Evaluation of the food grade expression systems NICE and pSIP for the production of 2,5-diketo-D-gluconic acid reductase from Corynebacterium glutamicum.

1.2 MB·English

by  Kaswurm, Vanja

Kaswurmetal.AMBExpress2013,3:7
http://www.amb-express.com/content/3/1/7
ORIGINAL ARTICLE Open Access
Evaluation of the food grade expression
systems NICE and pSIP for the production
of 2,5-diketo-D-gluconic acid reductase from
Corynebacterium glutamicum
Vanja Kaswurm1*, Tien-Thanh Nguyen1,2, Thomas Maischberger1, Klaus D Kulbe1 and Herbert Michlmayr1
Abstract
2,5-diketo-D-gluconic acid reductase (2,5-DKG reductase) catalyses thereduction of 2,5-diketo-D-gluconic acid
(2,5-DKG) to 2-keto-L-gulonic acid (2-KLG), a direct precursor(lactone) ofL-ascorbicacid(vitamin C). This reaction is
anessentialstep inthebiocatalytic production ofthefood supplementvitamin C from D-glucoseor D-gluconic
acid. As 2,5-DKG reductase is usually produced recombinantly, it is ofinterest to establish an efficient process for
2,5-DKG reductase production that also satisfies food safety requirements.In thepresentstudy, three recently
described food grade variants of theLactobacillales based expression systemspSIP (Lactobacillus plantarum) and
NICE (Lactococcus lactis) were evaluatedwith regard to their effictiveness to produce 2,5-DKGreductase from
Corynebacterium glutamicum.Our results indicate that both systems are suitable for 2,5-DKGreductase expression.
Maximum production yields were obtained withLb. plantarum/pSIP609 bypH control at 6.5. With 262 Uper litre of
broth, this represents thehighest heterologous expression level so far reported for 2,5-DKG reductase from
C. glutamicum. Accordingly, Lb. plantarum/pSIP609 might be an interesting alternative to Escherichia coli expression
systems for industrial 2,5-DKGreductase production.
Keywords: Ascorbic acid, 2,5-diketo-D-gluconic acid reductase, 2-keto-L-gulonic acid, Corynebacterium glutamicum,
Food–grade, Lactic acid bacteria, pSIP, NICE
Introduction 2,5-diketo-D-gluconate)(HancockandViola2002,Bremus
Thebacterialenzyme2,5-diketo-D-gluconicacidreductase et al. 2006). Anefficienthybrid processfor theproduction
(2,5-didehydrogluconatereductase;2,5-DKGreductase;EC of 2-KLG comprising the conversion of D-glucose or
1.1.1.274) is an NAD(P)(H)-dependent oxidoreductase D-gluconic acid into 2,5-DKG by Pectobacter cypripedii
assigned to the aldo-keto reductase (AKR) family (Ellis HEPO1 (DSM 12939) and the subsequent reduction of
2002). 2,5-DKG reductase catalyses the stereo specific 2,5-DKGto2-KLGusing2,5-DKGreductasefromCoryne-
reduction of 2,5-diketo-D-gluconic acid (2,5-DKG) at pos- bacterium glutamicum was previously developed in our
ition C-5 to 2-keto-L-gulonic acid (2-KLG), a key inter- laboratory (Pacher et al. 2008). This process involves a
mediate in the production of L-ascorbic acid (Anderson commercially available glucose dehydrogenase in order to
et al. 1985). At present, 2,5-DKG reductase is an integral recycle the costly coenzyme NADPH in situ through
part of several industrial processes designed to synthesize oxidation of D-glucose to gluconic acid. An alternative
2-KLG based on the 2,5-diketo-D-gluconic acid pathway biocatalytic process for 2-KLG production involving
(from D-glucose via D-gluconate, 2-keto-D-gluconate and 2,5-DKG reductase has been presented by Genencor Inc.
(Chotanietal.2000).
The above mentioned processes depend on the heter-
*Correspondence:[email protected]
1FoodBiotechnologyLaboratory,DepartmentofFoodScienceand ologous (high-level) expression of the 2,5-DKG reduc-
Technology,BOKU–UniversityofNaturalResourcesandLifeSciences, tase gene (dkr), usually achieved with Escherichia coli.
Muthgasse18,Vienna1190,Austria However,theutilizationofgeneticallymodifiedorganisms
Fulllistofauthorinformationisavailableattheendofthearticle
©2013Kaswurmetal.;licenseeSpringer.ThisisanOpenAccessarticledistributedunderthetermsoftheCreativeCommons
AttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,andreproduction
inanymedium,providedtheoriginalworkisproperlycited.
Kaswurmetal.AMBExpress2013,3:7 Page2of11
http://www.amb-express.com/content/3/1/7
(GMOs) to produce enzymes intended for food applica- described (Kaswurm et al. 2012). All oligonucleotide pri-
tionsisstrictlyregulated(Pedersenetal.2005,Peterbauer mers used in this study are displayed in Table 1 and
etal.2011).Lipopolysaccharide(endotoxin)productionby were synthesized by VBC-Biotech (Vienna, Austria). For
E. coli is a further obstacle for protein expressions preparation of genomic DNA from C. glutamicum, the
W
intended for food or medical purposes (Berczi et al. 1966, Easy-DNA Kit (Invitrogen, Carlsbad, CA) was used
Beutler and Rietschel 2003). Therefore, laborious and according to the instructions of the manufacturer. The
costly measures of down stream processing and quality PureYield™ Plasmid Miniprep System for isolation of
W
control are required to comply with the purity and safety E. coli plasmids and the Wizard SV Gel & PCR Clean-
specifications for food grade enzymes, as recommended UP kit for the purification of DNA fragments were
for example by the Joint FAO/WHO Expert Committee obtained from Promega (Madison, WI, USA). The Quick
onFoodAdditives(JECFA)andtheFoodChemicalCodex Ligation Kit and restriction enzymes with their cor-
(FCC). While recombinant (GMO) as well, an attractive responding buffers were purchased from New England
alternative is to use expression hosts with the “generally Biolabs (Ipswich, MA, USA). Phusion High-Fidelity PCR
recognized as safe” (GRAS) status, as defined by the US MasterMix(NewEnglandBiolabs)andaC1000Thermal
Food and Drug Administration (FDA). Although the Cycler (Bio-Rad Laboratories Inc., Hercules, CA, USA)
reported performance offoodgrade expressionsystems is wereusedtoamplifyDNAbyPCR.
usually low compared to standard expression systems
usingE.coli(Nguyenetal.2011a),anadvantageofapply-
ingGRAS(i.e.,food-grade,Peterbaueretal.2011)expres- Molecularcloning
sion systems is that the costs to satisfy food safety All bacterial strains/plasmids used in this study are shown
requirements could be drastically reduced. Accordingly, in Table 2. Genomic DNA from C. glutamicum DSM
effortsusinglacticacidbacteria(LAB)asexpressionhosts 20301,cultivatedinDSMZmedium53(GermanCollection
have gained significance in the last decade (Peterbauer of Microorganisms and Cell Cultures), was used as tem-
et al. 2011). Recently, examples of true food grade host/ plateforamplificationofthe2,5-DKGreductasegene(dkr)
vector combinations have been presented and applied (GenBank accession JQ407590.1). Plasmids were isolated
using the expression systems Lactobacillus plantarum / from Lactococcus und Lactobacillus following the previ-
pSIP (Nguyen et al. 2011a) and Lactococcus lactis / NICE ously described protocol (O’Sullivan and Klaenhammer
(Maischberger et al. 2010). In both systems, antibiotic 1993). All amplified sequences were verified by DNA
resistance marker genes have been replaced by selection sequencing(LGCGenomics,Berlin,Germany).
markers (pSIP: alr, alanine racemase gene; NICE: lacF,
gene encoding the soluble carrier enzyme IIA of the lac-
tose specific phosphotransferase system) complementing ConstructionofNICE-basedexpressionvectors
correspondinggenedeletionsinthehostchromosomes. NICEexpression vectors werebased onthe pTM51vector
Previous studies on the above mentioned expression series as presented by Maischberger et al. (2010). The β-
systemsdemonstratedhighexpressionlevelswithbacterial galactosidase encoding gene (lacLM) of pTM51R was
β-galactosidase genes (Nguyen et al. 2011a, Maischberger excised with BglII and SpeI, and replaced by the multiple
et al. 2010). However, in these studies, the target genes cloningsite(mcs)frompNZ8150(MierauandKleerebezem
originated from members of the same taxonomic order 2005)usingthesamerestrictionsites;theresultingplasmid
(Lactobacillales)astheexpressionhosts.Itisthereforeim- was designated pVK51. Primer pair V1/V2 (Table 1) was
portant as well to evaluate the performance of such LAB usedtoamplifythedkrgenefromgenomicC.glutamicum
expressionsystemswithgenesoftaxonomicdistantorigin. DNA. The PCR product was digested with SpeI, and the
The aim of the present work was to evaluate the food resulting fragment was ligated to plasmid pVK51 prepared
gradeexpressionsystemspSIPandNICEfortheircapacity by digestion with ScaI (blunt-end) and SpeI. This yiel-
to produce the industrially important enzyme 2,5-DKG ded the expression plasmid pVK51dkr. Additionally, the
reductasefromC.glutamicum(orderActinomycetales). complete dkr open reading frame (ORF) with its start
codon located 73 bases upstream of the dkr transla-
Material and methods tion start (Figure 1), was cloned in vector pVK51 using
0 0
Materials 5-ATGTCTGTTGTGGGTACCGG-3 as foward and V2
Chemicals for enzyme assays, protein analysis and media (Table 1) as reverse primer. Both constructs were trans-
components were purchased from commercial suppliers formed into L. lactis NZ3900 (unable to grow on lactose),
at the highest available level of purity. 2,5-DKG, the following the protocol of Holo and Nes (1989). Positive
substrate for 2,5-DKG reductase assays, was produced transformants were selected for their ability to grow on
by fermentation of glucose with Pectobacter cypripedii M17 medium (Terzaghi and Sandine 1975) with agar
(Pacher et al. 2008) and further purified as previously (15gL-1),supplementedwith1%lactoseat30°C.
Kaswurmetal.AMBExpress2013,3:7 Page3of11
http://www.amb-express.com/content/3/1/7
Table1OligonucleotideprimersusedforPCRamplificationsinthisstudy
Primername Restrictionenzymec Sequence(50-30) Targetgene
V1a - ATGGATCAGAAGAATAAGCTTTC dkr
V2b SpeI TCTACGACTAGTTCAGTTCAGATCATTCGG dkr
V3b XhoI CTATCGCTCGAGTCAGTTCAGATCATTCGGG dkr
P1a SpeI CGGAAATCACGGGAACTAGTCGCCAAA P ,P
sppA sppQ
P2b - CGGTACCTACAACAGACATGGGAATCATACTCCTATATATTATT P
sppA
P3b - CGGTACCCACAACAGACATATATGCTGGCCAGCTAAGTA P
sppQ
aforwardprimer.
breverseprimer.
crestrictionsitesareunderlined.
ConstructionofpSIP-basedexpressionvectorsundercontrol extension polymerase chain reaction. Each of the two
ofP andP resulting fragments (P :dkr, P :dkr) was ligated dir-
sppA sppQ sppA sppQ
The coding region of dkr was amplified with the primer ectly to the pJet1.2 blunt-end cloning vector (CloneJET
pair V1/V3 (Table 1). Promoters P (pSIP603R) and PCR cloning kit; Fermentas GmbH, St. Leon-Rot,
sppA
P (pSIP609R) (Nguyen et al. 2011a), were amplified Germany) and transformed into chemically competent
sppQ
from the respective plasmid DNA using the primer pairs E. coli NEB 5-α cells (New England Biolabs). The inserts
P1/P2 and P1/P3 (Table 1). The amplified dkr fragment were excised with SpeI and XhoI (restriction sites on
was fused to the promoters P and P by overlap primers, Table 1) and ligated to a ~5.5 kb fragment
sppA sppQ
Table2Bacterialstrainsandplasmidsusedinthisstudya
Strainsorplasmids Relevantcharacteristics Referenceorsource
Strains
Corynebacteriumglutamicum DMSZstrain20301 DMSZ
LactobacillusplantarumWCFS1 asinglecolonyisolatedfromLb.plantarumNCIMB8826,whichwasoriginallyisolated Kleerebezemetal.2003
fromhumansaliva(NationalCollectionofIndustrialandMarineBacteria,Aberdeen,U.K.)
LactobacillusplantarumTLG02 WCFS1derivative,Δalr,D-alanineauxotroph,expressionhost Nguyenetal.2011a
LactococcuslactisNZ3900 NZ3000derivative,ΔlacF,pepN::nisRK,selectionbasedontheabilitytogrowonlactose deRuyteretal.1996
(lacF),expressionhost
Escherichiacoli
MB2159 MC1000derivative,D-alanineauxotroph,cloninghost Strychetal.2001
NEB5-alpha cloninghost NewEnglandBiolabs
Plasmids
pJet1.2/blunt CloneJET™PCRCloningKit Fermentas
NICEderivativeplasmids
pNZ8150 Cmr,P Mierauand
nisA
Kleerebezem2005
pTM51R lacF,pNZ8150derivativecontainingLb.reuterilacLMgenesdownstreamofP Maischbergeretal.
nisA
2010
pVK51 lacF,pTM51Rderivativecontainingthemultiplecloningsite(frompNZ8150) thiswork
downstreamofP
nisA
pVK51dkr lacF,pVK51derivativecontainingC.glutamicumdkrdownstreamofP thiswork
nisA
pSIPderivedplasmids
pSIP603R alr,pSIP403derivativecontainingLb.reuterilacLMcontrolledbyP Nguyenetal.2011a
sppA
pSIP609R alr,pSIP409derivativecontainingLb.reuterilacLMcontrolledbyP Nguyenetal.2011a
sppQ
pSIP603dkr alr,pSIP603Rderivative,lacLMreplacedbyC.glutamicumdkrcontrolledbyP thiswork
sppA
pSIP609dkr alr,pSIP609Rderivative,lacLMreplacedbyC.glutamicumdkrcontrolledbyP thiswork
sppQ
aalr:alanineracemase;Cmr:chloramphenicolresistance;lacF:thegeneencodingthesolublecarrierenzymeIIAfromlactosespecificPTS;nisRK:gene
necessaryforsignaltransductionintegratedinthechromosome;P :promoternisinA;P ,P :thebacteriocinpromotersinthesppgenecluster;lacLM
nisA sppA sppQ
beta-galactosidaseencodinggene.
Kaswurmetal.AMBExpress2013,3:7 Page4of11
http://www.amb-express.com/content/3/1/7
fresh medium (M17 for L. lactis; MRS for Lb. plan-
tarum) and incubation at 30°C without shaking. After
12 hours, the cells were transferred to the bioreactor
already containing the corresponding medium to reach
an optical density at 600 nm (OD ) of ∼0.1. Expression
600
was induced at an OD of 0.35 ± 0.03. For the in-
600
duction of Lb. plantarum harbouring pSIP alr-based
Figure1N-terminalnucleotidesequenceofthenativedkr vectors, the synthetic peptide pheromone SppIP (Eijsink
genefromC.glutamicumDSMZ20301(GenBankaccession et al. 1996) (25 ng mL-1; CASLO Laboratory, Lyngby,
JQ407590.1).AribosomalbindingsiteinthemRNA(boldprint)is Denmark) was used. To induce the NICE expression sys-
locatedupstreamoftheinitiationcodon(ATG,position1).The
temwithL.lactisNZ3900,nisin(MierauandKleerebezem
secondATGcodoninframeislocatedatposition61andthirdATG
2005),a34aminoacidlantibioticbacteriocin,wasapplied
codoninframeatposition73.Aregioncontainingahigh
concentrationofpurinebasesishighlighted. at a final concentration of 10 ng mL-1. In parallel to the
induced cultures, noninduced negative controls were
included todetermine background activitiesand tocalcu-
late the induction factors (the quotient of specific activity
obtainedbycleavageofpSIP603Rwiththesamerestriction obtained under induced conditions and the activity
enzymes, resulting in the expression plasmids pSIP603dkr obtained under noninduced conditions). All experiments
and pSIP609dkr. Following the same procedure, pSIP- werecarriedoutat30°Cfor20hoursfollowinginduction.
basedexpressionvectorscontainingthecompletedkrORF
(designated pSIP603dkrORF and pSIP609dkrORF) were
constructed. For dkr ORF amplification forward primer Off-lineanalysisofparameters
0 0
5-ATGTCTGTTGTGGGTACCGG-3 and reverse primer Samples were taken in appropriate time intervals during
V2 (Table 1) were used. After plasmid amplification with the fermentations to monitor the growth of bacterial
E. coli MB2159 (Strych et al. 2001), the constructs were cultures by measuring OD and wet cell weight
600
electroporated into the D-alanine auxotroph expression (WCW) after centrifugation at 15,000 × g for 15 min at
host Lb. plantarum TLG02 (Nguyen et al. 2011a) as des- 4°C. 2,5-DKG reductase activities and the total intracel-
cribedbyJossonetal.(1989)andtranformantswere culti- lular protein concentrations were determined in order to
vatedindeMan,RogosaandSharpebroth(MRSmedium; evaluatethe expression levels. Forthatpurpose,bacterial
Oxoid, Basingstoke, U.K.) at 37°C without agitation. Com- cells were harvested from 5 mL of culture by centrifuga-
petent cells of E. coli MB1259 were prepared and trans- tion at 3,220 ×g for 10 min at 4°C, washed with Bis-Tris
formed according to the method of Inoue et al. (1990). buffer (50 mM, pH 6.5) and resuspended in 500 μL of
Cultures of E. coli NEB 5-α and E. coli MB1259 trans- the same buffer. The cells were mechanically disrupted
formants were grown in Luria-Bertani medium (LB; through bead beating with ∼1 g glass beads (average
Sambrook et al. 1989) at 37°C with constant agitation diameter of 0.5 mm) using a Precelly 24 glass bead mill
(200 rpm). For the selection of E. coli NEB 5-α, ampicillin (PEQLAB Biotechnologie GmbH, Erlangen, Germany).
was added to a final concentration of 100 mg mL-1. For The cell-free crude extracts obtained after 10 min cen-
cultivation of E. coli MB2159 and Lb. plantarum TLG02 trifugation at 9,000 × g (4°C) were used for 2,5-DKG
without plasmids, the respective growth media were sup- reductase activity assays and determination of protein
plementedwithD-alanine(200μgmL-1). concentrations.
2,5-DKG reductase activity assay was performed spec-
trophotometrically as previously described (Kaswurm
Expressionof2,5-DKGreductasewithfood–gradevectors et al. 2012). One unit of 2,5-DKG reductase activity is
Batch cultivations of LAB with food grade vectors were defined as the enzyme quantity required to reduce
performed in computer-controlled stirred reactors (6 × 1 μmol of 2,5-DKG per min under assay conditions,
0.5L) of theHT-Multiforssystem (Infors HT, Bottmingen, which is equivalent to the production of 1 μmol of
Switzerland). Comparative studies without and with pH NADP+ per min (Kaswurm et al. 2012). Protein concen-
control (pH 6.5) were performed. Culture pH was main- trations were determined by the dye binding method of
tained by automated addition of sterile NaOH (1 M). To Bradford (Bradford, 1976) using the Bio-Rad Protein
ensure homogenous distribution of the culture broth with Assay Kit (Bio-Rad Laboratories Inc.). Bovine serum al-
limited oxygen transfer, a low agitation speed of 80 rpm bumin (BSA), in concentrations of 0.1 – 1.0 mg mL-1,
wasused.Allexperimentswereperformedintriplicate. was used for the standard calibration curve. All assays
Inocula for the batch cultivations were prepared by were performed in triplicate, and the data are expressed
transferring 20 μl of a frozen stock culture to 200 mL asmean values ±standard deviation (SD).
Kaswurmetal.AMBExpress2013,3:7 Page5of11
http://www.amb-express.com/content/3/1/7
Electrophoresis
SDS-PAGE was performed with a PerfectBlue standard
vertical gel electrophoresis system (PEQLAB Biotechno-
logie GmbH) using 5% stacking gels and 10% separating
gels. Samples were prepared according to method of
Laemmli (Laemmli 1970) and loaded in aliquots of 10
μL per line onto gel. Protein bands were stained using
™
Coomassie blue R250. Precision Plus Protein Standard
(Bio-Rad Laboratories Inc.) was used as molecular mass
standard.
Codonusageanalysis
The fraction of usage of each codon of the C. glutami-
cum dkr gene by L. lactis subsp. cremoris MG1363 and
Lb. plantarum WCFS1 (Kleerebezem et al. 2003), was
predicted with the Graphical Codon Usage Analyser
(Fuhrmann et al. 2004) and the results are presented as
relative adaptiveness values. The codon usage table of
L. lactis subsp. cremoris MG1363 is estimated based on
2572 CDS’s (739646 codons) and that of Lb. plantarum
WCFS1basedon3057CDS’s(934462codons)(Nakamura
etal.2000).
Results
ExpressionoftheC.glutamicumdkrgene
The first experiments were conducted without pH regu-
lation during the fermentations. As judged by SDS-
PAGE of the crude extracts (Figure 2), 2,5-DKG re-
ductase could successfully be expressed with the three
food–grade expression systems NICE, pSIP603 and
pSIP609. Enzyme activities and protein concentrations
were quantified during all experiments. The develop-
mentofthemonitoredparametersoverthefermentation
time is plotted inFigure 3. In all cases, the highest yields
of active 2,5-DKG reductase were observed during expo-
nential growth. Table 3summarizes the highest recorded
activities during 2,5-DKG reductase expression. Consist-
ent with previous reports (Maischberger et al. 2010,
Nguyen et al. 2011a) the non-induced negative controls
Figure2SDS-PAGEofcellfreeextractsofstrainsL.lactis
displayed some background activities, which were taken NZ3900,Lb.plantarumTLG02andLb.plantarumWCFS1
into account by calculating the net effect of induction cultivatedwithoutpHmaintainance.PanelA:L.lactisNZ3900/
(inductionfactor,Table3). pVK51dkr;PanelB:Lb.plantarum/pSIP603dkr;PanelC:Lb.plantarum/
pSIP609dkr.PanelA:Lane1andLane9,molecularmassstandard
With L. lactis NZ3900, the highest volumetric activ-
protein;Lane2,cultureuninduced;Lane3-8,inducedcultureafter2,
ities(82UL-1fermentationbroth)wereobtained4hours
4,6,8,10and20hours.PanelB,C:Lane1andLane9,molecular
after induction. L. lactis reached a maximum OD600 of massstandardprotein;Lane2,cultureuninduced;Lane3-7,induced
approx. 4 and a WCW of 3.6 g L-1. Lb. plantarum (with cultureafter2,4,6,8and10hours;Lane8,wildtypeLb.plantarum
both pSIP603 and pSIP609) reached a maximum OD WCFS1.Thearrowsindicatethebandrepresentingheterolougously
600
of just above 9 (WCW approx. 10 g L-1) and displayed expressed2,5-DKGreductase.
maximum 2,5-DKG reductase activities of approximately
100 U L-1 after 8 hours of induction. The results of values, concomitant with a decrease of pH, levelling off at
expressions without pH control (Figure 3) indicate that approximately pH 4. This is also evident on SDS-PAGE
acidformationisthelimitingfactorfor2,5-DKGreductase (Figure 2), as the intensities of the protein bands corre-
production: In all cases, the volumetric activities of 2,5- sponding to 2,5-DKG reductase (31 kDa) decrease during
DKG reductase decreased after reaching their maximum continuedfermentation.
Kaswurmetal.AMBExpress2013,3:7 Page6of11
http://www.amb-express.com/content/3/1/7
Figure3TimecourseforgrowthofL.lactisNZ3900orLb.plantarumTLG02cultivatedwithoutpHregulation.PanelA:L.lactisNZ3900/
pVK51dkr;PanelB:Lb.plantarum/pSIP603dkr;PanelC:Lb.plantarum/pSIP609dkr.ThegraphshowsOD (trianglesdown),pH(crosshairs),volumetric
600
2,5-DKGreductaseactivity(unitsperliteroffermentationbroth)(circleswhite)andspecificactivity(unitspermilligramprotein)(circlesblack).
The results of dkr gene expression with pH control at (L. lactis NZ3900) to 2.5 (Lb. plantarum/pSIP609) (see
6.5, but otherwise identical conditions are plotted in Table 3). pH control resulted in higher cell densities as
Figure 4.Compared to the experiments without pH con- well: L. lactis reached a maximum OD of approx. 6
600
trol, the volumetric activities of recombinant 2,5-DKG (WCW of 5.5 g L-1) and Lb. plantarum an OD of
600
reductase could be increased by factors ranging from 1.4 approx.10(WCW=11.7gL-1withpSIP603and11.3gL-1
Kaswurmetal.AMBExpress2013,3:7 Page7of11
http://www.amb-express.com/content/3/1/7
Table3Maximum2,5-DKGreductaseactivitiesincellfreeextractsofinducedandnoninducedL.lactisNZ3900and
Lb.plantarumTLG02cultures
NotpHregulatedcultivationsofL.lactisandLb.plantaruma
Strain/plasmid Volumetricactivity(UL-1fermentationbroth) Specificactivity(Umg-1protein) Inductionfactorb
Induced Noninduced Induced Noninduced
L.lactisNZ3900/pVK51dkr 81.6±9.3 16.0±0.24 0.191±0.022 0.038±0.001 5.0
Lb.plantarum/pSIP603dkr 102±5.8 21.7±2.0 0.232±0.022 0.054±0.002 4.3
Lb.plantarum/pSIP609dkr 104±2.75 23.8±2.2 0.243±0.017 0.055±0.001 4.4
pHregulatedcultivations(pH6.5)ofL.lactisandLb.plantaruma
Strain/plasmid Volumetricactivity(UL-1fermentationbroth) Specificactivity(Umg-1protein) Inductionfactorb
Induced Noninduced Induced Noninduced
L.lactisNZ3900/pVK51dkr 114±1.9 14.6±2.0 0.188±0.001 0.022±0.003 8.5
Lb.plantarum/pSIP603dkr 226±5.9 27.2±0.56 0.264±0.026 0.032±0.001 8.3
Lb.plantarum/pSIP609dkr 262±1.7 30.2±1.2 0.308±0.016 0.033±0.004 9.3
aAlldataaremeanvaluesofthreeindependentexperiments.Themaximumvolumetricandspecificactivitiesmeasuredintheculturearepresented.
bTheinductionfactorwasdefinedastheratiobetweenthespecificactivityobtainedunderinducedconditionsandtheactivityobtainedunder
noninducedconditions.
withpSIP609)after7–8hoursofinduction.Afterreaching to dkr could also be identified in the published genome of
the growth maximum, volumetric activities began to drop L. lactis MG1363 (ancestral strain of L. lactis NZ3900)
intheLb.plantarumcultures(Figure4B,C).Inthestudies (deRuyteretal.1996).
using the L. lactis expression system, volumetric acitivites
remained rather stable over the recorded fermentation
period. In all cases, pH-regulated cultivation resulted in Investigationofanalternative"dkrgenevariant"
increased stability of the recombinant 2,5-DKG reductase In this and previous studies (Kaswurm et al. 2012, Pacher
as monitored during 20 hours of induced fermentations 2006) the dkr gene was cloned and expressed such that
(compareFigures3and4). thethirdin-frameATGcodonofthecompleteopenread-
The highest production levels of 2,5-DKG reductase ing frame (ORF) (GenBank accession JQ407590.1) was
were obtained with the system Lb. plantarum/pSIP609, used as translation start (Figure 1). This is a consequence
resulting in 104 U L-1 without pH regulation and 262 of previous experiments conducted in our laboratory that
U L-1 with pH control at 6.5. Although formation of re- demonstrated the presence of two protein bands with
combinant 2,5-DKG reductase by Lb. plantarum (both distinct electrophoretic mobilities (both identified as dkr
pSIP603andpSIP609) washigherthan with L. lactis, the gene products by MALDI-TOF analysis) when the com-
induction factors did not differ significantly because of pletedkr ORF (His -tagged)wasexpressed withanE. coli
6
slightly higher basal expression of noninduced Lb. plan- expressionsystem(Pacher2006).Sequenceanalysisofthe
tarum TLG02 cells. It can be concluded that some basal dkr gene shows a region with a high concentration of
2,5-DKG reductase expression, caused by “leakage” of purine bases (GAG GAA GAG), located downstream of
the corresponding promoters, occured in noninduced thefirst initiationcodon(betweenposition 36and 54, see
Lb. plantarum TLG02 cells (Table 3). Additional experi- Figure1), which may have been recognized as an alterna-
ments using wild type Lb. plantarum WCFS1 (ancestral tive ribosomal binding site by E. coli. Subsequent experi-
strain of TLG02, see Table 2) (Kleerebezem et al. 2003) ments(E.coli)usingthethirdATGcodonastranslational
were performed in MRS medium under equal conditions start (Figure 1) resulted in the presence of only a single
as described above, but without induction. The highest discernable band on SDS-PAGE and especially, higher
2,5-DKGreductaseactivitiesdetectedwere11.8±0.8UL-1 expression yields than with the complete ORF. Inte-
withoutpHregulationand13.6±0.9UL-1withpHcontrol restingly, the automated gene product annotations (i.e.,
at 6.5. Database research using the BLASTp algorithm predicted start of translation) of the currently available
(NCBI Database; http://www.ncbi.nlm.nih.gov/; Altschul coding sequences of the dkr gene from C. glutamicum
etal.1997)revealedthepresenceofseveralputativeoxidor- (GenBank, 99% sequence identities to JQ407590.1;
eductasesintheLb.plantarumWCFS1genomewithupto BLASTn; Altschul et al. 1997), differ in the above dis-
47% amino acid sequence identities with dkr. This circum- cussed respect, whereas either the first, second or third
stance might be an explanation for the recorded 2,5-DKG ATGcodonarepredictedasputativetranslationstartsites
reductase background activities as well. Putative aldo/keto (accession nos. CAF21024.1.; BAF55246.1; CCH25497.1
reductases with up to 48% amino acid sequence identities andBAB99752.1).
Kaswurmetal.AMBExpress2013,3:7 Page8of11
http://www.amb-express.com/content/3/1/7
Figure4TimecourseforgrowthofL.lactisNZ3900orLb.plantarumTLG02cultivatedwithpHcontrolatpH6.5.PanelA:L.lactis
NZ3900/pVK51dkr;PanelB:Lb.plantarum/pSIP603dkr;PanelC:Lb.plantarum/pSIP609dkr.ThegraphshowsOD (trianglesdown),volumetric
600
2,5-DKGreductaseactivity(unitsperliteroffermentationbroth)(circleswhite)andspecificactivity(unitspermilligramprotein)(circlesblack).
Following these considerations, the expression of the wasvisibleonSDS-PAGE(seeAdditionalfile1).However,
completedkrORFwasinvestigatedwithallpresentedLAB theyieldsof2,5-DKGreductaseactivities(intermsofboth
systems/variants as well (see results in Additional file 1, volumetric and specific activities) achieved by expression
Additionalfile2,Additionalfile3,Additionalfile4).Inter- of the complete dkr ORF were significantly lower than by
estingly, in contrast to E. coli, only a single protein band expression of the "dkr gene" (starting at the third ATG
Kaswurmetal.AMBExpress2013,3:7 Page9of11
http://www.amb-express.com/content/3/1/7
codon in frame) with all systems (see Additional file 2, theestimatedcostsfor2,5-DKGreductaseproductionwith
Additionalfile3,Additionalfile4). Lb.plantarumwouldbeatleast3foldcomparedtoE.coli.
A possible explanation for the improved expression A strong argument to employ food grade expression sys-
charateristics of "dkr" compared to the complete ORF tems however is that such, the costs to satisfy food safety
may be indicated by codon usage analysis: Compared to requirements may be significantly reduced (Mierau et al.
L. lactis subsp. cremoris MG1363 and Lb. plantarum 2005). Although the options presented here do not repre-
WCFS1, the mean difference of the codon usage in ORF sent "self-clones" and have therefore to be considered as
of dkr gene from C. glutamicum was 39.6% and 36.7% GMO, the use of gram positive expression hosts is still
for the complete ORF and 40.1% and 37.1% for dkr gene, highly attractive because lipopolysaccharide formation can
respectively. Additionally, according to the codon usage be avoided such, which might indeed reduce the costs for
tableofL.lactissubsp.cremorisMG1363(Additionalfile5) downstream processing and quality assurance required for
an analysis of usage of the first 50 codons of the complete "food grade" enzymes. In addition, the here applied food
ORF and dkr gene, shows that 10 codons (ORF) and 8 grade expression systems do not contain potentially harm-
codons (dkr), respectively can be considered “rare codons” ful, transferable antibiotic resistence markers (Peterbauer
(i.e.codonsusedinlessthan20%ofthecases)or“veryrare et al., 2011). Since vitamin C is an important and widely
codons” (i.e. codons used in less than 10% of the cases). used food supplement, expression of 2,5-DKG reductase
Conversely, for Lb. plantarum there is no rare codon with with such food grade systems could indeed represent an
a low fraction of usage within the first 50 codons of both interestingoption.
ORFanddkrgenefromC.glutamicum(Additionalfile6). In this regard, it is important to note that research on
LAB expression systems is still in progress, and it can
Discussion reasonable be expected that expression efficiencies of
The majority of the so far published studies concerned suchsystemswillbemuchimprovedoverthenextyears.
with the heterologous expression of dkr genes (Coryne- An important aspect to improve a particular system is
bacterium sp.) were focussed on 2,5-DKG reductase the choice of the inducible promotor, which was also
optimization by site-directed mutagenesis and the kinetic indicated in the present study: Heterologous expres-
characterisation of the obtained mutants after expression sion levels (Table 3) of the C. glutamicum dkr gene with
inE.coli,ratherthantheoptimizationofexpressionyields Lb. plantarum (pSIP603, pSIP609), clearly indicate that
(Bantaetal.2002a,b,Powers1996,Sanlietal.2004,Banta the expression characteristics of the same system can be
and Anderson 2002). However, Erwinia species (Erwinia significantly influenced by the used promotor (P and
sppA
herbicola and Erwinia citreus) that naturally accumulate P , respectively), as pSIP609 showed improved ex-
sppQ
2,5-DKG from D-glucose have been used as expression pression levels compared to pSIP603 in all cases. These
host for dkr as well, and have been employed in the one- data stand in contrast to the results recently published
stepproductionof2-KLG(Andersonetal.1985,Grindley by Nguyen and co-workers (Nguyen et al. 2011a), who
etal.1988,Wührer2006).Theexpressiondegreeofdkrin found no significant differences between pSIP603 and
Erwiniastrainswasevaluatedthroughtheproductiontiter pSIP609 comparing the levels of β-galactosidase expres-
of2-KLG,andthehighestproductivityrateof6.6gL-1d-1 sions. However, our results are in excellent accordance
was achieved with Erwinia citreus, mutant strain ER1026 with those obtained for the β-glucuronidase (GusA)
(Grindleyetal.1988). from E. coli and aminopeptidase N (PepN) from L. lactis
The focus of the present study was to determine the expressed with Lb. plantarum NC8 harbouring corre-
value of two recently developed LAB based food-grade sponding pSIP based vectors with erythromycin resist-
expression systems for the production of 2,5-DKG re- ance(Sørviget al.2005).
ductase. The best results (judged by enzyme activity in Further strategies recently discussed involve the in-
the crude extract) were obtained with Lb. plantarum/ crease of plasmid copy numbers and optimization of
pSIP609.Interestingly,thecorrespondingproductionyields mRNA secondary structure in the translational initiation
wereinthesamerangeasthosepreviouslyobtainedbydkr region (TIR) (Nguyen et al. 2011b, Friehs 2004, Ganoza
expressionwithE.coli/pET21d(approx.200UL-1fermen- and Louis 1994). Another important aspect is to analyse
tationbroth)(Kaswurmetal.2012).Additionally,thisisthe the codon usage preference among organisms used as
highestexpressionlevelsofarreportedforthisenzymeand expression systems. Accordingly, by modification of the
shows that LAB systems are suitable for dkr expression as target gene towards the set of codons that the host
well. However, it needs to be critically discussed whether organism (L. lactis. or Lb. plantarum) naturally uses in
LAB systems could compete with E. coli in an industrial its highly expressed genes, the risk of tRNA depletion
production process. Considering the current costs of the during translation can be minimized and hence the
required growth media (at the time of writing: MCHGly heterologous expression by lactic acid bacteria could be
medium approx. 3 € per liter; MRS medium approx. 9 €), further optimized (Fuglsang 2003). In addition, design
Kaswurmetal.AMBExpress2013,3:7 Page10of11
http://www.amb-express.com/content/3/1/7
of fermentation medium and further optimization of Competinginterest
cultivation conditions using a well reasoned strategy Theauthorsdeclarethattheyhavenocompetinginterests.
(Kennedy and Krouse 1999, Berlec et al. 2008) could
contribute to multiple increases of cell densities and Acknowledgements
expressionproductivities. HerbertMichlmayrwassupportedbytheAustrianScienceFund(FWF
project20246-B11).WethanktheAustrianAcademicExchangeService
In conclusion, with dkr from C. glutamicum as ex- (ÖAD)forscholarshipsupportofTien-ThanhNguyen.WethankDr.Martin,
ample, our results confirm that LAB expression systems fromEdinburghNapierUniversity,forkindlysupplyingE.coliMB2159.Weare
such as NICE and pSIP are indeed attractive candidates gratefultoClemensPeterbauerforcriticallyreadingthemanuscript.
for high level protein production and may gain further Authordetails
interestfor industrial purposesinthenearfuture. 1FoodBiotechnologyLaboratory,DepartmentofFoodScienceand
Technology,BOKU–UniversityofNaturalResourcesandLifeSciences,
Muthgasse18,Vienna1190,Austria.2SchoolofBiotechnologyandFood
Additional files Technology,HanoiUniversityofScienceandTechnology(HUST),Hanoi,
Vietnam.
Additionalfile1:FigureS1.SDS-PAGEofcellfreeextractsofstrainsL. Received:19January2013Accepted:21January2013
lactisNZ3900,Lb.plantarumTLG02andLb.plantarumWCFS1cultivated Published:28January2013
withoutpHmaintainance.PanelA:L.lactisNZ3900/pVK51ORFdkr;PanelB:
Lb.plantarum/pSIP603ORFdkr;PanelC:Lb.plantarum/pSIP609ORFdkr.
PanelA:Lane1andLane8,molecularmassstandardprotein;Lane2, References
cultureuninduced;Lane3-7,inducedcultureafter2,4,6,8and10hours. AltschulSF,MaddenTL,SchäfferAA,ZhangJ,ZhangZ,MillerW,LipmanDJ
PanelB,C:Lane1andLane8,molecularmassstandardprotein;Lane2, (1997)GappedBLASTandPSI-BLAST:anewgenerationofproteindatabase
cultureuninduced;Lane3-6,inducedcultureafter2,4,6and8hours; searchprograms.NucleicAcidsRes25:3389–3402
Lane7,wildtypeLb.plantarumWCFS1.Thearrowsindicatetheband AndersonS,MarksCB,LazarusR,MillerJ,StaffordK,SeymourJ,LightD,Rastetter
representingheterolougouslyexpressedcompletedkrORF. W,EstellD(1985)Productionof2-keto-L-gulonate,anintermediateinL-
ascorbatesynthesis,byageneticallymodifiedErwiniaherbicola.Science
Additionalfile2:TableS1.Maximumactivitiesof2,5-DKGreductase
230:144–149
measuredincellfreeextractsofinducedandnoninducedL.lactisandLb.
BantaS,AndersonS(2002)VerificationofanovelNADH-bindingmotif:
plantarumTLG02afterexpressionofthecompletedkrORF.
combinatorialmutagenesisofthreeaminoacidsinthecofactor-binding
Additionalfile3:FigureS2.TimecourseforgrowthofL.lactisNZ3900 pocketofCorynebacterium2,5-diketo-D-gluconicacidreductase.JMolEvol
orLb.plantarumTLG02cultivatedwithoutpHregulation.PanelA:L.lactis 55:623–631
NZ3900/pVK51ORFdkr;PanelB:Lb.plantarum/pSIP603ORFdkr;PanelC:Lb. BantaS,SwansonBA,WuS,JarnaginA,AndersonS(2002a)Alterationof
plantarum/pSIP609ORFdkr.ThegraphshowsOD600(trianglesdown),pH thespecificityofthecofactor-bindingpocketofCorynebacterium
(crosshairs),2,5-DKGreductaseactivity(unitsperliteroffermentation 2,5-diketo-D-gluconicacidreductaseA.ProteinEng15:131–140
broth)(circleswhite)andspecificactivity(unitspermilligramprotein) BantaS,SwansonBA,WuS,JarnaginA,AndersonS(2002b)Optimizingan
(circlesblack). artificialmetabolicpathway:engineeringthecofactorspecificityof
Additionalfile4:FigureS3.TimecourseforgrowthofL.lactisNZ3900 Corynebacterium2,5-diketo-D-gluconicacidreductaseforuseinvitaminC
orLb.plantarumTLG02cultivatedwithpHcontrolatpH6.5.PanelA:L. biosynthesis.Biochemistry41:6226–6236
lactisNZ3900/pVK51ORFdkr;PanelB:Lb.plantarum/pSIP603ORFdkr;PanelC: BercziI,BertókL,BereznaiT(1966)ComparativeStudiesontheToxicityof
Lb.plantarum/pSIP609ORFdkr.ThegraphshowsOD (trianglesdown), EscherichiacoliLipopolysaccarideEndotoxininVariousAnimalSpecies.CanJ
600
2,5-DKGreductaseactivity(unitsperliteroffermentationbroth)(circles Microbiol12:1070–1071
white)andspecificactivity(unitspermilligramprotein)(circlesblack). BerlecA,TompaG,SlaparN,FonovićUP,RogeljI,ŠtrukeljB(2008)Optimization
offermentationconditionsfortheexpressionofsweet-tastingprotein
Additionalfile5:FigureS4.Codonusageanalysisofthe50first
brazzeininLactococcuslactis.LettApplMicrobiol46:227–231
codonsincompletedkrORF(A)anddkr(B)ofC.glutamicuminL.lactis
BeutlerB,RietschelET(2003)Timeline:Innateimmunesensinganditsroots:the
subsp.cremorisMG1363.Theverticalaxisindicatestherelative
storyofendotoxin.NatRevImmunol3:169–176
adaptivenessvalues(%)oftripletcodonsinL.lactissubsp.cremoris
BradfordMM(1976)Arapidandsensitivemethodforthequantitationof
MG1363.Thecodonsusedinlessthan20%ofthecasesareconsidered
microgramquantitiesofproteinutilizingtheprincipleofprotein-dye
asrareandtheircodonusagefractionappearsingrey.
binding.AnalBiochem72:248–254
Additionalfile6:FigureS5.Codonusageanalysisofthe50first BremusC,HerrmannU,Bringer-MeyerS,SahmH(2006)Theuseof
codonsincompletedkrORF(A)anddkr(B)ofC.glutamicuminLb. microorganismsinL-ascorbicacidproduction.JBiotechnol124:196–205
plantarumWCFS1.Theverticalaxisindicatestherelativeadaptiveness ChotaniG,DodgeT,HsuA,KumarM,LaDucaR,TrimburD,WeylerW,SanfordK
values(%)oftripletcodonsinLb.plantarumWCFS1.Thecodonsusedin (2000)Thecommercialproductionofchemicalsusingpathwayengineering.
lessthan20%ofthecasesareconsideredasrareandtheircodonusage BiochimBiophysActaProteinStructMolEnzymol1543:434–455
fractionappearsingrey. deRuyterPG,KuipersOP,BeerthuyzenMM,vanAlen-BoerrigterI,deVosWM
(1996)Functionalanalysisofpromotersinthenisingeneclusterof
Lactococcuslactis.JBacteriol178:3434–3439
Abbreviations EijsinkVG,BrurbergMB,MiddelhovenPH,NesIF(1996)Inductionof
AKR:Aldo-ketoreductase;Alr:Alanineracemasegene;Cmr:Chloramphenicol bacteriocinproductioninLactobacillussakebyasecretedpeptide.
resistance;2,5-DKGreductase:2,5-diketo-D-gluconicacidreductase;2,5- JBacteriol178:2232–2237
DKG:2,5-diketo-D-gluconicacid;FDA:FoodandDrugAdministration; EllisEM(2002)Microbialaldo-ketoreductases.FEMSMicrobiolLett216:123–131
GMO:Geneticallymodifiedorganism;GusA:β-glucuronidase;2-KLG:2-keto-L- FriehsK(2004)Plasmidcopynumberandplasmidstability.AdvBiochemEng
gulonicacid;LAB:Lacticacidbacteria;lacF:ThesolublecarrierenzymeIIA Biotechnol86:47–82
encodinggene;lacLM:Overlappinggenesencodingβ-galactosidase; FuglsangA(2003)Lacticacidbacteriaasprimecandidatesforcodon
NADPH:Nicotinamideadeninedinucleotidephosphate(reducedform); optimization.BiochemBiophysResCommun312:285–291
NADP+:Nicotinamideadeninedinucleotidephosphate(oxidizedform); FuhrmannM,HausherrA,FerbitzL,SchödlT,HeitzerM,HegemannP(2004)
NICE:Nisincontrolledgeneexpression;ORF:Openreadingframe; MonitoringdynamicexpressionofnucleargenesinChlamydomonas
PepN:AminopeptidaseN;P :PromoternisinA;P P :Thebacteriocin reinhardtiibyusingasyntheticluciferasereportergene.PlantMolBiol
nisA sppA sppQ
promotersinthesppgenecluster. 55:869–881