Table Of ContentKamauetal.MalariaJournal2012,11:23
http://www.malariajournal.com/content/11/1/23
METHODOLOGY Open Access
Development of a TaqMan Allelic Discrimination
Assay for detection of Single Nucleotides
Polymorphisms associated with anti-malarial
drug resistance
Edwin Kamau1*, Saba Alemayehu1, Karla C Feghali1, LaDonna S Tolbert2, Bernard Ogutu3 and
Christian F Ockenhouse1
Abstract
Background: Anti-malarial drug resistance poses a threat to current global efforts towards control and elimination
of malaria. Several methods are used in monitoring anti-malarial drug resistance. Molecular markers such as single
nucleotide polymorphism (SNP) for example are increasingly being used to identify genetic mutations related to
anti-malarial drug resistance. Several methods are currently being used in analysis of SNP associated with anti-
malarial drug resistance and although each one of these methods has unique strengths and shortcoming, there is
still need to improve and/or develop new methods that will close the gap found in the current methods.
Methods: TaqMan Allelic Discrimination assays for detection of SNPs associated with anti-malarial drug resistance
were designed for analysis on Applied Biosystems PCR platform. These assays were designed by submitting SNP
sequences associated with anti-malarial drug resistance to Applied Biosystems website. Eleven SNPs associated with
resistance to anti-malarial drugs were selected and tested. The performance of each SNP assay was tested by
creating plasmid DNAs carrying codons of interests and analysing them for analysis. To test the sensitivity and
specificity of each SNP assay, 12 clinical samples were sequenced at codons of interest and used in the analysis.
Plasmid DNAs were used to establish the Limit of Detection (LoD) for each assay.
Results: Data from genetic profiles of the Plasmodium falciparum laboratory strains and sequence data from 12
clinical samples was used as the reference method with which the performance of the SNP assays were compared
to. The sensitivity and specificity of each SNP assay was establish at 100%. LoD for each assay was established at 2
GE, equivalent to less than 1 parasite/μL. SNP assays performed well in detecting mixed infection and analysis of
clinical samples.
Conclusion: TaqMan Allelic Discrimination assay provides a good alternative tool in detection of SNPs associated
with anti-malarial drug.
Background integral part of malaria control efforts [3]. Anti-malarial
Spreadandemergenceofoldandnewdrugresistantpara- drugresistanceanddrugefficacycanbemonitoredbyper-
sites is threatening malaria control programmes in most formingtherapeuticefficacystudies,measurementofdrug
malaria endemic regions [1,2]. Advances that have been concentrationsinblood, in vitroteststhatmonitorpara-
made thus far will only be sustained if monitoring and sitephenotypicchangesandanalysisofmolecularmarkers
reporting of anti-malarial drug resistance becomes an that monitor genetic changes. Althoughtherapeutic effi-
cacystudiesareconsideredthegoldstandardmethodfor
*Correspondence:[email protected] determining anti-malarial drug efficacy, each of these
1MilitaryMalariaResearchProgram,MalariaVaccineBranch,Departmentof
methodspresentsuniquestrengthsandweaknesses[3-6].
MolecularDiagnosticsandGenomicStudies,WalterReedArmyInstituteof
Research,503RobertGrantAve,SilverSpring,20Maryland,USA Recentadvancesinmolecularinformationandtechnology
Fulllistofauthorinformationisavailableattheendofthearticle
©2012Kamauetal;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreativeCommons
AttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,andreproductionin
anymedium,providedtheoriginalworkisproperlycited.
Kamauetal.MalariaJournal2012,11:23 Page2of12
http://www.malariajournal.com/content/11/1/23
in particular has positioned analysis and monitoring of 2005andApril2006attheKEMRI/WalterReedProject,
genetic markers as an important alternative method for Kombewa Clinic in the Kombewa Division of Kisumu
detectionofdrugresistance[7,8]. District, Nyanza Province, Western Kenya. The study
Plasmodiumfalciparummanifestsitsgeneticdiversityin was approved by the Ethical Review Committee of the
several forms: single nucleotide polymorphisms (SNPs), Kenya Medical Research Institute, Nairobi, Kenya and
microsatelliterepeats,smallinsertionsordeletions(indels) WalterReedArmy Institute ofResearch(WRAIR)Insti-
and gene duplication. Studies identifying SNPs and gene tute Review Board, Maryland, USA. The details of this
duplicationsassociatedwithanti-malarialdrugresistance studyhavebeendescribedelsewhere[26].GenomicDNA
have been exploited in evaluation of resistance to treat- fromtheclinicalsamplewasextractedfromwholeblood
ment[9].SNPsinoneormoregenescanbeattributedto using the QIAamp DNA Blood Mini Kit (Qiagen, Vale-
cumulativeeffectofresistance[10,11].Forexample,ithas nicaCA,USA)asrecommendedbythemanufacturer.
been shown that point mutations in the P. falciparum
dihydrofolatereductase(dhfr)geneatcodonsA16V,N51I, Plasmodium falciparum laboratory strain samples
C59R,S108N/TandI164Laugmentedbymutationsinthe GenomicDNAfromthreeP.falciparumlaboratorystrains
dihydropteroate synthase (dhps) gene at codons S436F, wasusedinthisstudy.GenomicDNAfrom3D7and7G8
A437G,K540E,A581G,andA613S/Tconferresistanceto strains was extracted from cultures grown at WRAIR
sulphadoxine-pyrimethamine[12-14]. Chloroquineresis- using QIAamp DNA Blood Mini Kit. K1strain genomic
tance is attributed to SNPs in chloroquine resistance DNA was obtained from Malaria Reagent Repository
transporter (crt) and/or multidrug resistance gene 1 Resourcehttp://mr4.org,MR4.
(mdr1)genes[15-18].
Most of the methods used for detection of drug resis- SNP selection and assay design
tance SNPs are polymerase chain reaction (PCR) based. ThirtySNPsequences(~100nucleotidesontheleftfrank
Once amplicons are obtained, the presence of SNPs can and ~100 nucleotides on the right frank of the allele of
bedetectedbyrestrictionfragmentlengthpolymorphisms interest)associatedwithanti-malarialdrugresistancewere
(RFLP),DNAsequencing,orsingle-strandedconformation submittedtoAppliedBiosystems(AB)websiteforanalysis
polymorphisms[19].OthermethodsusedforSNPanalysis oftheirsuitabilitytobeusedinSNPassays.Aftersubmit-
include single-nucleotide primer extension (SNPE) [20], ting sequences to the custom TaqMan assay design tool
melting curve analysis-fluorescence resonance energy on the AB website, twenty five sequences returned SNP
transfer(FRET-MCA)[21],molecularbeacons[22],melt- assaysthatwereconsideredtobegoodcandidatedesigns.
ing probe hybridization [23], real-time PCR [24] and ThefollowingSNPassayswereselectedforfurtheranaly-
microarray [25]. Each of these methods presents unique sis: pfdhfr codons A16V, S22N, N51I, C59R, S108N, and
advantages and disadvantages. While there is a need to I164L; pfmdr1 codons N86Y, Y184F, S1034C and
develop new SNP analysis methods it is important that N1042D;andpfdhpscodonA581G.TaqMan-MGBgeno-
next generation SNP analysis improves on the existing typingassaymixforeachoftheseassayswasorderedfrom
methods. Some desirable qualities for next generation AB. Each of these TaqMan-MGB genotyping assay mix
SNPanalysismethodsshould includeimproved accuracy contained a forward and reverse primer, one probe that
andsensitivity, reducedcost, fast turn-aroundtime,high perfectly matched to the wild-type sequence variant
through-putcapability,andfielddeployabletomention a labeled with VIC and the second probe matched to the
few. mutant (SNP) sequence variant labeled with 6-carboxy-
Here, development of TaqMan Allelic Discrimination fluorescein (FAM) (Table 1). Probes contained a non-
assays(SNP assays) for genotyping SNPs associatedwith fluorescent quencher and a minor groove binder moiety
P.falciparumdrugresistanceperformedonAppliedBio- (MGB) which allows for shorter probe sequences to be
systems 7500 Fast Real-Time PCR System is described. designed. TaqMan-MGB genotyping assay mixes were
The performance of each SNP assay was assessed using suppliedat40Xconcentration.
plasmid DNAs which contained PCR fragment carrying
codons of interest from P. falciparum laboratory strains SNP assay
with known genetic profile. The specificity of the SNP Aworkingmastermixwaspreparedthatcontained0.25μL
assays was assessed by comparing SNP assay data to ofTaqMan-MGBgenotypingassaymix(20X),2.5μLTaq-
sequencedataofclinicalsamples. ManGenotypingMasterMix(AppliedBiosystems,Carls-
badCA,USA)and2.25μLofwateror1.25μLwaterand
Methods 1μLofhumangenomicDNAat50ng.Humangenomic
Clinical samples DNAwasaddedinreactionswhichwereranwithplasmid
Samples used in this study were obtained from a Phase DNAs as the template. Each reaction contained 5 μL of
IIb paediatric clinical trial conducted between March working master mix and up to 2 μL of template DNA.
Kamauetal.MalariaJournal2012,11:23 Page3of12
http://www.malariajournal.com/content/11/1/23
Table 1Primersand probesequences ofthe SNPassays
SNPAssayName Primers/Probes Sequence(5’-3’)
DHFR16 Forward CAAGTCTGCGACGTTTTCGATATTT
Reverse CCTCATTTTTTTTCCCCTCATTTTTGC
Probe1 CCTTACAACATGCACATAT
Probe2 AACCTTACAACATACACATAT
DHFR22 Forward GCGACGTTTTCGATATTTATGCCATA
Reverse TCCTAGACCTCTAAATGTGTAGTTATTAAAAACCT
Probe1 CCCTCATTTTTGCTTTCAA
Probe2 CCCTCATTTTTGTTTTCAA
DHFR51 Forward ACTACACATTTAGAGGTCTAGGAAATAAAGGA
Reverse GTTGTAACTGCACAAAAATATTTCATATCTAGGG
Probe1 CCATGGAAATGTAATACCAT
Probe2 CCATGGAAATGTATTACCAT
DHFR59 Forward CTAGGAAATAAAGGAGTATTACCATGGAAATGT
Reverse CATCTCTTATATTTCAATTTTTCATATTTTGATTCATTCA
Probe1 CCCTCATTTTTGCTTTCAA
Probe2 CCCTCATTTTTGTTTTCAA
DHFR108 Forward ATGTAAATGATATGCCTAATTCTAAAAAATTACAAAATGT
Reverse GACAATATAACATTTATCCTATTGCTTAAAGGT
Probe1 CTTTCCCAGCTTGTTCT
Probe2 CTTTCCCAGTTTGTTCT
DHFR164 Forward ACAAAGTTGAAGATCTAATAGTTTTACTTGGGAAA
Reverse TTAATTTCTTTTCTAAAAATTCTTGATAAACAACG
Probe1 CCCTCATTTTTGCTTTCAA
Probe2 CCCTCATTTTTGTTTTCAA
MDR86 Forward AGGAGGAACATTACCTTTTTTTATATCTGTGT
Reverse ATTGTACTAAACCTATAGATACTAATGATAATATTATAGGAT
Probe1 CATCACCTAAATTCATGTTC
Probe2 CATCACCTAAATACATGTTC
MDR184 Forward GGTACGAAATTTATAACAATTTTTACATATGCCAGTT
Reverse AAAAACGCAAGTAATACATAAAGTCAAACGT
Probe1 CCTTTTTAGGTTTATATATTTG
Probe2 CCTTTTTAGGTTTATTTATTTG
MDR1034 Forward GACAAAAAAGAAGAATTATTGTAAATGCAGCTT
Reverse AGGATCCAAACCAATAGGCAAAACT
Probe1 CTTTGACTGAATCCC
Probe2 TTTGACAGAATCCC
MDR1042 Forward GGATTCAGTCAAAGCGCTCAATTA
Reverse GTACCTCTTTTAATTAAGAAGGATCCAAACCA
Probe1 ATAGGCAAAACTATTAATAAA
Probe2 TAGGCAAAACTATCAATAAA
DHPS581 Forward TTCTTGTATTAAATGGAATACCTCGTTATAGGAT
Reverse TATACATGTATATTTTGTAAGAGTTTAATAGATTGATCATG
Probe1 TTTCTTCGCAAATCC
Probe2 TTTCTTCCCAAATCC
TemplateDNAusedintheseexperimentswaseitherplas- reactionto6or7μL.Extensiveexperiments(tobereported
midDNAorgenomicDNA.Insomeexperiments,twodif- elsewhere)havebeendone whichshowthatsuchdiffer-
ferentplasmidDNAswereused.Insuchinstances,0.5μL encesinvolumeandconcentrationofreal-timePCRreac-
or1μLofeachplasmidDNAwasaddedtothe5μLofthe tionsdonotalterassay performance.Plateswereloaded
working master mix bringing the final volume of the intoAppliedBiosystems7500FastReal-TimePCRSystem
Kamauetal.MalariaJournal2012,11:23 Page4of12
http://www.malariajournal.com/content/11/1/23
andAB7500v2.0.5softwarewasusedtorunthegenotyp- reactionswereplatedoutonkanamycinplates andsingle
ingassayexperimentfollowingthedefaultstandardAllelic coloniesweregrowninculturesovernight.PlasmidDNAs
Discriminationgenotypingassayprotocol.Theinitialstep werepurifiedfromovernightculturesusingQIAgenspin
ofthisprotocolincludespre-readingoftheplatewherethe miniprepkit(Qiagen,ValenicaCA,USA)followingmanu-
backgroundflorescenceisrecordedfollowedbyABstan- facturer’srecommendations.PlasmidDNAswerepurified
dardPCRprotocolof95°Cfor10min,95°Cfor15secand from a minimum of three colonies for each reaction. To
60°Cfor1min,repeatingsteps2-3for40cycles.Thepost- verify if cloning reaction was successful, PCR was per-
readstepfollowsaftercompletionofthePCRstepwherea formed using 1 μL ofplasmid DNA astemplate and pri-
post-readisperformed.Thesoftwareanalysedthebefore mers corresponding to those used to amplify the PCR
andafterflorescencelevelandcalculatesnormalizeddye fragmentclonedintothevector.PCRfragmentswereana-
fluorescence (ΔRn) as a function of cycle number for lysedonagarosegel,ensuringthecorrectPCRfragments
Allele1(wild-type)orAllele2(mutant).Basedonthisnum- were obtained. Clones with correct PCR fragments were
ber(whichisarelativenumberofthepossibleoutcomes), furtherconfirmedbysequencingasdescribedbelow.The
the software makes an automatic call of either Allele1 concentration and purity of purified plasmid DNA was
(homozygous1/1),Allele2(homozygous2/2)orheterozy- measuredusingNanoDrop2000(ThermoFisherScientific
gous(1/2).Insomeinstanceshowever,thesoftwaredoes Inc,USA)followingmanufacturer’sinstructions.AllDNA
not make automatic calls and returns a call of undeter- sampleswererequiredtohavea260/280ratioofbetween
minedwhichcanbe due tolowornochange of fluores- 1.8 and 2.2. Most samples had 260/280 ratio of between
cence. Also, the system requires large enough sample 1.88 and 2.0. Plasmid DNA Genomic Equivalence (GE)
numberinordertomakeautomaticcalls(fromcommuni- wascalculatedusingthefollowingequation:
catingwithABtechnicalhelpline,~fifteenormoresam-
plesarerequiredforthesoftwaretomakeautomaticcall). (cid:2)Xg/µLDNA/(cid:3)transcriptlengthnucleotide×660(cid:4)(cid:5)×6.022×1023=Ymolecule/µL
However,insomeinstancesthereisnoclearexplanation
whythesoftwaredoesnotmakeautomaticcallsbutwith
proper controls in place, calls can be made manually by Sequencing
assessingthecalculatednormalizeddyefluorescence(ΔRn) Bi-directional sequencingwas performedeitheronplas-
asafunctionofcyclenumberandthecyclethreshold(CT) mid DNA or directly on PCR fragments obtained from
values. genomic DNA. DNA amplifications were performed as
describedaboveandPCRfragmentspurified using QIA-
DNA amplification and cloning PCR fragments into TOPO quickPCRpurificationkit.BigDyeTerminatorv3.1Cycle
TA vector SequencingKit(AppliedBiosystems,CarlsbadCA,USA)
Primersweredesigned(usingPrimerExpress3.0software) was used for bi-directional sequencing following manu-
that amplified amplicons of interest (Table 2). DNA was facturer’s recommendations. Each reaction contained 4
amplified from genomic DNA of either P. falciparum μLofTerminatorReady Reaction Mix,3.2pmolprimer,
laboratorystrainsamplesorclinicalsamples.Theamplifi- templateDNA(plasmidDNAorpurifiedPCRfragment)
cation reaction mixture contained 1 × PCR gold buffer inafinalvolumeof10μL.M13ForM13Rprimerswhich
with MgCl in a final concentration of 4 mM, 0.2 mM are part of TOPO TA cloning kit were used for the bi-
2
deoxynucleoside triphosphates, and 0.4 μM of each pri- directionalsequencingofplasmidDNAswhereasforward
mer. Reactions were carried out in 20 μL reactions con- or reverse primers used in generation of the PCR frag-
taining1μLgenomicDNAand1UAmpliTaqGoldDNA ments were used in sequencing of these amplicons.
PolymerasewithGeneAmp(AppliedBiosystems,Carlsbad Cycling conditions for the BigDye Terminator reaction
CA, USA). Cycling conditions were 95°C for 10 min fol- was as follows: 96°C for 1 min followed by 25 cycles of
lowedby40cyclesof95°Cfor15s,52°Cfor10s,and72°C 96°C for 10s, 50°C for 5s, and 60°C for 4 min. The pro-
for 30s. Amplification of the PCR fragments was con- ducts of these reactions were purified using Performa
firmedbyrunningpartofthePCRreactionona2%agar- SpinColumns(EdgeBio,GaithersburgMD,USA)follow-
ose gel and staining with ethidium bromide. PCR ing manufacturer’s recommendation. Electrophoresis of
fragmentswerepurifiedusingQIAquickPCRpurification these samples was performed using 3130XL Genetic
kit(Qiagen,Valenica CA,USA)followingmanufacturer’s Analyzer (Applied Biosystems, Carlsbad CA, USA) fol-
instructions. Purified PCR fragments were cloned into lowingmanufacturer’srecommendation.
pCR2.1-TOPOvectorusingTOPOTAcloningkit(Invi-
trogen,USA)followingmanufacturer’srecommendations. Results
OneShotTOP10ChemicallyorElectrocomp competent SNP assays performance
cells (Invitrogen, USA) where transformed with cloned To analyse the performance of the selected SNP assays,
vectorfollowingmanufacturer’srecommendations.These three P. falciparum strains, 3D7, 7G8 and K1 that differ
Kamauetal.MalariaJournal2012,11:23 Page5of12
http://www.malariajournal.com/content/11/1/23
Table 2Primer sequences used in generation ofplasmid DNAs.
Plasmidgenerated Sequence(5’-3’) PCRfragmentsize
16-3D7/7G8 ForwardPrimer CAAGTCTGCGACGTTTTCGATATTT
ReversePrimer TTAATTTCTTTTCTAAAAATTCTTGATAAACAACG 526bp
86-K1/7G8 ForwardPrimer TGGGTAAAGAGCAGAAAGAGAAA
ReversePrimer TTGCAACAGTTCTTATTCCCATT 735bp
1034-K1/7G8 ForwardPrimer CAAGCGGAGTTTTTGCATTT
ReversePrimer TTCCACCATCATCTCTTACATCA 447bp
581-K1/7G8 ForwardPrimer TGCATAAAAGAGGAAATCCACA
ReversePrimer TCCAATTGTGTGATTTGTCCA 357bp
in some of their genetic profiles at selected codons pfmdr1 codons N86Y or Y184F are referred as 86-K1 or
(Table 3) were used to generate plasmid DNAs contain- 86-7G8; plasmid DNAs carrying pfmdr1 codons S1034C
ing PCR fragment of genes carrying codons of interest. and N1042D are referred to as 1034-K1 or 1034-7G8;
Four PCR fragments that contained all the eleven SNPs and plasmid DNAs carrying pfdhps codon A581G are
were amplified from respective genes and cloned into referred to as 581-K1 or 581-7G8. The concentration of
TOPO TA vectors as described in the methods section. each plasmid DNA was determined using NanoDrop
Primers used for amplification of these PCR fragments and the genomic equivalence (GE) was calculated. To
are shown on table 2. Amplicon sizes were as follows; obtain the initial analytical sensitivity and specificity,
the amplicon that carried pfdhfr codons A16V, S22N, each plasmid DNA was diluted to an initial final con-
N51I, C59R, S108N, and I164L was 526 bp; the ampli- centration of 32, 000 copies. SNP assays were performed
con that carried pfmdr1 codons N86Y and Y184F was as described in methods section. SNP assay names were
735 bp; the amplicon that carried pfmdr1 codons based on the codon being analysed. For example, to ana-
S1034C and N1042D was 447 bp; and the amplicon that lyse codon pfdhfr N51I, the SNP Assay name is refer-
carried pfdhps codons A581G was 357 bp. Pfdhfr codons enced as DHFR51 (Table 1). Performance of each SNP
A16V, S22N, N51I, C59R, S108N and I164L PCR frag- assay was assessed based on the known genetic profile
ments were amplified from 3D7 and 7G8 strains. These of each strain at each codon and sequence data. Assess-
fragments were cloned into TOPO TA vectors and the ment of each SNP assay was based on automatic calls,
plasmid DNAs generated are referred to as 16-3D7 and normalized dye fluorescence (ΔRn) as a function of
16-7G8. Plasmid DNA 16-3D7 was used for analysis of cycle number for Allele1 (wild-type) or Allele2 (mutant),
codons A16V, S22N, C59R, and I164L. Note that the and the CT values. All the calls made (11 of 11) for
genetic profiles of these codons are the same (wild-type) each SNP assay were correct, establishing the initial ana-
in 3D7 and 7G8 strains. Plasmid DNAs 16-3D7 and 16- lytical sensitivity and specificity at 100%. To establish
7G8 were used for analysis of codons N51I and S108N, the Limit of Detection (LoD) for each assay, each plas-
which 3D7 and 7G8 strains have different genetic pro- mid DNA was serially diluted 5-fold and the initial ten-
files at these codons. For codons pfmdr1 N86Y, Y184, tative LoD for each assay was set as the lowest
S1034C, N1042D and pfdhps codon A581G, plasmid concentration of DNA that yielded positive results in
DNAs were generated by cloning PCR fragments from duplicate experiments (Figure 1: shows LoD for pfdhfr
K1 and 7G8 strains. K1 and 7G8 strains have different 51 and 108, pfmdr1 86 and 184, pfmdr1 1034 and 1042,
genetic profiles at these codons. The generated plasmid pfdhps 581). The LoD was confirmed by testing the LoD
DNAs are referred to as follows; plasmid DNAs carrying concentration in replicates of two or more. All the
assays had LoD of 2 GE.
Table 3Genetic profile ofP. falciparumlaboratory strains
Mixed infections
Codon 16 22 51 59 108 164 86 184 1034 1042 581
To test the ability of each assay to discriminate mixed
Wild-type C G A T G A A A A A C
infections,plasmidDNAscarrying alternate genetic pro-
Mutant T A T C A T T T T G G
filesateachcodonweremixedatdifferentratiosandthe
3D7 C G A T G A A A A A C
abilityofeachassaytomakethecorrectcallwasassessed.
7G8 C G T T A A A T T G C SNP assays analysed for mixed infection were DHFR51
K1 C G N N A A T A A A G and 108 (using plasmid DNA 16-3D7 and 16-7G8),
GeneticprofileofP.falciparumlaboratorystrainsusedinthisstudybasedon MDR86and184(usingplasmidDNA86-K1and86-7G8),
PlasmoDBwebsitewww.plasmodb.organd/orsequencedata.Boldindicates MDR1034 and 1042 (using plasmid DNA 1034-K1 and
themutantalleleandNindicatesthereisnoinformationavailableonthe
profileoftheindicatedalleleonPlasmoDBwebsite. 1034-7G8), and DHPS581 (using plasmid DNA 581-K1
Kamauetal.MalariaJournal2012,11:23 Page6of12
http://www.malariajournal.com/content/11/1/23
Figure1LoDforDHFR51andDHFR108,MDR86andMDR184,MDR1034andMDR1042,DHPS581SNPassays.DatashowingLoDfor
allele1andallele2foreachSNPassaywhereplasmidDNAcarryingeitherallele1orallele2wasusedasatemplate.LoDforalltheSNPassays
wasestablishedat2GE.DataisshownindicatingtheSNPassayandthestrainwhichthePCRfragmentintheplasmidDNAwasclonedfrom.
Example51-3D7isdataobtainedfromSNPassayDHFR51using16-3D7plasmidDNA.
and581-7G8).Analysisformixedinfectionwasperformed assays undetermined. There is no clear explanation why
asfollows;oneplasmidDNAconcentrationwaskeptcon- suchresultswereobtained(undetermined) at these plas-
stant while the other was serially diluted 5-fold or both mid DNA mixture ratios since the software made auto-
plasmid DNAs were serially diluted 5-fold and mixed at matic calls for the consequent plasmid DNA mixtures.
equal concentrations. As shown in Figure 2 (DHFR108 Notethatthesoftwaredidnotmakeautomaticcallsforall
SNP assay, MDR1034 SNP assay and DHPS581 SNP MDR86 and MDR184 SNP assays. Notwithstanding,
assay), when one plasmid DNA concentration was kept Allele1andAllele2ΔRnintheseSNPassays wereclearly
constant (high) while the other was serially diluted, the separated butyetthesoftwarecouldnotmakeautomatic
presence ofheterozygous alleleswas only detected when calls (Figure 3). Manual calls were made based on ΔRn
bothplasmidDNAswereathighconcentration.Thepre- values of the Allele1 and Allele2. It was determined the
senceofthealleleintheseriallydilutedplasmidDNAwas performance of these two SNP assays, MDR86 and
not detected beyond when the plasmid DNAs were at MDR184 were similar to those of the other SNP assays.
equalconcentrations.However,forMDR1034SNPassay, Interestingly, in all the SNP assays, when both plasmid
both alleles were detected when one plasmid DNA was DNAs were serially diluted, the presence of both alleles
dilutedto6400GE(Figure2,MDR1034SNPassay)while was detected at or near LoD as established using single
theotherwasatkeptat32000GE.Curiously,thesoftware plasmidDNA.
did not make automatic callsfor the DNA mixtures that
contained serially dilutedplasmidDNA at 1:5 (6400 GE) Assay specificity
and undiluted plasmid DNA (32000 GE) for DHFR51, Twelve samples from the clinical trial were randomly
MDR1042andDHPS581SNPassays, renderingthesesix selected and sequenced directly or by cloning PCR
Kamauetal.MalariaJournal2012,11:23 Page7of12
http://www.malariajournal.com/content/11/1/23
Figure2PerformanceofDHFR108,MDR1034andDHPS581SNPassaysinmixedinfectionexperiments.PlasmidDNAscarryingoneof
theallelesforeachSNPassaywereusedintheseexperimentsbymixingtheminaeachreaction.PlasmidDNAswereseriallydiluted5-fold
startingat32000GEdownto2GE.Insomeexperiments,theconcentrationofoneoftheplasmidDNAwaskeptconstantwhiletheotherwas
seriallydilutedwhereasinotherexperiments,bothplasmidDNAswereseriallydilutedandmixedatequalDNAconcentrations.
Kamauetal.MalariaJournal2012,11:23 Page8of12
http://www.malariajournal.com/content/11/1/23
Figure3ManuallycalledSNPassays.DatashowingthemanualcallofMDR86andMDR184SNPassays.TheautomaticcallfortheseSNP
assaysduringtheserunswereundeterminedhoweverasthedatashows,Allele1andAllele2ΔRnintheseSNPassayswereclearlyseparated.
Thisdatashowsmanualcallscanbemadewithgreatconfidenceregardlessofwhetherautomaticcallsaremadeornot.Inaddition,CTvalues
showedaclearanddistinctdifferencebetweenthetwoalleles.
fragment that contains codons of interest into TOPO primer sets and amplicons were either cloned into
TA vector. Primers used for cloning and/or sequencing TOPO TA vector and then sequenced or were directly
are described in Table 2. Here, similar scheme was used sequenced as described in the methods section. SNP
as that described in the results section, SNP assay per- assays were performed in replicates of two or more for
formance. PCR fragments were amplified using different each sample using either cloned plasmid DNA and/or
Kamauetal.MalariaJournal2012,11:23 Page9of12
http://www.malariajournal.com/content/11/1/23
genomic DNA of the clinical samples. 3D7, 7G8 or K1 ran, automatic calls were made for MDR86 and 184
plasmid DNAs were used as positive controls for each SNPs assays since large number of samples and controls
allele in all the assays analysed. For DHFR16, 22, 59, were used, emphasizing the need of analyzing a large
and 164 SNP assays, only 16-3D7 plasmid DNA was number of samples for the software to make automatic
used as positive control (Allele1) because at these call. To assess the analytical specificity of the SNP
genetic loci, both 3D7 and 7G8 strains carry wild-type assays, calls made using SNP assay data were compared
alleles. For DHFR51 and 108 SNP assays, 16-3D7 and to the sequence data of the samples. All calls made
16-7G8 plasmid DNAs were used as positive controls using SNP assays were in 100% agreement with
(Allele1 and Allele2 respectively) because at these sequence data. Sequence analysis is considered a gold
genetic loci, 3D7 and 7G8 carry different alleles (Table standard method for SNP analysis. Eleven SNP assays
3). 86-7G8 and 86-K1 plasmid DNAs were used as were analysed in 12 clinical samples, representing a
Allele1 and Allele2 positive controls respectively for total of 132 SNP assays that were correctly called. This
MDR86 SNP assays whereas for MDR184 SNP assays, analysis, in addition to that initially performed using
86-K1 and 86-7G8 plasmid DNAs were used as Allele1 3D7, 7G8 and K1 strains represent 100% specificity of
and Allele2 positive control respectively. 1034-K1 and all the SNP assays analysed.
1034-7G8 plasmid DNAs were used as Allele1 and
Allele2 positive controls for MDR1034 and 1042 SNP Clinical samples analysis
assays respectively. For DHPS581 SNP assay, 581-7G8 Sixty clinical samples with known parasite density based
and 581-K1 plasmid DNAs were used as Allele1 and on microscopy and real-time PCR data [27] were ana-
Allele2 positive controls respectively. K1 and 7G8 lysed using all the eleven SNP assays. All the SNP assays
strains differ at all these genetic loci as shown (Table performed as expected with distinct and clear calls
3). SNP assays were performed as described in the regardless of the parasite density in each sample. In
methods section. Figure 4 shows an Allelic Discrimina- additional, 10 clinical samples that were negative by
tion plots for DHPS581 and MDR86 SNP assays ran microscopy and real-time PCR data were ran for further
using clinical samples and plasmid DNA controls. The analysis of the analytical specificity of the SNP assays.
plot shows a clear and distinct separation between the There were no false positives; all the CT values were
two alleles. In these experiments unlike those initially undetermined.
Figure4AllelicDiscriminationplotsforMDR86andDHPS581SNPassays.Tworepresentativeplotsshowingperformanceoftwoassaysin
analysisofclinicalsamples.Theseassaysshowclearseparationbetweenthesignalsderivedfromallele1orallele2.Allele1isshowninredand
allele2isshowninblue.Limegreenrepresentsamixtureofthetwoalleles(whichwasapositivecontrolallele1/allele2derivedusingamixture
oftwoplasmidDNAs).
Kamauetal.MalariaJournal2012,11:23 Page10of12
http://www.malariajournal.com/content/11/1/23
Discussion valuesof2.23and2.27forAllele1andAllele2respectively.
A TaqManAllelic Discriminationassaysfordetectionof Here,heterozygous1/2automaticcallwasmadebutifthis
SNPs associated with anti-malarial drug resistance has decisionwasbasedonCTvalues,probablysubjectivecall
been described. The assay was developed for use on wouldhavebeenAllele1.Automaticcallsarelesssubjec-
Applied Biosystems 7500 Fast Real-Time PCR System. tivesincetheyarebasedonthesoftware’salgorithm. Itis
The performanceofeachoftheSNPassayswasanalysed importantto havepositiveandnegativecontrolsinplace
and control plasmid DNAs developed. Each SNP assay and a large number of samples must be analysed for the
performedwellwith100%sensitivityandspecificity.Data softwaretomakeautomaticcalls.
from genetic profiles of the P. falciparum laboratory Currently,therearemanymethods that arebeingused
strains and sequence data from 12 clinical samples was for molecular analysis of anti-malarial drug resistance.
used as thereference methodwith whichtheSNPassays Methods chosen by different studies will be based on
were compared to. All the SNP assays had LoD of 2 manyfactorsincluding technologycapabilities andavail-
copies, which is equivalent to less than 1 parasite/μL ability, the availability of intellectual and financial
(based on unpublished data to be reported elsewhere). resources to mention a few. Some of the factors that
TheperformanceoftheSNPassayswasfurthervalidated should be important in decision making regarding what
when each SNP assays was used to assess SNP genetic assay to use in SNP analysis should include accuracy of
profileofadditional60clinicalsampleswithknownpara- theassay,sensitivity,robustness,reproducibility,cost,and
sitedensitybasedonmicroscopyandreal-timePCRassay reliability.Here,weareaddingonemoretoolthatcanbe
whichamplifies18sRNA.Basedonmicroscopy,theden- usedingenotypinganti-malarialdrugresistance.
sityoftheparasiterangedfromlessthana100parasites/ TaqMan Allelic Discrimination assays can be custom
μL to more than 10E6 parasites/μL [27]. All SNP assays designedfordetectionofSNPsofinterest.Whendesign-
performedwellregardless ofparasitedensity.Usingreal- ing these assays however, just like any other PCR assay,
timePCR18sRNAparasitedensitydata,SNPassayssuc- not all SNP sequences will be good candidate designs.
cessfullygenotypedsamplescontainingparasitesdensities And once good candidate designs are identified, it is
of 10 parasites/μL or less. All clinical samples that were important that extensive analysis of each assay is per-
negativebyreal-timePCR18sRNAassaywerealsonega- formed before its utilization. It is important that a SNP
tiveinallSNPassays. detection assay is capable of detecting mixed alleles
Detection of SNPs associated with anti-malarial drugs (mixedinfection).Here,justlikepreviouslyreported[29],
using real-time PCR based assay has been extensively data shows that TaqMan Allelic Discrimination assay is
reported[28]. However,untilrecently[29],therehasnot capable of detecting mixed alleles. However, it is impor-
beenany publishedworktowardsdevelopingSNPdetec- tanttonotethatthisisaPCRbasedassaywhichdiscrimi-
tionassaysusingtheTaqManAllelicDiscriminationassay natesthepresenceofeitherallelebasedonaffinityofone
methodonAppliedBiosystemsPCRplatformforgenotyp- probe to the SNP sequences of the allele present as
ingSNPspresentinthePlasmodiumgenome.Inthestudy opposed tothe one notpresent. Some SNP assays might
byDanieletal.,[29],TaqManAllelicDiscriminationassay detect mixed infections better than others;it all depends
was developed for identification and tracking P. falci- on chemistry of each set of probes. Data presented here
parum.Here,theauthorsselectedapaneloftwenty-four show that SNP assays can detect mixed infections when
SNPs that were identified to exhibit a high minor allele DNAofbothallelesispresentinhightoverylowconcen-
frequency for which robust TaqMan genotyping assays trations as long as DNAs carrying both alleles are at or
wereconstructed. AvarietyofsamplesincludingP.falci- nearequalconcentration.
parum laboratory strains, frozen whole blood, or whole
bloodspottedontofilterpaperwereusedintheassaywith Conclusion
a success rate > 99%. The performance of the assay was The SNP assay described here for detection of anti-
validated using nested PCR. By making calls using ΔRn, malarial drug resistance is accurate, sensitive, robust,
TaqMan Allelic Discrimination assays simplifies and inexpensive, highly reproducible and reliable. And since
increasesaccuracyincallmakingbyeliminatingsubjective itisareal-timePCRbasedassay,ithasgreatpotentialof
decisionwhichcanbemadebyuseofCTvalues.Inmost beingutilizedinhigh-throughputstudiessuchassurveil-
of the mixed infections, data present here show that if lanceandepidemiologicalstudies.TaqManAllelicDiscri-
only CT values were used, wrong calls would have been minationassayshavebeenwidelydevelopedandusedfor
made. For example in Figure 3 where 1034-K1 plasmid genotyping SNPs in applications such as SNP typing in
DNA at 32000 GE was mixed with 1034-7G8 plasmid at forensic genetics, pharmacokinetics and bacterial strain
6400GE,theMDR1034SNPassayhadCTvaluesof17.53 typing[30].However,itisnotuntilrecentlythatDaniels
and 19.25 for Allele1 and Allele2 respectively and ΔRn et al [29] showed utilization of this technology in allele