccccccttttttttt lllllllllhhhhhhhhhiiiiiiiii ||| ||iiiiccccccccc ... tttt......aaaaaaaaahhhh lllwwwllllllww sssssssssoooo uuuuwwwwwrrrr wwwww.....LLLLLiiiiifffffSeeeeetEEEEEayxxxxx httttteeeeeeannnnnlsssssthiiiiioooooiennnnnr .....fcccoccrooooo mmmmmma/////nHHHHHy yPPPPPelllllauuuuurssssss to come! 423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45
1-866-598-6748 | www.LifeExtension.com/HPlus
1-866-598-6748 | www.LifeExtension.com/HPlus
1-866-598-6748 | www.LifeExtension.com/HPlus
1-866-598-6748 | www.LifeExtension.com/HPlus
The Life Extension Foundation is the non-profit organization that funds anti-aging research
The Life Extension Foundation is the non-profit organization that funds anti-aging research
Tahne dL riefep oErxttse mnseidoinc aFlo burnedakattihorno uisg hths ein n doins-epasreo fiptr eovregnatnioizna.t iIonn f athcta,t i ff uynodus’r ea ntatik-ianggin ag l orewse-darocshe
Tahne dL riefep oErxttse mnseidoinc aFlo burnedakattihorno uisg hths ein n doins-epasreo fiptr eovregnatnioizna.t iIonn f athcta,t i ff uynodus’r ea ntatik-ianggin ag l orewse-darocshe
Tdaily ahanes dpL irirefienp oEtroxtt seh mneslepido inpc raFelov buernnetda kaatt ihhorenoa uritsg hathtst eian cn kdo,in sy-eopausreo’r fiep tra eolvrreeganadtniyoi znba.et inIonen fif attthcitan,t gi f f ufyrnoodums’r eau ntsat! ik-Wiangegi’rn aeg l torhewes e-odanroceshes
Tdaily ahanes dpL irirefienp oEtroxtt seh mneslepido inpc raFelov buernnetda kaatt ihhorenoa uritsg hathtst eian cn kdo,in sy-eopausreo’r fiep tra eolvrreeganadtniyoi znba.et inIonen fif attthcitan,t gi f f ufyrnoodums’r eau ntsat! ik-Wiangegi’rn aeg l torhewes e-odanroceshes
wdahiloy araenssdpe airrreicnph o traotn sdh m erleepdp ipocrraetl v nbeernewta kaat nhhdreo aburetg thtaetsrt ia nwc kad,yi ssye otaouse ’rh epe rlaeplvr eyeanodutiy ol inbv.ee nI nhe efifaatltctithn,i gief r f yrloooumn’gr eeu rts,a ! skWoin yeg’or aeu ltcohawen - odtanokesees
wdahiloy araenssdpe airrreicnph o traotn sdh m erleepdp ipocrraetl v nbeernewta kaat nhhdreo aburetg thtaetsrt ia nwc kad,yi ssye otaouse ’rh epe rlaeplvr eyeanodutiy ol inbv.ee nI nhe efifaatltctithn,i gief r f yrloooumn’gr eeu rts,a ! skWoin yeg’or aeu ltcohawen - odtanokesees
awddahviloay n rateasspgeaeirr iocnhf ftauont udhr eerlep mp poerrdeti vcneaenlw tb raae nahdke tabhrerto ttauetgrta hwcsk.a,y sy otou ’rhee laplr eyaoduy l ibveen heefiatlttihnige rf rloomng eurs, ! sWo ye’oreu tchaen otankees
awddahviloay n rateasspgeaeirr iocnhf ftauont udhr eerlep mp poerrdeti vcneaenlw tb raae nahdke tabhrerto ttauetgrta hwcsk.a,y sy otou ’rhee laplr eyaoduy l ibveen heefiatlttihnige rf rloomng eurs, ! sWo ye’oreu tchaen otankees
awdhvoa nrteasgeaer ochf fauntudr ere mpoerdti cnaelw b raenadk tbherottuegr hws.ays to help you live healthier longer, so you can take
awdhvoa nrteasgeaer ochfB fauenctudor mere emp oae rdLti icnfaeel w Eb rxaetnaedkn tsbhierootntue gmr hwesm.aybs etro nhoewlp fyooru j ulisvte $ h4e5a lathnide rg leotn aglel rt, hsios !you can take
advantage ofB fuectuorme em ae dLiicfael Ebrxetaekntshiroonu gmhesm. ber now for just $45 and get all this!
advantage ofB fuectuorme em ae dLiicfael Ebrxetaekntshiroonu gmhesm. ber now for just $45 and get all this!
Become a Life Extension member now for just $45 and get all this!
■ FREE 1-Year BSuebcsocrmipeti oan Ltoi fLei fEe xEtxetennssiioonn member noCwa flol r1 j-u8s6t $64-55 9a8nd-6 g7e4t a8l lt toh ijso!in today.
■ FREE 1-Year BSuebcsocrmipeti oan Ltoi fLei fEe xEtxetennssiioonn member noCwa flol r1 j-u8s6t $64-55 9a8nd-6 g7e4t a8l lt toh ijso!in today.
■ M FRaEgEaz 1in-Ye,e ajar mSu-pbascckriepdt iwonit hto c Lutitfein Eg-xetdengesi honea lth Call 1-866-598-6748 to join today.
■■ nMM F FeRRaawEEggsEEaa wzz 11iionn--rYYeeld,,ee aawjjaarri mmdSSuue--pp bb(aa$sscccc5kkrr9iieepp.dd8tt ii8wwoo nnniitt ehhttwoo cc sLLuustttiiattffeeiinnn dEEgg --xxveettaddeelunnggeeessii )hhoo.nneeaa lltthh MMCCeeaannllttlliioo 11nn --ccoo88dd66ee 66AAVV--55BB9999008866AA--66.. WW77ee44’’ll88ll uu sstteeoo yy oojjuuoorr iissnnppee ccttiiaaooll dd$$44aa55yy ..
■■■■■■ Fntn Fnn FnMn FMn F FMnhueueueeeRRRRRReaaawwwwwrrrEEEEEEsgggsssessssseeeEEEEEEaaa ssswwwwwHzzz ,,,1PPPPP iiiooooonnnnnne-hhhhhrrrrrauuuYeeelllllooooolddddd,,,tttet rrrnnnnnawwwwwhjjjiiiaaarttteeeee iiiii mmmiiiA dddddSoooaaaaaueeeeed---nnncccccppp bcccccviii(((((sssaaa$$$$$seeeeeitttccccssssss55555sssokkkrsssss,,,99999i eeerpeeettttt.....sdddvvvooooo88888t ieeet88888 wwwoodddddnnn nnnnnnliiiooooo ltttppp -ccccceeeeehhhtfeeetttttwwwwwo rooooorrrccce ssssssssrrrrrLuuueooossssssssss tttttttti,,,,,nnnaaaaaatttf nnnnnneiiiaaannnnnnnn lllaaaaaydddddE gggtttttttt duuuuurrr---xvvvvveeeaaatarrrrraaaaadddiiieoooooylllllnnnuuuuunggg,ppppp eeeeeeeeeee7saaaaarrri )))))ttttt:ssshhho.....3hhhhh... neee0sssssCCCaaa,,,,, lllaaaa ttt.lllhhhmlll . mryomryMmryMmrMmrCMmeeeeeooofsssssfeeeeeeeeeeuuuaeeeeeemmmmmmnnnn aaaaarlnnn ttttrrrrrbbbbbbleiiiiccccceeeoooox eeeeeehhhhheee1nnnnrrrrrrpddd.....ssssss i hhhhhh-RRRRRccccrttteooooiiiiii8oooeeeeeppppppsdddd sssss hhh 61eeeeeeeeeffffffeeeaaaaaeeeeee 26AAAAlllrrrrreeeeee/pppccccc VVVV3-((((((hhhhh rrrrrryyy15BBBB eeeeeeooottttt/gggggg9999hhhhh90uuuuuuuuu0000aaaaa9 8lllllleeettttt6666.aaaaaa xxxcccccrrrrrrAAAA-tttlllllloooooeee6yyyyyy....uuuuunnn WWWW$$$$$$7llllldddddddd777777 eeee4 yyy555555yyyyy’’’’llllooo))))))8iiiiilllleeeee uuu ttttttuuuulllll rrroooooodddddsssst eeeelll ffffffoiiittttt uuuuuufffhhhhhyyyyeee nnnnnnooooeeeee jiii dddddduuuunnniiiiionnnnn rrrrdddaaaaaa ifffffssssnnnnnneeeooooonppppfififittttttrrrrreeeeiiiiiimmmmmnnn ------ccccaaaaaatiiiiiiitttaaaaaggggggaaaaoeeetttttiiiiiillllllliiiii nnnnnndyyyooooo$$$$gggggg...nnnnn4444 a TTT 5555yhhh .iiisss
■ tttnn FohhuuR eerr1Essssee eeaE ssHH. ,,mP nnee.haauu, ollttfttrronhhiirtte iiAA aooanddnncscvviiwsseiittsssessoos,,r srreet ssvvot oeett ood nnyllo ollpp--cuffeetrrorrree ssrheeoos e,nnaa annnaallltayy httt ddurr aaqaariiouyynn,,pe ee77sarrtt::ssi33h..o 00sCCn, saaaa ..llmmll .. ooyyreooffsffuueee arrnn reeceexxheeppdd. ii Rrrtteeooess s hh11eeea22llr//ppc33h yy11 oot//h00uua99 eet.. xxcttoeeunnlddd yyyooieuulrrd ll iitffheee ii nninddfeeofifirmnniittaeetlliyyo..n TT hhiiss
to 1 a.m., for answers to your health questions
atttnohhnu eedr1sss ee hea sHH.e,ml pnee. aau,i llntfttro hhicrt u iAAaosnddtnosvviwmsiitssesioo,rz srrie nssvt ogettoo nyyll oollp--uufferrrrree sdheeo ienaaeannatl,ltyy het ddrx aqeaaiuryync,,e ei77ssrte::si33 .oa 00Cnn sdaaa ..l mml .. ooyoffffuee rrn eeexxeppdii rrteeoss h11e22l//p33 y11o//00u99 e..xtend your life indefinitely. This
and help in customizing your diet, exercise and
satttoohun epd11sp e haal eH..emmmlpe..e a,,in lnffttoo h crrr ue Aaagsnndtiomssvwwmieseeniorrz.ssri nstt oogto yyyloool-uuufrrrre dhhe ieeaeaantll,tty hhe dx qqeauuryc,ee i7ssstte:ii3 ooa0nnn ssda . m. SSofttfaaeryy ehhxpeeiaarellttshh 1ii2ee/rr3 1ffoo/0rr9 mm. aannyy yyeeaarrss ttoo ccoommee!!
supplement regimen.
aton d1 ha.emlp. ,i nfo cru asntoswmeirzsi ntog yyoouurr dhieeatl,t hex qeurceisstei oannsd Stay healthier for many years to come!
saunpdp hleemlpe innt cruegstiommeniz.ing your diet, exercise and
■■ B Bssauuniippggdpp sshllaaeeevvmmlpiinnee innggnttss crrooueennggst iibbommmlleeoonniooz..ddin ttgee ssyttossu ffroo drr ipperrtee, vveeexnnerttciiooisnne wwaniittdhh oouurr SSttaayy hheeaalltthhiieerr ffoorr mmaannyy yyeeaarrss ttoo ccoommee!!
■■■■■■■■■■ m 2(sm 2(s Bm 2(s Bm 2(s Bm 2(ss Bm 2(svvvvvvuuuuuuu555555iiiiiiiiiiaaaaaapppppppggggtttttt%%%%%%iiiiiiaaaaaappppppp llllllssss------mmmmmmlllllll––––––aaaaooooooeeeeeee555555vvvvmmmmmmmrrrrrriiiiiinnnnnnddddddiiii000000nnnneeeeeeesssssseeeeee%%%%%%,,,,,,nnnnnnnrrrrrrgggg mmmmmmtttttttssssllllll sssss saaaaaaoooooo r))))))ooooiiiiiibbbbbbeffffff nnnnnnnnnnffffffdddddd......geeeeee eeeeeeipppppprrrrrrbbbbmvvvvvvaaaaaarrrrrrllll1eeeeeelllllleeeeeeeoooossssssllllllmmmmmmnoooooo,,,,,,-oooo pppppphhhhhh.8ddddiiiiiieeeeeeuuuuuuoooooo 6ddddddttttrrrrrrmmmmmmeeeemmmmmm 6ttttttssss------hhhhhhttttooooooqqqqqqssss-rrrrrrnnnnnnuuuuuu oooooo5ffffeeeeeeaaaaaaoooouuuuuussssss9llllllrrrrgggggg iiiiii &&&&&&hhhhhhttttttpppp8yyyyyy rrrr oooooo eeee-nnnnnnnnnnnnuuuuuuvvvv6uuuuuuuuuuuueeeerrrrrrtttttt nnnntttttt7rrrrrrrrrrrrrrrrrriiiiiitttteeeeee4aaaaaattttttiiiissssssiiiiiioooocccccceeeeeeoooooo8nnnneeeeeeaaaaaannnnnnuuuuuurrrrrr aaaaaawwwwcccccctttttt llllllhhhhhhiiiiii |iiiicccccc tttt......aaaaaahhhh llllllw ssssssoooo uuuuwrrrr w.LifSetEayx hteeanlsthioienr .focro mma/nHy yPelaurss to come! 423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45423.59 0209 MEMB45
1-866-598-6748 | www.LifeExtension.com/HPlus
1-866-598-6748 | www.LifeExtension.com/HPlus
1-866-598-6748 | www.LifeExtension.com/HPlus
1-866-598-6748 | www.LifeExtension.com/HPlus
1-866-598-6748 | www.LifeExtension.com/HPlus
Table
of Contents
AI
Brain-Computer
Interfacing:
From Prosthetic

Limbs to Telepathy Chips
16
The Great “Designer Baby”
Controversy of ‘09 24
10 The Virtual Cocoon 20 BIO “roger Pederson, Won’t You Please Come
Home?”
11 Climb Inside a Virtual sphere
22 eNHANCeD: Optogenetics
12 Wearing the Internet
30 Andy miah, sports Doping, and the
13 Oh rosie, Can You Bring me my slippers? enhancement enlightement
4444
13 Live Long and Heavy 34 Biology for the Homebody

14 Fast Blasts 37 Here Come the Neurobots

18 FOreVer YOuNG smart Biology 40 unreal Tournament: Was That a Bot or a
Human?
ssuummmmeerr 22000099
Life on Mars with Pete Worden:
An Interview with the Director of the
48 NASA Ames Research Center
What if Travis Bickel
was “The Thing”?
An Interview with
Dennis Detwiller
72
The Man Behind
Biosphere 2
50
42 From X PrIze to singularity university: 62 Chris Conte: Cynthetic series
An Interview with Peter Diamandis
67 Let A Hundred Futures Bloom
50 The man Behind Biosphere 2:
An Interview with John Allen 70 everything of the Dead: The Future of
Humanity is zombie
56 real Discrimination Against Digital People
78 recommended Books
5555
58 NANO It’s a Big mistake to Overlook
mid-range Dangers 81 HumOr relinquishment, step One
60 NeurO running with the Dopes: Cheating
to be a Better Human
WWWWWW..HHPPLLuussmmAAGGAAzzIINNee..CCOOmm
EXPERIENCE
NEURVANA.
PILLS THAT MAKE YOU
SMARTER, THINNER,
MORE SEXUALLY POTENT
Publisher Betterhumans LLC
.
AND ACTIVATE LONGEVITY
James Clement - Co-Founder
Dan stoicescu - Co-Founder
WITH BETA-PHENYLETHYLAMINE
editor-in-Chief r.u. sirius
managing editor Jay Cornell
A Word From Dr.Richard Clark Kaufman
Contributing editor surfdaddy Orca
NEURVANA Chief Science Officer,
Author, Biogerontologist
NEURVANA is an advancement in anti-aging
Design Infoswell media, Inc
science for living a longer life and developing
peak mental and physical performance. By
Art Director stephanie Fox
correcting underlying central metabolic imbal-
ances, NEURVANA produces a broad range of
desirable effects on improving human functions.
From slower aging to protecting against decline
and feeling good, NEURVANA delivers benefits
that every person of every age can quickly feel, Print Distribution Disticor
observe and appreciate.
David Latimer
NEURVANA™ Products contains...
beta-phenylethylamine (PEA), a naturally occur-
ring neurohormone / neurotransmitter (chemical
signal messenger between nerves) that’s normally Advertising James Clement
synthesized in the brain from the amino acid
David Latimer
phenylalanine. PEA has the unique ability to
amplify the activity of the major neurotransmitters
and improve your life functions.
Patent-Pending Nanosphere Delivery System Contact [email protected]
NEURVANA™ is formulated with a patent
pending “Self-emulsifying Nanosphere Delivery
System.” It uses natural phospholipids and medi-
um-chain triglycerides to form a nanoemulsion Letters to the editor [email protected]
(covering) in the intestinal tract, enhancing
bioavailability (delivery) of PEA.
Proofreading Lori selke
There are five NEURVANA Products in all.Click this ad to get FREE sample packs.
NEURVANA™ Pro NEURVANA™ Tranquil
This product embodies the core NEURVANA Everybody experiences occasional bouts of snail mail
concept. It features the brain neuro-amplifier anxiety, tension and insomnia. NEURVANA
beta-phenylethylamine for slower aging, youth- Tranquil restores calm. Through its combination h+ magazine, 385 Vista roma Way, #115, san Jose, CA
ful functioning, and peak body-and-mind per- of neural inhibitors you quickly relax, sleep
formance. It works wonders on boosting mood, soundly, block harmful stress, and your mind 95136
mental activity, attention, motivation, alertness, enters a serene, peaceful state.
energy, libido, creativity and awareness. NEURVANA™ SexualDesire
NEURVANA™ BodySlim This is the best product in the market for
How would you like to lose up to 10 pounds in improving sex in men and women. Its combi- unsolicited manuscripts give us hives
10 days? You can do so through NEURVANA nation of research-proven nutraceuticals
BodySlim's synergistic combination of thermo- produces a stronger sex drive, faster arousal,
genic calorie burners and the BodySlim better orgasms, and longer-lasting on-demand
Letters to the edItor
Transformation Plan. They re-program your performance.
body to convert food and fat calories into NEURVANA™ Synchronicity Please email the editor at [email protected]
energy 24 hours a day for losing weight.
The team of “chronobiotic” supplements
NEURVANA™ MoodBrightener “MoodBrightener & Tranquil” synchronize your
Think of it as a powerful biogenic pick-me-up. daily body rhythms for slower aging, mental
Its6666 synergistic combination of neurotransmitters wellness, illness prevention, and optimal per-
activators will quickly dissolve depressive formance. SYNCHRONICITY combats jet lag,
moods. It will also ease away tension, block chronic fatigue, mood swings, depressive All materials © Betterhumans LLC 2009 unless otherwise
stressful feelings, increase attention, make you states, tension, mental fogginess, attention
feel great and give you pleasure. problems, memory loss, sexual problems, indicated. All copyrights for text revert to writers 90 days
addictions and low immunity.
NEURVANA after publication. Date of publication February 2009.
TRANSFORM YOUR LIFE TODAY...
CLICK HEREFORFREE SAMPLEPACKS.
© NEURVANA Products 2009 • 13470 Washington Blvd., Third Floor • Marina Del Rey, CA 90292 USA
These statements hssavuue mmnotmm beeeenrr e v22al00ua00te99d by the Food and Drug Administration. These products are not intended to diagnose, treat, cure, or prevent any disease.
Futurist Heroes
We are privileged to know and to work with many Futurist Heroes.
However, we want to see this league of advocates for a positive future
in which poverty, scarcity, disease, and ignorance are erased from
humanity, grow much larger.
Watching the news as we do, we witness incredible breakthroughs
nearly every week. These are stories that would have been the “story of
the year” if they had happened just a decade ago. But these days, they
are quickly swept aside by the next breaking science story. They seem
to come at ever increasing speeds. In this sense, we are becoming ever
more aware of the implications of moore’s Law being played out in the
“NBIC” (Nano, Bio, Info & Cogno) “Information science” fields. James Clement
Co-Founder
Here at h+ magazine, we hope that (among other things) we can
inspire young people to study and get involved in the emerging “NBIC”
sciences and technologies so as to help us transcend our genetic/
biological limitations. We’re hoping that future generations will be
able to live incredibly long and healthy lifespans without disease, enjoy
higher intelligences (perhaps augmented by computers through brain-
computer interfaces), and generally be more productive and happy.
Join our h+ Community and help bring about this future – become a
Futurist Hero too.
Best wishes, Dan stoicescu
Co-Founder
James Clement and Dan stoicescu
Co-Publishers
7777
resOurCes
Visit the h+ Community
http://www.hpluscommunity.com
WWWWWW..HHPPLLuussmmAAGGAAzzIINNee..CCOOmm
PrePare
Ih ave tended to be a little less impressed with the rate of change than perhaps
some other techno-progressives have been. Technology’s best promises –
for curing cancer, ending scarcity, insuring mental health – not to mention
the more radical hopes for amplifying neurological function, expanding biological
lifespan, and creating strong problem-solving AI… what have you – have at times
seemed like chimera – the horizons recede just out of reach whenever we seem to
get close. We’ve all heard those predictions from the optimists in various fields:
“We will have (insert favorite breakthrough here) in five years.” Five years later
what do they say? “We will have this in five years.”
But I’ve been getting substantially more impressed lately. I’m not sure if it’s
just because I have the privilege of editing h+ (the magazine and the website), or
if the rate of acceleration is really starting to get interesting, but I suspect that it’s
the latter.
scanning through the news items we’ve covered on our website over
the last couple of months we find (among many other astonishing
items) that:
Professor Nadrian seeman has created
two-armed worker robots made of DNA.
An international team has cracked the
editor in Chief
mammalian gene control code.
scientists have used embryonic stem
cells to make synthetic blood.
8888
British scientists have developed the
world’s first stem cell therapy to cure
the most common cause of blindness.
ssuummmmeerr 22000099
PrePare
for
acceleration
ru sIrIus
so when I scan the evidence provided by my own magazine and
website, I am, in fact, convinced that fantastic breakthroughs
in NBIC (Nano-Bio-Info-Cogno) are happening all the time
and they are starting to influence our lives. The promises and
potentials for a radically different and (hopefully) far brighter
And scanning this issue of h+ magazine, we find that: future implicit in these sciences are moving quickly from
theoretical possibility to laboratory breakthrough to hands-on
Nanotech researchers have achieved practice.
real-time atom manipulation Of course, promises are made to be broken. These hopeful
breakthroughs are running neck and neck with any number
Neurobots are manifesting individual of disaster scenarios. There are two wild cards in this race
behaviors and “are just about at the between resource/environmental collapse and a new dawn of
edge of the amount of size and health, prosperity, and novelty. One of them is plain dumb luck.
complexity found in real brains.” The only thing we can predict about the unpredictable is that
it will surprise us. The other is us. It’s going to take a lot of
Genescient expects to soon be intelligence and wisdom and social-navigational skill to bring
able to make designer supplements this accelerating mess of contradictions broadly describable
containing nutrients made using as the human (or transhuman) condition to a reasonably soft
9999
detailed genomic information. landing with over 6 billion humans (and many other less crazy
species) on board.
… All this and gamebots are threatening
to pass the Turing Test. I hope h+ is contributing to that effort.
WWWWWW..HHPPLLuussmmAAGGAAzzIINNee..CCOOmm
Virtual Reality ...Finally?
Virtual Cocoon CLImB InSIDe a VIrTUaL SPHere
Tristan Guillford
researchers from several universities in the For those of you who are tired of
uK have teamed up to develop an immersive button-mashing and are looking
virtual reality headset that stimulates all
to take your gaming experience
fi ve senses. Designed for maximum realism, the
to a whole new level, or merely looking to
Vr helmet will be THeY’re CALLING IT
add a little spice to your typical workout,
equipped with high
“reAL VIrTuALITY.”
welcome Virtusphere, Inc.
defi nition video,
After 45 man-years, they have
surround sound audio, special tubes that spray
simulated tastes and scents into waiting mouths developed a functional, easy-to-assemble
and noses, a fan that blows air to create hot or cold plastic sphere and base platform that fi ts
temperatures; and tactile devices for simulating inside a large living room. Just put on
touch.
goggles and climb into the sphere, and
A mock up of the Virtual Cocoon was
you’re interacting in the virtual world.
showcased at Pioneers ’09 on march 4th, a
Because you’re in a movable sphere,
technology conference put on by the engineering
yyoouu ccaann jjuummpp,, rruunn,, ccrroouucchh,, llooookk aarroouunndd,,
aanndd PPhhyyssiiccaall sscciieenncceess rreesseeaarrcchh CCoouunncciill aatt LLoonnddoonn’’ss
aanndd wwaallkk wwiitthhoouutt hhaavviinngg
OOllyymmppiiaa CCoonnffeerreennccee CCeennttrree.. IInn aa pprreessss rreelleeaassee bbyy
tthhee eePPssrrCC,, pprroojjeecctt lleeaadd DDaavviidd HHoowwaarrdd ooff tthhee
uunniivveerrssiittyy ooff YYoorrkk ssaayyss:: ““VViirrttuuaall rreeaalliittyy pprroojjeeccttss
hhaavvee ttyyppiiccaallllyy oonnllyy ffooccuusseedd oonn oonnee oorr ttwwoo ooff
tthhee fifi vvee sseennsseess —— uussuuaallllyy ssiigghhtt aanndd hheeaarriinngg..
WWee’’rree nnoott aawwaarree ooff aannyy ootthheerr rreesseeaarrcchh
ggrroouupp aannyywwhheerree eellssee iinn tthhee wwoorrlldd ddooiinngg
what we plan to do.”
TThhee rreesseeaarrcchheerrss eessttiimmaattee tthhaatt iitt wwiillll
11110000
ttaakkee aatt lleeaasstt fifi vvee yyeeaarrss bbeeffoorree aa ccoommmmeerrcciiaall
mmooddeell ooff tthhee VViirrttuuaall CCooccoooonn iiss aavvaaiillaabbllee
ffoorr ppuurrcchhaassee.. TThheeyy hhooppee ttoo hhaavvee iitt oonn tthhee
mmaarrkkeett ffoorr aabboouutt 11,,550000 ppoouunnddss,, aa lliittttllee mmoorree
than $2,500 usD.
PPhhoottoo ccoouurrtteessyy ooff VViirrttuusspphheerree,, IInncc..
ssuummmmeerr 22000099