Table Of ContentBiogeosciences,6,33–44,2009
Biogeosciences
www.biogeosciences.net/6/33/2009/
©Author(s)2009. Thisworkisdistributedunder
theCreativeCommonsAttribution3.0License.
Bacterial diversity of autotrophic enriched cultures from remote,
glacial Antarctic, Alpine and Andean aerosol, snow and soil samples
E.Gonza´lez-Toril1,R.Amils1,4,R.J.Delmas3,J.-R.Petit3,J.Koma´rek2,andJ.Elster2
1CentrodeAstrobiolog´ıa(INTA-CSIC)Ctra. AjalvirKm. 5,28850Torrejo´ndeArdoz,Spain
2InstituteofBotany,AcademyofSciencesoftheCzechRepublic,TeboandFacultyofScience,UniversityofSouth
Bohemia,E`eske´ Bud`ıjovice,CzechRepublic
3LaboratoiredeGlaciologieetGe´ophysiquedel’EnvironnementduCNRS,StMartind’He`res,France
4CentrodeBiolog´ıaMolecular(UAM-CSIC)Cantoblanco,28049Madrid,Spain
Received: 12February2008–PublishedinBiogeosciencesDiscuss.: 15April2008
Revised: 8December2008–Accepted: 8December2008–Published: 8January2009
Abstract. Fourdifferentcommunitiesandonecultureofau- 1 Introduction
totrophic microbial assemblages were obtained by incuba-
tion of samples collected from high elevation snow in the Long distance dispersal of biological particles produced by
Alps(Mt. Blancarea)andtheAndes(NevadoIllimanisum- atmospheric circulation, ocean currents, birds, fish, mam-
mit,Bolivia),fromAntarcticaerosol(FrenchstationDumont mals and human vectors, has been known since the mid
d’Urville) and a maritime Antarctic soil (King George Is- 20thcentury(Gisle´n,1948;Gregory,1967;SchnellandVali,
land, South Shetlands, Uruguay Station Artigas), in a min- 1972; Marshall, 1996a, b; Vincent, 2000). The small size
imal mineral (oligotrophic) media. Molecular analysis of of microorganisms makes them easily transportable by air
more than 200 16S rRNA gene sequences showed that all masses. Eventually, these windborn particles are deposited
cultured cells belong to the Bacteria domain. Phylogenetic onthegroundand/orsnow/ice, onveryhighmountainsand
comparison with the currently available rDNA database al- in Polar Regions, respectively, in either dry or wet form
lowedsequencesbelongingtoProteobacteria(Alpha-,Beta- (Chalmers et al., 1996). It has been proposed that microor-
and Gamma-proteobacteria) , Actinobacteria and Bac- ganismslivinginhotand/orcoldterrestrialdesertsareespe-
teroidetes phyla to be identified. The Andes snow culture cially susceptible to dispersion due to their special adapta-
was the richest in bacterial diversity (eight microorganisms tion to extreme and variable conditions (temperature, radia-
identified) and the marine Antarctic soil the poorest (only tion,spectralquality,desiccation,etc.)(Flechtner,1999;Van
one). Snow samples from Col du Midi (Alps) and the An- ThielenandGarbary,1999;Garty,1999;ElsterandBenson,
dessharedthehighestnumberofidentifiedmicroorganisms 2004).
(Agrobacterium, Limnobacter, Aquiflexus and two uncul-
Living microorganisms have been collected in the strato-
turedAlphaproteobacteriaclones).Thesetwosamplingsites
sphere (Imshenetsky et al., 1978), and there are several re-
alsosharedfoursequenceswiththeAntarcticaerosolsample
ports supporting the idea that microorganisms can live and
(Limnobacter,PseudonocardiaandanunculturedAlphapro-
reproduce on airborne particles (Dimmick et al., 1979). It
teobacteriaclone). Theonlymicroorganismidentifiedinthe
hasalsobeenshownthatmicroorganismscanactivelygrow
Antarcticasoil(Brevundimonassp.) wasalsodetectedinthe and reproduce at temperatures near or below 0◦C in cloud
Antarcticaerosol.Mostoftheidentifiedmicroorganismshad
dropletscollectedathighaltitudes(Sattleretal.,2001).
beendetectedpreviouslyincoldenvironments,marinesedi-
Both,viableanddeadcells,ortheirremains,storedinthe
mentssoilsandrocks. Aircurrentdispersalisthebestmodel
ice of continental icecaps and mountain glaciers are poten-
toexplainthepresenceofveryspecificmicroorganisms,like
tialhistoricalrecordsofrecentevolutionofmicrobiallife,as
those identified in this work, in environments very distant
wellasarecordoftheEarth’schangingclimate. Inthewake
andverydifferentfromeachother.
oftherecentdiscoveryofthesub-glacialAntarcticLakeVos-
tok (Priscu et al., 1999; Siegert et al., 2001), and the pos-
Correspondenceto: E.Gonza´lez-Toril sibility of recovering water samples containing fossil living
([email protected]) microorganisms, there is a growing interest in investigating
PublishedbyCopernicusPublicationsonbehalfoftheEuropeanGeosciencesUnion.
34 E.Gonza´lez-Toriletal.: Diversityofpigmentedbacteriainaerosol,snowandsoil
thetransportoflivingorganismsviaairoverlargedistances, withhighcontentofbacteriaproducingpigmentedcolonies
e.g.coldglacialregions. werechosenforthisstudy.
Recently,thecompositionofmicro-autotrophs(cyanobac- Intheyear2000,twosnowpitsweredugatveryhighel-
teria and algae), micro-fungi (hyphae and spores), bacteria evation sites in the Mt. Blanc area of the Alps: one (0.6m
(rod,cocciandpigmentedbacteria),yeastandplantpollenin deep) at Col du Midi (elev. 3532ma.s.l., 17 May) and the
remoteaerosol,depositedsnow,andicehavebeenevaluated other(2mdeep)atColduDome(elev.4250ma.s.l.,31Au-
(Elster et al., 2007). As a product of this study cultivable gust) for European sampling. Snow collected from recent
autotrophic pigmented microorganisms were obtained from deposits contained several visible dust layers. This dust is
alpine snow (Alps and Andes) and aerosol (Antarctic) sam- knowntobetransportedairbornetotheAlpsfromtheSahara
ples. desert(Oeschgeretal.,1977;Wagenbach,1989;Angelisand
Ithasbeensuggested(Imshsnetskyetal.,1978,Christner Gaudichet,1991). Thedustlayerscorrespondtoshortevents
etal., 2000)thatthepresenceofhighlypigmentedbacterial (outbursts) that occur under meteorological conditions such
coloniesinthemesosphereandinglacialicewasassociated as a low descend over the western North Africa (Morocco)
withtheneedtoprotectcellsfromharmfulUV-radiationdur- producing a southern wind over Italy and southern France.
ingatmospherictransportandexposureonthesurfaceofthe The time corresponds to a few hours up to some days. At
glaciers. Morphologically similar bacterial specimens have Col du Dome the accumulation rate is variable, but from a
also been observed in soils in the Arctic Svalbard (unpub- pit,theageofthelayermaybeafewmonthsuptoayear.
lisheddata,Øehakova´ etal.,2009). Theseobservationssup- IntheAndes,surfacesnowblockswerecollectedin2000
porttheideathatthistypeofmicroorganismscommonlyde- at the summit of Nevado Illimani, Bolivia (16◦370S,
velopincolddesertecosystemsandareeasilytransportedvia 67◦460W,CordilleraReal, elevation6350m). TheBolivian
aerosoltoboth,shortandlongdistances. AndesaresurroundedbytheAltiplano,ahighaltitudedesert
(mean elevation: 3700ma.s.l., Clapperton, 1993). This re-
In this work we report the identification, using molecu-
gion, in particular, contains large salt flats called “salares”
lar ecology methodologies, of autotrophic microorganisms
(Risacher, 1992), which are an important source of dust for
abletogrowoligotrophicallyinenrichmentculturesofsam-
the regional atmosphere during the dry season. From size
plesobtainedfromalpinesnow(AlpsandAndes)andaerosol
and depth of snow-dust layer it has been estimated that the
(Antarctic). Forcomparisonthecultureofpigmentedbacte-
age of the collected sample from this site was the same or
riaisolatedfrommarineAntarcticsoil(KingGeorgeIsland,
similaroftheMt.Blancarea.
SouthShetland)wasalsoanalysed.
Samples from the Alps (Col du Midi 6 samples+blank,
Col du Dome, 9 samples + blank) and the Andes (2 sam-
ples)wereanalysed(Elsteretal.,2007). Eachsnowsample
2 Materialandmethods
containedabout0.5to1kgofsnow.Thesurfacelayer(about
3–5cm)fromthesnowsampleswascutoutandonlythecen-
2.1 Sitedescriptionandsamplecollection tralpartofthesnowblocksweretakenforanalysis(formore
detailsonsamplepreparationseeElsteretal.,2007). Inthis
Theaerosolsamplesoriginatedfromasetoffilterscollected set 88% of analysed samples contained bacteria producing
between1994and2000atthecoastalAntarcticStationDu- pigmented colonies (Elster et al., 2007). From these sets,
mont d’Urville (66◦400S, 140◦010E) for long-term atmo- the samples with the highest content of pigmented bacteria
sphericchemistrystudies. Thisstationissituatedonasmall were concentrated by lyophilisation (two Alps and one An-
island, a few hundred meters offshore from the mainland. dessamples)forfurtheranalysis.
Local meteorological conditions were described by Pe´riard In the austral summer season of 2005, soil samples were
& Pettre´ (1992) and Ko¨nig-Langlo et al. (1998). The main collectedfromthevicinityoftheUruguayAntarcticStation
features of the chemical composition of the aerosol can be Artigas, King George Island, South Shetlands. All sam-
foundinWagenbachetal.(1998),Minikinetal.(1998),and ples were collected using pre-cleaned glass vials (aerosol)
Legrandetal.(1998).Alltogether,13Antarcticaerosolsam- and sealed plastic bags (snow and soil), respectively, trans-
plesandcontrolswerecollectedonGelmanZefluor®filters ported frozen to the laboratory in Grenoble and/or in Tebo
(47mm diameter, 0.5µm pore size) by drawing in air at a andstoredfrozenuntilfurtheranalysis(formoredetailssee
flow rate of 1.5m3h−1. The sampling interval was 20 h in Elsteretal.,2007).
summer(fromNovembertoFebruary)and40htherestofthe
year,whichcorrespondsto30and60m3 ofair,respectively. 2.2 Samplepreparationandcultivation
Alldevicesusedwerewashedthreetimeswith18.2M(cid:127)cm
MilliQ® water, except for the filters. Collected filters were Tominimizepossiblecontaminations,allpost-samplingma-
kept under cool, dark and dry conditions (−25◦C). In 38% nipulations were done in a UV-sterilized laminar flow hood
of analysed aerosol samples the bacteria that produced pig- using sterile glass vials. To retrieve samples from the snow
mentedcolonieswererecorded(Elsteretal.,2007). Samples pits an upper layer of about 2cm was sliced with a sharp
Biogeosciences,6,33–44,2009 www.biogeosciences.net/6/33/2009/
E.Gonza´lez-Toriletal.: Diversityofpigmentedbacteriainaerosol,snowandsoil 35
knife. The samples were dried off at a temperature of 359and805forCyanobacteriaphylum(Nu¨beletal.,1997)
−40◦C in a special sterile lyophilization device (Lyovac wereperformed.ThesegeneswereamplifiedbyPCRinmix-
GT2,Leybold-Heraeus,Germany). Glassvesselscontaining turescontaining20–30ngofDNAper50µlreactionvolume,
the solid deposits were rinsed with 10–15ml of re-distilled 1×PCRbuffer(PromegaBiotechIberica,Spain),2.5µMof
water. eachofthedeoxynucleotides(AmershamBiosciences,UK),
Aerosolfilterswerecutintoquartersandonequarterwas 2.5mMMgCl2, 1mgmL−1 bovine serum albumin (BSA),
used for enrichment cultures. Each snow and aerosol sam- 500mMofeachforwardandreverseprimersand0.025U/µl
ple was cultured in a sterile glass bottle (25ml in volume) of Taq DNA polymerase (Promega Biotech Iberica, Spain)
inBG-11culturemedia(asdescribedinBischoffandBold, (Table 1). PCR conditions were as follows: initial denatu-
1963). Eachglassbottlewasfilledwithabout10mlofster- ration at 94◦C for 5 min, followed by 30 cycles of denatu-
ile medium (for more details see Elster et al., 2007). Sus- rationat94◦Cfor40s, annealingat52◦Cfor1minforthe
pensionsof10gsoil+90mlsterilewaterwerehomogenized Bacteria domain, 56◦C for the Archaea domain, and 60◦C
usingultrasonicationfor4minforsoilsamplesanalysis. For for the Cyanobacteria phylum. Positive and negative con-
enrichment cultures 1ml of lyophilized snow or solid sus- trolswerealwaysusedineveryPCR.Large16SrRNAgene
pensionsoraquarterofafilterwereused. Forcolonyisola- fragments (>1400bp) were purified by GeneClean Turbo
tion0.1mlofenrichmentcultureswerespreadonPetridishes Column (Q-Bio Gene Inc., CA, USA) and cloned using the
containing1.5%BG11agar(Elsteretal.,1999). Fourrepli- TopoTaCloningKit(Invitrogen,CA,USA).Clonedinserts
cateswereperformedforeachagarculture.Glassbottlesand were amplified using PCR conditions described above and
Petridisheswerecultivatedinanilluminated(∼100W/cm2) weredirectlysequencedwithaBig-Dyesequencingkit(Ap-
refrigerator(temperature5–8◦C)withalightregimeof18h plied Biosystem) following the manufacturer’s instructions
oflight, 2hofUV-Bradiation(germicidelamp)and4hof (Gonza´lez-Toriletal.,2006).
darkness. Thegermicidelampwasusedtosterilizethecul-
ture growth area (UV-B light did not penetrate through the 2.5 Clonelibraryanalysis
glass bottles). Experimental bottles were shaken every 2–
3 days. After 1 and 2 months of cultivation, the contents Sequences were analyzed using BLAST at the NCBI
of bottles and Petri dishes were analyzed under the light database (http://ncbi.nlm.nih.gov/BLAST) and added to the
microscope (Olympus BX 60). Aliquots of samples were mostimportantBLASThits,toreachanalignmentof50000
analyzed by fluorescence after staining with the DAPI flu- homologous bacterial 16S rRNA primary structures by us-
orochrome (EFM Olympus BX 60) (Zachleder and Cepa´k, ing the ARB software package aligning tool (http://www.
1987)andtransmissionelectronmicroscopy(Jeolequipment arb-home.de) (Ludwig et al., 2004). The rRNA alignments
JEM1010). were corrected manually and alignment uncertainties were
Fiveoligotrophicenrichmentcultures,fromeachsampling omitted in the phylogenetic analysis. Phylogenetic trees
station(AntarticStationDumontdU´rville;ColduMidi,Col were generated using parsimony, neighbour-joining, and
du Dome, Nevado Illimani and Uruguay Antarctic Station maximum-likelihood analyses with a subset of 200 nearly
Artigas)wereselectedforphylogeneticanalysis. full-length sequences (>1400bp). Filters, which excluded
highly variable positions, were used. In all cases, general
2.3 DNAextraction tree topology and clusters were stable and a consensus tree
was generated (Gonza´lez-Toril et al., 2006). Sequences ob-
One ml of each enrichment culture was used for DNA ex- tained in this study have been deposited in the EMBL se-
traction. Fast DNA Spin kit for soil (Q-Bio Gene Inc., CA, quence database under accession numbers from EU429484
USA)wasusedaccordingtothemanufacturer’sinstructions. toEU429508.
Todisruptthecells,themixtureofceramicandsilicabeads
providedinthekitandthreepulsesof40satspeed5.5ofthe
FastPrep bead-beating instrument (Bio 101) were applied. 3 Resultsanddiscussion
Aftertheextraction,DNAwaspurifiedbypassagethrougha
GeneCleanTurbocolumn(Q-BioGeneInc.,CA,USA)and Followingtheprotocolsforenrichmentculturesofphotoau-
quantifiedbyethidiumbromide-UVdetectiononanagarose totrophicmicroorganismspresentinsnowsamplesfromthe
gel(Gonza´lez-Toriletal.,2006). Alps and the Andes and in an aerosol sample from the
Antarctica,pigmentednon-photosyntheticprokaryotesgrew
2.4 16SribosomalRNAclonelibraryconstruction successfully in the extremely poor nutritional conditions of
theselectedmedia(Fig.1)(Elsteretal.,2007). Similarpig-
PCRamplificationof16SrRNAgenefragmentsbetweenE. mented bacteria have also been observed in soils in King
colipositions8and1507forBacteriadomain(Lane,1991), George Island, South Shetland Island group as well in the
between E. coli position 25 and 1492 for Archaea domain Arctic Svalbard Islands (øehakova´ et al., 2008). It appears
(AchenbachandWoese,1995),andbetweenE.coliposition that this type of bacteria commonly develop in cold desert
www.biogeosciences.net/6/33/2009/ Biogeosciences,6,33–44,2009
36 E.Gonza´lez-Toriletal.: Diversityofpigmentedbacteriainaerosol,snowandsoil
Table1.PrimersusedforPCRamplification
Primera Targetsiteb Sequence(5’to3’) Specificity Reference
8F 8–23 AGAGTTTGATCMTGGC BacteriaDomain Lane,1991
25F 9–25 CYGGTTGATCCTGCCRG ArchaeaDomain AchenbachandWoese,1995
1492R 1492–1513 TACGGYTACCTTGTTACGACTT Universal AchenbachandWoese,1995
Cya359F 359–378 GGGGAATYTTCCGCAATGGG Cyanobacteriaandclhoroplasts Nu¨beletal.,1997
Cya106F 106–127 CGGACGGGTGAGTAACGCGTGA Cyanobacteriaandclhoroplasts Nu¨beletal.,1997
Cya781R(a)c 781–805 GACTACTGGGGTATCTAATCCCATT Cyanobacteriaandclhoroplasts Nu¨beletal.,1997
Cya781R(b)c 781–805 GACTACAGGGGTATCTAATCCCTTT Cyanobacteriaandclhoroplasts Nu¨beletal.,1997
a F(foward)andR(reverse)indicatetheorientationsoftheprimersinrelationtotherRNA.b PositionsaregivenaccordingtotheE. coli
numberingofBrosiusetal.,1981.cReverseprimerCYA781RisanequimolarmixtureofCYA781R(a)andCYA781R(b).
any of the DNA extracted from the five enriched cultures.
Theseresultsagreewiththemicroscopyanalysisofthecul-
tures (Elster et al., 2007). Also, no Archaea were detected
byamplification. PCRamplificationof16SrRNAgenesus-
inguniversalbacterialprimers, followedbycloningandse-
quencingproducedaround200sequences,whichwereused
to identify the different bacteria present in the enrichment
cultures by comparison with the NCBI database. The re-
trieved sequences were added to a database of over 50000
prokaryotic 16S rRNA gene sequences using the aligning
tooloftheARBsoftwarepackage(http://www.arb-home.de)
(Ludwig et al, 2004). Every sample was processed in the
same way: positive PCR products were cloned and 50 pos-
itive colonies were chosen and sequenced. Around 50 se-
quences were obtained for every enrichment culture. All
of them were aligned using the ARB software. With the
sequences aligned we built a distances matrix that allowed
Fig.1. Displayofpigmentedmicroorganismsenrichedfromsnow
different OTUs (operational taxonomic units) to be identi-
andaerosolsamples.
fied: 3 for Col du Dome, 7 for Col du Midi, 8 for Illi-
mani, 1 for Artigas and 6 for aerosol (Antarctis). One rep-
resentativesequencefromeveryOTUwasselectedforphy-
ecosystems and is easily transported with aerosols at both,
logenetic analysis. With these selected sequences phyloge-
shortandlongdistances. In1978,Imshsnetskyetal. hadal-
netictreesweregeneratedusingparsimony,neighbourjoin-
readystudiedpigmentationofviablebacteriarecoveredfrom
ing,andmaximum-likelihoodanalyseswithasubsetof200
the mesosphere. These authors suggested that the pigments
nearly full-length sequences (>1.400bp). Filters excluding
produced by these bacteria are associated with the need to
highlyvariablepositionswereused. Inallcasesgeneraltree
absorbharmfulUV-radiation. RecentlyDuetal.(2006)and
topology and clusters were stable. Thus, consensus trees
Mayilrajetal.(2006)havedescribedtheoccurrenceofpig-
weregenerated(Figs.2–6).
mented bacteria from various marine and soil ecosystems,
respectively. After the analysis of the generated sequences, represen-
Due to the characteristics of the cultures and the origin tatives of three bacterial phyla: Proteobacteria (Alpha-,
of the samples it was considered of interest to identify the Beta-andGamma-proteobacteria),ActinobacteriaandBac-
microorganismspresentinthedifferentcultures,toevaluate teroidetes, were identified (Fig. 2). Seven close relative
the diversity corresponding to this very specific type of mi- microorganisms were identified for the snow sample from
croorganismsandeventuallytocomparetheresultsobtained Col du Midi (Alps). Three sequences corresponded to
in geographically dispersed sampling sites. A commercial the Alphaproteobacteria: one as a possible member of
soil DNA extraction kit was used to extract DNA from the the genus Agrobacterium (closest relative: clone IrT-J614-
enrichment cultures from particulate matter present in high 14, retrieved from an environmental sample of a uranium
elevation snow in the Alps and the Andes, from an Antarc- mine (Selenska-Pobell, 2002) (Fig. 3), the other two; close
ticaerosolandamaritimeAntarcticsoil. Nooxygenicpho- to clones B3NR69D12 and AP-12, detected in an under-
totrophic Bacteria were amplified using specific primers in ground cave (Northup et al., 2003) and in a marine estuary
Biogeosciences,6,33–44,2009 www.biogeosciences.net/6/33/2009/
E.Gonza´lez-Toriletal.: Diversityofpigmentedbacteriainaerosol,snowandsoil 37
Fig.2.Prokaryoticphylogenetictreeshowingthephylainwhichenrichedmicroorganismsfromsnow,aerosolandsoilhavebeenidentified.
(NCBI accession number AY145551, unpublished) respec- Eightcloselyrelatedmicroorganismswereidentifiedfrom
tively. TwosequencescorrespondedtotheBetaproteobacte- the Andean snow sample (Nevado Illimani). Three se-
ria: oneapossiblememberofthespeciesHydrogenophaga quencescorrespondedtotheAlphaproteobacteriaclass: two
palleronii (Fig. 4), identified by FISH in lake snow aggre- related to the Agrobacterium (clone IrT-J614-14) (Fig. 3)
gates (Schweitzer et al., 2001), and the other close to a and the clone B3NR69D12, both identified in Col du Midi;
clone of the genus Limnobacter, D-15, isolated from un- andonerelatedtotheunculturedEV818CFSSAHH29clone,
derground mineral water (Loy et al., 2005). One sequence which was identified from subsurface water in the Kalahari
correspondingtotheGammaproteobacteriaexhibitedahigh Shield, South Africa (NCBI accession number DQ336984,
homologywithPseudomonaspseudoalkaligenes,whichwas unpublished). Two sequences corresponded to the Betapro-
isolated from a marine sediment (NCBI accession number teobacteria class: Hydrogenophaga palleronii (Fig. 4) and
AF286035,unpublished). Onesequencecorrespondedtothe LimnobactercloneD-15,bothalsoidentifiedinColduMidi.
phylum Bacteroidetes, with high homology with Aquiflexus One sequence exhibiting high homology with Aquiflexus
balticus(Fig.5),alsoretrievedfromamarinesediment(Bret- balticus(Fig.5)ofthephylumBacteroidetes,previouslyde-
taretal.,2004). scribedinColduMidi,wasretrievedfromtheAndesenrich-
The other sample from the Alpes (Col du Dome) exhib- ment culture. The last two sequences corresponded to the
ited much lower diversity than the one obtained from Col Actinobacteriaclass: onewithhighhomologytoMicrobac-
duMidi. IntheColduDomesampleonlythreerepresenta- terium thalassium (Richert et al., 2007) and the other with
tive sequences were retrieved. Two corresponded to uncul- Pseudonocardia sp. (Fig. 6) which was isolated from ma-
tivated Alphaproteobacteria clones, AP-12 and O15B-H01, rinesediments(NCBIaccessionnumberAY974793,unpub-
thefirstdetectedinamarineestuary(NCBIaccessionnum- lished).
ber AY145551, unpublished) and the other from a uranium Seven sequences retrieved from the aerosol sample from
minegroundwater(NCBIaccessionnumberAY662032,un- Antarctica were identified by phylogenetic analysis. Three
published). The other sequence corresponded to the class sequences corresponded to the Alphaproteobacteria class:
Actinobacteria, with a high level of homology with the one related with clone B3NR69D12, which has been also
speciesDietziakujamensis,whichwasisolatedfromtheHi- identifiedintheAndesandtheAlps(ColduMidi); another
malaya(Mayilrajetal.,2006). related with clone AP-12 which has been also identified in
www.biogeosciences.net/6/33/2009/ Biogeosciences,6,33–44,2009
38 E.Gonza´lez-Toriletal.: Diversityofpigmentedbacteriainaerosol,snowandsoil
Fig.3. PhylogenetictreeofAgrobacteriumandrelatedbacteria. Cloned16SrRNAsequencesfromenrichmentculturesareindicatedin
bold. SequencesretrievedfromNevadoIllimani(Andes)aredesignatedbytheword“Illimani”followedbythenumberofthesequence.
SequencesfromColduMidi(Alps)aredesignatedby“Coldumidi”followedbythenumberofthesequence. Barrepresents10%estimated
phylogeneticdivergence.
Fig.4. PhylogenetictreeofHydrogenophagaandrelatedbacteria. Cloned16SrRNAsequencesfromenrichmentculturesareindicatedin
bold. SequencesretrievedfromNevadoIllimani(Andes)aredesignatedbytheword“Illimani”followedbythenumberofthesequence.
SequencesfromColduMidi(Alps)aredesignatedby“Coldumidi”followedbythenumberofthesequence. Barrepresents10%estimated
phylogeneticdivergence.
Biogeosciences,6,33–44,2009 www.biogeosciences.net/6/33/2009/
E.Gonza´lez-Toriletal.: Diversityofpigmentedbacteriainaerosol,snowandsoil 39
Fig.5. PhylogenetictreeofAquiflexusandrelatedbacteria. Cloned16SrRNAsequencesfromenrichmentculturesareindicatedinbold.
SequencesretrievedfromNevadoIllimani(Andes)aredesignatedbytheword“Illimani”followedbythenumberofthesequence.Sequences
fromColduMidi(Alps)aredesignatedby“Coldumidi”followedbythenumberofthesequence.Barrepresents10%estimatedphylogenetic
divergence.
Fig.6. PhylogenetictreeofPseudonocardiaandrelatedbacteria. Cloned16SrRNAsequencesfromenrichmentculturesareindicatedin
bold. SequencesretrievedfromNevadoIllimani(Andes)aredesignatedbytheword“Illimani”followedbythenumberofthesequence.
Sequences from aerosol sample collected in Antarctica are designated by “Aeroplankton” followed by the number of the sequence. Bar
represents10%estimatedphylogeneticdivergence.
www.biogeosciences.net/6/33/2009/ Biogeosciences,6,33–44,2009
40 E.Gonza´lez-Toriletal.: Diversityofpigmentedbacteriainaerosol,snowandsoil
Table2.AnalysisofOTUs.Microorganismsandsequencescloselyrelatedwithclonesobtainedinthisstudyandsomeoftheircharacteris-
tics.
ColduDome(snow– ColduMidi(snow– Illimani(snow– UruguayAntarcticSta- French Antarctic Sta- Interestingcharacteristics NCBIa
theAlps) theAlps) theAndes) tionArtigas(soil–King tion Dumont d’Urville
GeorgeIsland) (aerosol)
CloneAP-12 CloneAP-12 CloneAP-12 Unculturedbacterium AY145551(98%)
NearBradyrhizobium NearBradyrhizobium NearBradyrhizobium fromWeserEstuary
Alphaproteobacteria Alphaproteobacteria Alphaproteobacteria
CloneB3NR69D12 CloneB3NR69D12 Unculturedbacterium AY186080(99%)
NearAfipiamassiliensis NearAfipiamassiliensis fromaninhabiting
Alphaproteobacteria Alphaproteobacteria ferromanganese
depositsinLechuguilla
andSpiderCaves
CloneO15B-H01 Unculturedbacterium AY662032(100%)
NearSinellagranuli fromagroundwater
Alphaproteobacteria contaminatedwithhigh
levelsofnitric
acid-bearinguranium
water
CloneIrT-J614-14 CloneIrT-J614-14 Unculturedbacterium AJ295675(99%)
NearAgrobacterium NearAgrobacterium fromauranium
Alphaproteobacteria Alphaproteobacteria miningwastepiles
Clone Brevundimonassp. Brevundimonas –Unculturedbacterium DQ336984(97%)
EV818CFSSHH29 Alphaproteobacteria vesicularis fromsubsurface DQ177489(99%)
NearBrevundimonas Alphaproteobacteria waterofKalahariShield, AY169433(99%)
Alphaproteobacteria SouthAfrica
–Bacteriaisolatedfrom
permafrost.
–Anaerobicpsychrophilic
enrichmentcultures
obtainedfroma
Greenlandglaciericecore
-Bacteriadetectedin
lakesnowaggregatesby
FISH
CloneD-15 CloneD-15 CloneD-15 Unculturedbacterium AF522999(99%)
NearLimnobacter NearLimnobacter NearLimnobacter from
Betaproteobacteria Betaproteobacteria Betaproteobacteria naturalmineralwater
Hydrogenophaga Hydrogenophaga Bacteriadetectedinlake AF078769(98%)
palleronii palleronii snowaggregatesbyFISH
Betaproteobacteria Betaproteobacteria
aAccessionNumberinNCBIoftheclosestphylogeneticrelativesandpercentageofsimilarity.
ColduMidi;andathirdonecorrespondingtotheBrevundi- regions. Saharan dust layers are very common in high alti-
monasvesicularis,whichwasisolatedfromaGreenlandice tude alpine snow (De Angelis AND Gaudichet, 1991). The
core(Sheridanetal., 2003). Onesequencecorrespondedto blocks of Alps snow used in this study even recorded a Sa-
Betaproteobacteria and had a high level of homology with haradustevent. Dustconcentrationwasalsorelativelyhigh
theunculturedcloneofLimnobacterD-15,alreadyidentified inthesnowdepositedonthesummitofIllimani(Clapperton,
intheenrichmentculturesofsnowsamplesfromtheAndes 1993), despite the absence of bare rocks near the sampling
andtheAlps(ColduMidi). Threesequencescorresponded site. Similar results of microbial abundances in snow were
to the Actinobacteria class: one related with Pseudonocar- also demonstrated from various Antarctic localities (Wynn-
diaantarctica(Fig.3),apsychrophilicmicroorganismsiso- Williams,1991).
lated from McMurdo Valley in the Antarctica (Prabahar et The sample from marine Antarctica soil was a pure cul-
al., 2004); a second one corresponding to a member of the ture because only one sequence was retrieved with a high
Pseudonocardia genus (Fig. 6) isolated from marine sedi- levelof16SrRNAgenesequencehomologywithamember
mentsandalsoidentifiedintheAndes;andathirdonesim- oftheBrevundimonassp.identifiedpreviouslyinpermafrost
ilartoBrachybacteriumconglomeratum,whichwasisolated samplesandclosetotheAlphaproteobacteriaspeciesofBre-
fromaspacecraftassemblyfacility(NCBIaccessionnumber vundimonasidentifiedintheAntarcticaerosol.
AY145551,unpublished).
All the identified microorganisms in the enrichment cul-
ThehighmountainsnowsfromtheAlpsandAndeswere tures belong to the bacterial domain. Snow samples from
richerinbacterialdiversitythantheAntarcticaerosol(Elster the Alps (Col du Midi) and the Andes (Illimani), as well
etal.,2007).Thisobservationagreeswiththerelativelylarge as the Antarctic aerosol sample exhibited a similar level of
amountsofdusttransportedinthefreetroposphereofthese bacterial diversity in the corresponding enrichment cultures
Biogeosciences,6,33–44,2009 www.biogeosciences.net/6/33/2009/
E.Gonza´lez-Toriletal.: Diversityofpigmentedbacteriainaerosol,snowandsoil 41
Table2.Continued.
ColduDome(snow– ColduMidi(snow– Illimani(snow– UruguayAntarcticSta- French Antarctic Sta- Interestingcharacteristics NCBIa
theAlps) theAlps) theAndes) tionArtigas(soil–King tion Dumont d’Urville
GeorgeIsland) (aerosol)
CloneLCP-79 Unculturedbacterium AF286035(98%)
Pseudomonas frommarinesediments
Gammaproteobacteria
Dietziaspp. Bacteriaisolatedincold DQ060378(99%)
Actinobacteria environments(Himalaya
andarticOcean)
Pseudonocardiasp. Pseudonocardia –Bacteriaisolatedfrom AY234532(99%)
Actinobacteria antarctica marinesediments AJ576010(99%)
Actinobacteriaand (depthsof500m).
Pseudonocardiasp. –Bacteriaisolatedfrom
Actinobacteria McMurdo
Dry Valleys, Antarctica.
Filamentous
andproducebrowncolour
substratemyceliaand
aerialmyceliaVich
formawhite
conglomerate.
Microbacterium Inyoungcultures,cells AM181507(98%)
thalassium aresmallirregularrods.
Actinobacteria Inoldcultures,rods
become
shorterorspherical
elements.
Coloniesareyellowish
while,yellow
ororange.
Brachybacteriumsp. Bacteriaisolatedfrom AY167842(99%)
Actinobacteria spacecraftassembly
facilities
Aquiflexumbalticum Aquiflexumbalticum Bacteriumisolatedfrom AJ744861(94%)
Bacteroidetes Bacteroidetes surfacewaterofthe
Central
BalticSea(depthof5m).
Redandtransparent
colonieswhenyoung,but
turn
opaque with ongoing in-
cubation.
Cellscontaincarotenoids.
(Table 2). The marine Antarctic soil (King George Island, Antarcticmaritimesoil),Hydrogenophagapalleroni(Coldu
UruguayAntarcticStationArtigas)enrichmentculturecon- Midi and Illimani), Aquiflexus balticus (Col du Midi and
tainedonlyonesequence(Table2). Thisisprobablydueto Illimani) and Pseudonocardia sp. (Illimani and Antarctic
thestrictoligotrophicprotocolusedforitsenrichment. Only aerosol) (Table 2). Six out of fourteen identified genera or
onetypeofbacteriawasabletogrowonmineralagarplate. species are found only in a single location (Table 2). In-
On the contrary, in the case of snow and aerosol samples, terestingly enough, much more diversity was found in very
growthinliquidmineralmediawasalwaysobserved. Inthe close locations in the Alps (Col du Dome and Col du Midi,
supplementary information http://www.biogeosciences.net/ only one common sequence out of ten) than in locations
6/33/2009/bg-6-33-2009-supplement.pdf figures of more in different hemispheres, altitudes or matrix (snow versus
phylogenetictreeareprovided. aerosol) (Table 2). Concerning the pigments that color to
The distribution of detected bacteria was related to cold someofthecolonies,severalbacteriasuchasDietzia,Aqui-
environments (21.4%), marine environments (35.7%) and flexum, Microbacterium and Pseudonocardia, related with
soils/subsurface (35.7%) (Table 2). No single cosmopoli- thosepresentintheenrichmentcultures,havebeendescribed
tan bacterium was found in all the analyzed sites, although as having this peculiar phenotypic property. In addition,
three geographically distant sampling sites (Alps, Illimani membersoftheActinobacteriaclassarewellknownfortheir
and Antarctic aerosol) shared three microorganisms (Lim- ability to synthesize pigments for radiation protection pur-
nobacter clone D-15, and two uncultured Alphaproteobac- poses.
teria, clones B3NR69D12 and AP-12). Different bacteria It is evident that the experimental procedure used in this
werefoundintwolocations:Agrobacteriumsp.(ColduMidi study is not contamination-free (see Elster et al., 2007).
and Illimani), Brevundimonas sp. (Antarctic aerosol and Careful analysis of contamination was done through the
www.biogeosciences.net/6/33/2009/ Biogeosciences,6,33–44,2009
42 E.Gonza´lez-Toriletal.: Diversityofpigmentedbacteriainaerosol,snowandsoil
use of blank samples (e.g. vials without sample but merely References
opened in the field for the same period of time, distilled
or re-distilled water used throughout the project, filters for Achenbach, L. and Woese, C.: 16S and 23S rRNA-like primers,
inArchaea, in: Alaboratorymanual, editedby: Sower, R.and
aerosolcollection,negativecontrolsforDNAextractionand
Schreier,H.J.,ColdSpringHarborLaboratoryPress,NY,521–
PCR amplification, etc.). No growth could be detected in
523,1995.
anyofthecontrolsperformed. Inaddition,mostoftheiden-
Bischoff,H.W.andBold,H.C.:SomealgaefromEnchantedRock
tified bacteria fit quite well with bacteria isolated or identi-
andrelatedalgalspecies,inPhycologicalstudies,Universityof
fiedfromsimilarhabitatsaroundtheworld(e.g.Castroetal.,
Texas,IV,Austin,68,1963.
2004; Shivaji et al., 2004; Mayilraj et al., 2006; Despre´s et Brettar, I., Christen R., and Ho¨fle M. G.: Aquiflexum balticum
al.,2007;Georgakopoulosetal.,2008).Thesebacterialcom- gen.nov.,sp.nov.,anovelmarinebacteriumoftheCytophaga-
munitiesrepresentindividualsfrequentlyoccurringinremote Flavobacterium-Bacteroides group isolated from surface water
terrestrial cold or hot deserts/semi-deserts, and/or marginal of the central Baltic Sea, Int. J. Syst. Evol. Microbiol., 54(6),
soil-snow-iceecosystems. 2335–2341,2004.
Concerningthedifferentmodelsforlongdistancemicro- Brosius,J.,Dull,T.J,Sleeter,D.D.,andNoller,H.F.: Geneorga-
nizationandprimarystructureofaribosomalRNAoperonfrom
bial dissemination (atmospheric circulation, ocean currents,
Escherichiacoli,J.Mol.Biol.,148,107–127,1981.
birds,fish,mammalsandhumanvectors),ifweconsiderthe
Castro,V.A.,Thrasher,A.N.,Healy,M.,Ott,C.M.,andPierson,
habitatsinwhichrelatedmicroorganismshavebeendetected,
D.L.: Microbialcharacterizationduringtheearlyhabitationof
we can rule out ocean currents and animal vectors, leaving
theinternationalspacestation,MicrobialEcology,47,119–126,
atmospheric circulation as the most plausible means of dis-
2004.
semination,especiallygiventhemicrobialdiversitydetected Clapperton, C. C.: Quaternary Geology and Geomorphology of
in the Antarctic aerosol and shared with other distant loca- South America, in Elsevier Science Publ., Amsterdam, 780,
tions(71.4%),whichunderlinestheimportanceofmicrobes 1993.
attachedtodustparticlesfortheirdisseminations. Chalmers, M. O., Harper, M. A., and Marshall, W. A.: An Il-
Of course, our data can not rule out the possible model lustrated Catalogue of Airborne Microbiota from the Maritime
of“everythingiseverywhere”,althoughconsideringtheex- Antarctic,BritishAntarcticSurvey,Cambridge,175,1996.
Christner, B. C., Mosley-Thompson, E., Thompson, L. G.,
perimental constraints introduced by the use of extremely
Zagorodnoc, V., Sandman, K., andReeve, J.N.: Recoveryand
oligotrophicselectivemedia,wethinkthatatmosphericdis-
identification of viable bacteria immured in glacial ice, Icarus,
persioncanexplainadequatelytheobservedresults. Oneof
144,479–485,2000.
theproblemsrelatedwiththistypeofexperimentsistorule
De Angelis, M. and Gaudichet, A.: Saharan dust deposition over
out the possibility of contamination. Considering the loca-
MontBlanc(FrenchAlps)duringthelast30years,Tellus,43B,
tion of the selected sampling sites and the obtained results, 61–75,1991.
we believe we demonstrated by the protocols used that this Despre´s,V.R.,Nowoisky,J.F.,Klose,M.,Conrad,R.,Andreae,M.
possibilityisimprobable. Althoughthedifferencesobserved O.,andPo¨schl,U.:Characterizationofprimarybiogenicaerosol
among the samples obtained during the same campaign in particles in urban, rural, and high-alpine air by DNA sequence
twoclosesitesintheAlpsisnotobvious,wethinkthatitis andrestrictionfragmentanalysisofribosomalRNAgenes,Bio-
a very useful internal control for the lack of contamination geosciences,4,1127–1141,2007,
http://www.biogeosciences.net/4/1127/2007/.
inthesamplingmanipulationbecausetheywerecollectedby
Dimmick,R.L.,Wolochow,M.A.,andChatigny,A.A.: Evidence
thesameteamandanalyzedtogetherinthesameconditions.
formorethanonedivisionofbacteriawithinairborneparticles,
We strongly believe that the common microbial patterns of
Appl.Environ.Microbiol.,38,642–643,1979.
the particular microorganisms observed at distant locations
Du,H.,Jiao,N.,Hu,Y.,andZeng,Y.:Diversityanddistributionof
reflectstrueairbornemicrobialdissemination,andtherefore
pigmentedheterotrophicbacteriainmarineenvironments,FEMS
wewouldliketoproposetheprotocolofenrichmentinolig- MicrobialEcology,57,92–105,2006
otrophicmediaforfurthertestingofairbornemicrobialdis- Elster,J.,Lukesˇova´,A.,Svoboda,J.,Kopecky´,J.,andKanda,H.:
persiontoreducetheamountofcontaminantsthatcouldin- Diversityandabundanceofsoilalgaeinthepolardesert,Sver-
terferewiththeanalysisoftheresults. drup pass, central Ellesmere Island, Polar Rec. 35, 231–254,
1999.
Acknowledgements. The work was supported by grants Elster,J.andBenson,E.E.: LifeinthePolarTerrestrialEnviron-
from the Spanish Ministerio de Educacio´n y Ciencia (grant ment: AFocusonAlgae,inLifeInTheFrozenState,FullerB,
CGL2006/02534/BOS), the Ministry of Education of the editedby: Lane,N.andBenson,E.E.,TaylorandFrancis,Lon-
Czech Republic (Kontakt – ME 934, ME 945 and project GA don,111–149,2004.
CR 206/05/0253) and the French-Czech cooperative research Elster,J.,Delmas,R.J.,Petit,J.-R.,andReha´kova´,K.: Composi-
programme Barrande No. 99054. We are very grateful to tionofmicrobialcommunitiesinaerosol,snowandicesamples
Mrs.JanaSˇnokhousova´forhertechnicalassistance. fromremoteglaciatedareas(Antarctica,Alps,Andes),Biogeo-
sciencesDiscuss.,4,1779–1813,2007,
Editedby:J.Toporski http://www.biogeosciences-discuss.net/4/1779/2007/.
Flechtner, V. R.: Enigmatic desert soil algae. Soil algal flora of
Biogeosciences,6,33–44,2009 www.biogeosciences.net/6/33/2009/
Description:and Gamma-proteobacteria) , Actinobacteria and Bac- teroidetes phyla to be and reproduce at temperatures near or below 0◦C in cloud droplets