Table Of ContentHiranietal.BMCBiotechnology2013,13:1
http://www.biomedcentral.com/1472-6750/13/1
METHODOLOGY ARTICLE Open Access
A simplified counter-selection recombineering
protocol for creating fluorescent protein reporter
constructs directly from C. elegans fosmid
genomic clones
Nisha Hirani1, Marcel Westenberg1,4, Minaxi S Gami1, Paul Davis2, Ian A Hope3 and Colin T Dolphin1*
Abstract
Background: Recombineering is a genetic engineering toolthat enablesfacile modification of large episomal
clones, e.g. BACs, fosmids. We have previously adapted this technology to generate, directly from fosmid-based
genomic clones, fusion gene reporter constructs designedto investigategene expression patterns in C.elegans.
Inour adaptation a rpsL-tet(A) positive/negative-selection cassette (RT-cassette) is first inserted and then, under
negative selection,seamlessly replaced withthedesired sequence. We report here onthe generation and
application ofa resource comprising two setsof constructs designed to facilitate this particular recombineering
approach.
Results: Twocomplementary setsof constructswere generated.The first contains different fluorescent protein
reporter coding sequences and derivativeswhile thesecond set of constructs, based in thecopy-number inducible
vector pCC1Fos, providea resource designed to simplify RT-cassette-based recombineering. These latter constructs
are used in pairs the first member ofwhich provides a template for PCR-amplification ofan RT-cassette while the
second provides, as an excised restriction fragment, the desired fluorescent protein reporter sequence.As the
RT-cassette is flanked byapproximately 200bp from the ends of thereporter sequence thesubsequentnegative
selection replacement step is highlyefficient. Furthermore, use of a restriction fragment minimizes artefacts
negating the need for final clone sequencing. Utilizing this resource wegenerated single-, double-and
triple-tagged fosmid-based reporters to investigateexpression patterns ofthreeC.elegans genes located ona
single genomic clone.
Conclusions: We describe the generation and applicationof a resource designedto facilitatecounter-selection
recombineering of fosmid-based C. elegans genomic clones.By choosing the appropriate pair of ‘insertion’and
‘replacement’constructsrecombineered products, devoid ofartefacts,are generated athighefficiency.Gene
expression patternsfor three genes located on thesame genomic clone were investigated viaa set of
fosmid-based reporter constructs generated with the modified protocol.
Keywords: C.elegans, Recombineering, Fosmid, Fluorescent protein, Deoxyribose-phosphate aldolase,
Peroxiredoxin,Metallocarboxypeptidase
*Correspondence:[email protected]
1InstituteofPharmaceuticalScience,King’sCollegeLondon,Franklin-Wilkins
Building,150StamfordStreet,LondonSE19NH,UK
Fulllistofauthorinformationisavailableattheendofthearticle
©2013Hiranietal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative
CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and
reproductioninanymedium,providedtheoriginalworkisproperlycited.
Hiranietal.BMCBiotechnology2013,13:1 Page2of13
http://www.biomedcentral.com/1472-6750/13/1
Background have developed tools and techniques designed to lever-
Since its introduction as a model metazoan animal [1] age the power of recombineering. Recombineering is a
the experimental convenience, simple anatomy, which homologous recombination (HR)-based genetic engineer-
includes most differentiated tissues including a nervous ingsystemmediatedbytransientexpressionofλ-encoded
system, and, in particular, genetic tractability has made recombinaseswithinanE.colihost(reviewedin[10]).We
the nematode Caenorhabditis elegans a popular research reported previously [5] on the use of a rpsL-tet(A) posi-
platformformanybiologistsandgeneticists[2].Sequence tive/negative-selection cassette (RT-cassette) [11] in a
analysis of the C. elegans genome, completed in 1998 [3], two-step counter-selection recombineering approach that
has revealed the presence of approximately twenty thou- enables the seamless creation of fosmid-based reporters
sand protein-coding genes. Although many of these have devoid of undesired, extraneous sequence changes. Al-
human homologues many are yet to have a function as- though some groups [8,9] have reported poor recombi-
signed. A number of complementary methodological ap- neering efficiencies using the RT-cassette as a selectable
proaches are available to functionally analyze C. elegans marker others [12,13] have, like us, employed it success-
genes amongst which the determination of the spatial- fullytogeneratehighlyinformativereporterfusions.
temporalpatternofgeneexpressionisparticularlyinform- Although the various strategies and associated resour-
ative. While such patterns can be investigated at the level ces provide C. elegans researchers with a range of po-
oftranscriptionortranslation,viaapproachessuchas,re- werful recombineering tools the methodology is perhaps
spectively,insituhybridizationorimmunohistochemistry, not as commonly practiced as it might be. To both fur-
it is more common to employ reporter technology and ther encourage its uptake and to facilitate an ongoing
analyze, in transgenic animals, the expression pattern of project designed to interrogate putative internal pro-
thesurrogatereporter. moter elements within operons we generated two sets
In its simplest guise, reporter technology involves clo- of constructs designed to provide tools to simplify the
ning either the known promoter region or, if this se- RT-cassette-based counter-selection recombineering ap-
quence has not been precisely defined, as is often the proach employed in our laboratories. The first set con-
0
case, then all or part of the 5 intergenic sequence up- tained coding sequences (CDSs) encoding potentially
stream of a reporter gene, such as gfp, in an appropriate useful fluorescent protein (FP) reporters intended to
base plasmid (e.g. reference [4]) to generate a so-called expand the FP palette currently in common use by C.
transcriptional reporter. Because the cloned sequence elegans researchers. In order to maximise the utility of
maynotcontainallnecessaryregulatoryelementsresult- the final resource, N- and C-terminal TAP- (tandem
ing expression patterns should be interpreted cautiously affinity purification) tag [14,15] sequences were also in-
as they may not fully reflect that of the gene under cluded. The FP-encoding sequences were both extrac-
study. If, on the other hand, a more complex transla- ted from the previously described vectors pPD136.61,
tional reporter, in which the reporter is fused in-frame pPD136.64 [4] and pAA64 [16] that encode, respectively,
to the protein-coding sequence of the gene of interest, CFP, YFP and the red-shifted mCherry [17], and synthe-
is constructed then, in addition to deriving information sized de novo to encode the less frequently used mCeru-
about promoter activity, potentially other related aspects lean [18], mTFP1 (Teal FP) [19] and mCitrine [20]. A
of gene expression, such as the sub-cellular localization set of these inserts was subsequently introduced into the
of the corresponding gene product, can also be derived. single-copy fosmid vector pCC1Fos generating the sec-
In order to include distantlylocated regulatory elements, ond set of constructs that provide the tools to faciliate
and thus generate a construct more likely to recapitulate RT-cassette-based recombineering. The resulting me-
the expression pattern of the endogenous gene, such a thod requires only a single PCR, to generate the initial
reporter would, ideally, contain not only the genomic RT-cassette, and generates final products of high fidelity.
locus under study but also significant stretches of the We report here on the generation of these constructs
0 0
5 and 3 flanking sequence. Because C. elegans genes are and illustrate their utility by building reporter fusion
relatively compact (5 kb on average [3]) and the fosmid- constructs designed to examine the expression patterns
based genomic clone insert is typically 35–40 kb, a trans- of three C. elegans genes. These genes were all located
lational reporter based upon such a fosmid would, when on a single fosmid and a series of reporter constructs
the locus under study is located within the central region were built, via iterative rounds of counter-selection re-
of the insert, provide that broad genomic DNA envi- combineering, in which one, two or all three genes were
ronment. Fosmid-based C. elegans genomic clones are taggedwithadifferentFPreporter.Fluorescencemicros-
thus ideal foundations for translational reporter cons- copy of lines transgenic for a subset of these constructs
truction [5]. revealed expression patterns that either confirmed those
To facilitate the generation of such reporter constructs previously reported or, in the case of one gene, indicated
from C. elegans fosmid clones we [5,6], and others [7-9], an unexpected aggregation of the fusion gene product.
Hiranietal.BMCBiotechnology2013,13:1 Page3of13
http://www.biomedcentral.com/1472-6750/13/1
Unexpectedly, and somewhat disappointingly, mCeru- Monomeric FPs with reported high photostability and
lean, mCitrine and mCherry, each encoded by a codon- brightness wereselected from the cyan, green,yellow and
optimized CDS, exhibited either rather fast bleaching or red regions of the visible light spectrum and led to the
were not as bright as had been envisaged particularly choiceofthecyanmCerulean[18],thecyan/greenmTFP1
when expressed as fusion proteins. As these characteris- [19], the yellow mCitrine [20] and the red mCherry [17].
tics make theircorrespondingconstructsless useful than Although DNA sequences encoding each of the FPs were
hoped only those constructs that provided useful recom- available we decided to design, and have commercially
bineering tools are being made available via the plasmid synthesized, novel CDSs as this would not only permit
depository Addgene. By selecting constructs from this codon optimization but also, by careful choice and place-
resource appropriate to their aims C. elegans researchers mentofrestrictionenzyme(RE)sites,enableustosimplify
will be able to recombineer fosmid-based reporter con- all envisaged downstream sub-cloning events. In addition,
structsina simplified,streamlinedmanner. because introns have been demonstrated to generally in-
creaselevelsofheterologousgeneexpression[25],andare
Results and discussion routinely inserted into sequences encoding reporter pro-
Approximately 15% of all C. elegans genes are clustered teins in C. elegans, we also designed and included silent,
together into polycistronic transcriptional units termed blunt-cutting internal RE sites to enable facile insertion
operons[21].Wehavebeguntoinvestigatetheextentthat of up to two artificial introns per CDS (Additional file 1:
downstream operon genes may be transcriptionally regu- FigureS1andAdditionalfile1:TableS1).
lated via internal cis-acting sequence elements (Hirani We expanded the overall utility of this first set of
et al., unpublished). Operons containing such internal constructs by including additional sequences encoding
promoter elements, so-called hybrid operons, have been N- and C-terminal TAP-tags (pHN001, pNH002) to en-
identifiedusingtranscriptionalreportersdesignedtointer- able combined gene expression analysis and TAP-based
rogate, in isolation, the intergenic regions between neigh- protein purification [14,15]. We chose, as the terminal
bouring operon genes [22]. In contrast, we are employing epitope, the S-Tag sequence due to its strong retention
fosmid-based reporters to enable us to both manipulate on S-protein resins [26] followed by, as the protease site,
precisely such putative internal regulatory elements and, the recognition sequence for human rhinovirus 3C pro-
atthesametime,tagmultipleoperongeneswithdifferent tease. For the internal tag we decided upon StrepTag II
FPs,without,ineithercase,otherwisedisturbingthegross [27] because of its highly specific interaction with Strep-
operonstructure.Tofacilitatetherecombineeringofthese Tactin resins and the ability to subsequently elute bound
reporterconstructswedesignedandbuiltaresourcecon- protein(s) under gentle conditions. Although not yet ex-
sistingoftwocomplementarysetsofplasmids.Thefirstof perimentally tested these TAP-tags can be excised from
these comprises a modular set of FP CDSs including ver- constructsavailablefromAddgene(Table1).Themodular
sions augmented by addition of N- and C-terminal TAP- design of the synthesized sequences and their provision
tagsor a nuclear-localizationsignal. The rationalefor this in a vector, pGOv5, stripped of common restriction sites
setofplasmidswasourinitialaimtotag,withdifferentFP enabled us to build quickly a range of sub-clones encom-
reporters, up to four genes within any one operon. Spec- passing the more useful potential module combinations
traldiscriminationbetweeneachFPwouldbeachievedby (Additionalfile1:TableS1).
acombinationofcarefulchoiceofFPwithassociatedfilter
set and combiningthis, if necessary, withpost-acquisition
Table1pGOv5-basedconstructsa
spectral unmixing. However, as discussed below, ulti-
Construct Insert Intron1e Intron2
mately only three different FPs were combined within a
single fosmid-based reporter enabling us to discriminate pNH001 [(G4S)3]::C-TAP-tag::2xNLSb - -
readily between their respective spectral signals simply pNH002 N-TAP-tag::[(G4S)3]::mTFP1c - -
using appropriate filter sets. The second set of plasmids, pNH009 N-TAP-tag::mTFP1 - -
built using inserts from the first, was designed to both pNH013 mTFP1d - -
simplify and speed up the recombineering procedure and pNH026 mTFP1::[(GS)]::C-TAP-tag - -
4 3
generatehighfidelityFPfusiongenereporterproducts.
pNH030 mTFP1::[(GS)]::2xNLS - -
4 3
pNH078 mTFP1[1I]d B -
Sequencesencodingfluorescentproteinreporters
pNH082 mTFP1[2I]d B C
To identify FPs with sufficient spectral separation to
aAllconstructsareinE.coliDH5αandareavailablefromAddgeneblacks
allow multiple tagging and, at the same time, minimize intactopen-readingframe;cmTFP1sequencelacksN-terminalMet-Valand
therequirementforcomputationalseparationoftheresul- C-terminalLysresiduespresentinnativesequence;dN-terminalMet-Val
residuesandC-terminalLysresidue,presentinnativecodingsequence,
tingfluorescentsignalsweconsideredtherelativebiophy-
replaced,respectively,withMet-Ala-AlaandVal-Ser-Ala;eseeAdditionalfile1:
sical and spectral properties of the FPs available [23,24]. TableS2.
Hiranietal.BMCBiotechnology2013,13:1 Page4of13
http://www.biomedcentral.com/1472-6750/13/1
Prior to their incorporation into fosmid-based re- The second observation was the apparent lack of im-
porters the spectral and biophysical properties of the provement, in terms of relative brightness, exhibited by
FPs were briefly investigated via in vitro and in vivo mCitrine and mCherry when compared, respectively, to
approaches. First, each FP was expressed in vitro from F-YFP and Mc-mCherry despite the codon optimization
a DNA template and the resulting protein immuno- undertaken specifically to maximize expression in vivo.
captured to agarose beads via an appropriate anti-FP Both latter FPs are encoded by CDSs containing three
antibody.Fluorescencemicroscopyrevealed discrete,con- short, equally spaced artificial introns. As expected, the
centrated fluorescence of the intended colour (Additional introduction of two similar sized artificial introns, albeit
file 1: Figure S5) confirming that each FP had been suc- not spaced equally, into the CDSs encoding mCitrine
cessfully generated from its respective CDS and each and mCherry improved, as judged by eye, protein ex-
exhibited the expected spectral profile. Second, we obser- pression levels in transgenic worms over the equivalent
ved fluorescence expression patterns in transgenic C. ele- non-intron-containing CDSs (data not shown). However,
gans strains transformed with constructs built from the longer exposure times were still required to achieve
myo-3PROM-containing vector pPD95.86 [4] that encoded fluorescence emissions equivalent to worms transformed
either an unembellished FP, with a contiguous or two with corresponding F-YFP- and Mc-mCherry-encoding
intron-containing (2I) CDS, or with a C-terminal nuclear constructs. In contrast, mTFP1 proved to be consistent-
localization signal (NLS). Control strains were also ly bright and photostable requiring only rather short
generated by transformation with DNA of equivalent (2–5 msec) exposure times when encoded by the two
pPD95.86-based sub-clones that contained CDSs en- intron-containing CDS. Many factors are involved in de-
coding CFP, YFP and mCherry excised, respectively, termining the overall brightness of the FP reporter in-
from pPD136.61, pPD136.64 [4] and pAA64 [16]. To cluding the efficiency of transcription/translation of the
distinguish these FPs from those encoded by CDSs encoding sequence as well as the intrinsic spectral prop-
designed as part of this work the prior versions of CFP erties of the resulting fluorophore. With respect to the
and YFP are prefixedwithF (F-CFP, F-YFP)and mCherry latter, we expected mCitrine, especially when encoded
with Mc (Mc-mCherry). All strains revealed the ex- by the two-intron-containing CDS, to be at least as
pected body muscle expression pattern (Additional file 1: bright as F-YFP, when illuminated under equivalent ex-
Figure S5) with clear nuclear localization for the FPs posure conditions, as this FP is considered superior to
equipped with a NLS (data not shown). Although these standardYFPinbothbrightnessandstability[23,24].Al-
results indicated that the FPs possessed the anticipa- though strains transformed with myo-3PROM-driven Mc-
ted spectral properties, both in vitro and in vivo, two mCherry reproducibly exhibited brighter images than
additional observations were made. First, rapid pho- equivalent strains transformed with mCherry the two
tobleaching was exhibited by mCerulean, particularly FPshadidenticalaminoacidsequencesanddifferedonly
when expressed in vivo within transgenic worms, using by being encoded by different, “codon-optimized” CDSs
thesameilluminationintensityandexposuretimepara- that were globally 77% identical (data not shown). The
meters employed to visualize the other FPs including differences in brightness observed between the respective
F-CFP. As the FP had effectively completely bleached in yellow and red FP pairsare morelikely due todifferences
thetimeittooktofocusonthefinedetailofaspecimen inthe efficiency with which each CDS is transcribed and/
it was concluded that mCerulean would be impractical ortheresultingmRNAtranslatedintoproteinresultingin
as a FP partner in multiple in vivo gene tagging strat- reducedFPabundancethananysignificantdifferencesbe-
egies and that the three FP combination mTFP1/mCi- tween the spectral properties of the fluors. Although we
trine/mCherry would be used in future constructs. The attemptedtoensure,bydesigningsequencesfromscratch,
reasons for the rapid in vivo fluorescence decay of that the CDSs encoding mCitrine and mCherry would
mCerulean, especially in comparison to that observed promote efficient transcription and translation it is clear
with the ancestral enhanced CFP (ECFP) (visualized that simple assumptions concerning, for example, adjus-
here as F-CFP), is not clear as the amino acid sequence tingcodon choice to reflect usage in highly expressed en-
isthesameasthatoftheoriginalmCerulean[18].Inter- dogenousgenes,doesnotnecessarilyguaranteeoptimized
estingly, recent crystallographic data [28] has suggested proteinexpression[30].
that the additional Y145Achange present in mCerulean
might exacerbate the likelihood of fluorescence quen- pCC1Fos-basedconstructs
ching in comparison to CFP. Whatever the underlying The second set of plasmids, built with inserts derived
cause(s), further improved versions of cyan-shifted FPs from the first, was designed to enable the recombinee-
have been developed, e.g. mCerulean3 [29] and mTur- ring procedure to be simplified, take less time and ge-
quoise2 [28], which would be less likely to suffer from nerate final FP fusion gene reporter constructs of high
suchfluorescenceinstability. fidelity. As a subset of the plasmids were to contain the
Hiranietal.BMCBiotechnology2013,13:1 Page5of13
http://www.biomedcentral.com/1472-6750/13/1
RT-cassette which, we had found, confers instability selectionreplacementstepishighlyefficientwithfarfewer
when present in a standard high-copy number vector false positives, e.g. from when the RT-cassette is deleted
(unpublished observations), it was decided to base them rather than being replaced. In our hands, for clones se-
all in pCC1Fos. As well as maintaining clones as single lected under negative selection with chloramphenicol and
copies for stable, routine propagation pCC1Fos-based streptomycin, successful replacement of the RT-cassette
constructs can, when hosted in a suitable strain such as with the desired sequence is essentially 100% (data not
EPI300or MW005[6],also betransientlyinducedtoap- shown).ThisimprovementinHRbringsanumberofadd-
proximately 50 copies per bacterial cell thus improving itionalmethodologicalbenefitsincludingsmalleramounts
DNA isolation yield and purity. These plasmids were oflinearreplacementDNA(50ng)beingrequiredand,as
designed as pairs the first member of which provides the farfewerbacterialcellsneedbetoelectroporated,reduced
template for PCR-amplification of the RT-cassette, used cell culture volumes and shorter incubation times. Fur-
in the first, positive selection recombineering step, while thermore, use of a restriction fragment ensures final
the second provides the desired replacement sequence, recombineered products are essentially free of sequence
excisedasarestrictionfragment,foruseinthesubsequent artefacts introduced byPCR requiringonlyRE analysis to
counter selection step. Generation of this pCC1Fos-based confirm construction fidelity. Lists of paired constructs
construct set greatly simplifies the RT-cassette-mediated designed to provide template for PCR-amplification of
counter-selection recombineering protocol as only one the RT-cassette donor and the subsequent replacement
PCR needs to be performed and a restriction fragment is fragment are provided in Table 2 and Additional file 1:
used to replace the inserted RT-cassette in the second Table S6. Additional methodological details are provided
recombineering step. The first step involves PCR-amplifi- inthesupplementaldata.
cationofanRT-cassettefromatemplatesequenceexcised
byrestrictionenzymedigestionfromtheappropriatecon- Geneexpressionanalysis
struct. The product is flanked by approximately 200 bp, Having generated this pCC1Fos-based resource set we
0 0
derived fromthe template,matchingthe 5 and 3 endsof utilized some of its components to build, by iterative
the chosen FP CDS and 50 bp terminal homology arms, rounds of counter-selection recombineering, a series of
derivedfromtheprimers,designedtodirectinsertioninto translational reporter constructs from a single fosmid
thechosensitewithinthetargetgene.Replacementofthe clone. Although we are using this resource to investigate
inserted RT-cassette is achieved by recombineeering the transcriptional complexity of operon gene regulation
transformation with a NotI restriction fragment, excised we chose, for the sake of simplicity, to confirm its utility
from a second plasmid, containing the desired FP CDS. here by tagging genes present on the same fosmid clone
TheinclusionoftheextendedregionsofflankingFPCDS but not located within a single operon. A list of fosmid
homology with the RT-cassette ensures this negative clones each containing three or more such genes with
Table2Resourcesforsimplifiedcounter-selectionrecombineering
RT-cassette-containingconstructb Replacementconstructc
Desiredinsertionsequencea RT kbd Fwd(50-30)e Rev(50-30)e pCC1Fos- pGOv5- kbf
based based
RT-cassette pNH034 2.0 GCTGTCGAGATATGACGGTGTTCA TCTTGGAGTGGTGAATCCGTTAGC - -
F-CFP pNH050 2.4 ATGAGTAAAGGAGAAGAACTTTTC [*]TTTGTATAGTTCATCCATGCCATG pNH039 n/a 0.9
F-GFP pNH051 2.4 ATGAGTAAAGGAGAAGAACTTTTC [*]TTTGTATAGTTCATCCATGCCATG pNH040 n/a 0.9
F-YFP pNH052 2.4 ATGAGTAAAGGAGAAGAACTTTTC [*]TTTGTATAGTTCATCCATGCCATG pNH041 n/a 0.9
Mc-mCherry pNH053 2.4 ATGGTCTCAAAGGGTGAAGAAGAT [*]GGATCCACTAGTCTTATACAATTC pNH042 n/a 0.9
mTFP1 pNH054 2.4 ATGGCCGCCTCAAAAGGAGAAGAA [*]AGCGCTTACGTAGAGCTCGTCCAT pNH043 pNH013 0.7
N-TAP-tag::[(GS)]::mTFP1 pNH066 2.6 ATGGTTAAAGAAACAGCAGCAGCG [*]AGCGCTTACGTAGAGCTCGTCCAT pNH058 pNH002 0.9
4 3
mTFP1::[(GS)]::C-TAP-tag pNH094 2.3 ATGGCCGCCTCAAAAGGAGAAGAA [*]AGCCCATGAGTCCATATGCTGTCT pNH090 pNH026 0.9
4 3
mTFP1::[(GS)]::2xNLS pNH070 2.6 ATGGCCGCCTCAAAAGGAGAAGAA [*]AGCGCTAACTTTTCGCTTCTTCTT n/a pNH030 0.8
4 3
mTFP1[B] pNH054 2.4 ATGGCCGCCTCAAAAGGAGAAGAA [*]AGCGCTTACGTAGAGCTCGTCCAT n/a pNH078 0.8
mTFP1[BC] pNH054 2.4 ATGGCCGCCTCAAAAGGAGAAGAA [*]AGCGCTTACGTAGAGCTCGTCCAT n/a pNH082 0.8
asequencetobeseamlesslyinsertedintotarget;bthecounter-selectionRT-cassetteshouldbePCR-amplifiedfromthisconstructusing,astemplate,theRT-
cassette-containingNotI-NotIfragment;cthedesiredreplacementcassettecanbeexcised,asaNotI-NotIfragment,fromeitherthepCC1Fos-(ifavailable)or
parentalpGOv5-based(Table1)constructs;dsizeoftheisolatedNotI-fragment(orNcoI-NcoIfragmentforpNH034)tobeusedasPCRtemplate;esuggested
30sequencesof‘recombineering’ODNsdesignedtoPCR-amplifyFP-flanked,RT-cassette-containingsequence.ReverseODNsequencelacksa50stoptriplet[*];
fsizeoftheisolatedNotI-fragmenttobeusedtoreplacetheinsertedFP-flanked,RT-cassette-containingsequence.AllconstructsareavailablefromAddgeneand
areinE.coliEPI300apartfromthosebuiltinpGOv5whichareinE.coliDH5α.
Hiranietal.BMCBiotechnology2013,13:1 Page6of13
http://www.biomedcentral.com/1472-6750/13/1
published expression patterns was scanned by eye and Subsequent investigation of expression patterns pro-
cloneWRM069dD11,containingthreesuchgeneslocated ceeded by examination of lines transformed with the
approximately centrally within the insert, was identi- F-CFP/F-YFP/Mc-mCherry-tagged constructs. F09E5.3
fied.WRM069dD11containsthegenesF09E5.3,F09E5.15 encodes aDERAhomologthat shares 72%similarity and
(prdx-2)andEEED8.6(ccpp-6)thatencode,respectively,a 54%identitywithhumanDERA(datanotshown).DERA,
putativedeoxyribose-phosphatealdolase(DERA),aperox- as part of the pentose phosphate shunt, catalyzes the
iredoxinandametallocarboxypeptidase(Figure1).Theit- reversible reaction of 2-deoxy-D-ribose 5-phosphate to
erative recombineering workflow generated single, double D-glyceraldehyde 3-phosphate and acetaldehyde [31] and,
and triple-tagged constructs for both the mTFP1/mCi- as such, might be expected to exhibit widespread expres-
trine/mCherry and F-CFP/F-YFP/Mc-mCherry FPcombi- sion consistent with an enzyme involved in intermediate
nations (Additional file 1: Figure S4 and Figure 2). metabolism.Indeed,examinationofstrainsCTD1059and
Transgeniclinesweregeneratedforthesingle-andtriple- CTD1055 (Additional file 1: Table S7), that were trans-
tagged variants and resulting expression patterns in- formed, respectively, with the F09E5.3::F-CFP (fNH058)
vestigated (Figure 3). Microscopic examination of the and the triple gene-tagged construct (fNH086), revealed
lines revealed that, as noted previously for the myo- diffuse F-CFP expression throughout the hypodermis, in-
3PROM-driven transcriptional constructs, the mCitrine testine and pharynx (Figure 3, panels A-D, R). Similarly,
and mCherry fusion proteins, even when encoded by strain CTD1050 (Additional file 1: Table S7), trans-
CDSswith2 introns, were, asdetermined byeye,visibly formedwiththecorrespondingF09E5.3::mTFP1construct
less bright that the respective F-YFP and Mc-mCherry fNH068, exhibited an essentially equivalent expression
equivalents. Whatever the cause(s) the low signal levels pattern(Figure3,panelsE,F).Thisgeneralizedpatternof
made discerning clear expression patterns for the two fu- expression was in agreement with that previously pub-
sion genes, F09E5.15::mCitrine(2I) and EEED8.6::mCherry lished for strain BC14910 that had been generated by
(2I), difficult and further examination of the correspond- transformation with a corresponding F09E5.3PROM tran-
ing lines was not pursued. Interestingly, mTFP1-expres- scriptionalstylereporterconstruct(Figure1)[32,33].
sing worms were, consistently, as bright as the otherwise F09E5.15 (prdx-2) encodes one of the two 2-Cys
equivalent F-CFP-expressing strains confirming that peroxiredoxins expressed in C. elegans. These conserved
mTFP1, as encoded by the CDS designed here, is a thioredoxin-coupled peroxidases, via their capacity for
useful addition to the FP palette for reporter analysis H O reduction, are important components of the over-
2 2
in C. elegans (Figure 3 panels E, F). All lines transformed all oxidative-stress response employed by multicellular
withareporterconstructbuiltwithoneormoreoftheF- organisms. However, there is also increasing evidence
CFP/F-YFP/Mc-mCherryFPsetexhibitedrelativelybright that they have additional, complex functions including
andeasilyinterpretableexpressionpatterns(Figure3). important roles as regulators of H O -mediated redox
2 2
5kb
F09E5.3 F09E5.15(prdx-2) EEED8.6(ccpp-6)
2kb
Figure1GenomiclocationoffosmidWRM069dD11insert.Upperpanel:genesontheforward(purpleexons)andreverse(greenexons)
strandsoftheinsertfromfosmidgenomiccloneWRM069dD11.Lowerpanel:Anexpandedregionoftheinsertdemonstratingtherelative
locationsofthegenes(boxed)F09E5.3,F09E5.15(prdx-2)andEEED8.6(ccpp-6)forwhichpublished,independentexpressiondatawasavailable.
LocationsofthegenomicregionsusedtodrivegfpexpressioninthetranscriptionalreportersdescribedbyMcKayetal.(2003)ref[32]and
Hunt-Newburyetal.(2007)ref[33](lightgreyboxes)forF09E5.3,F09E5.15andEEED8.6,strainsBC14910,BC13145andBC11803,respectively,
andIsermannetal.(2004)ref[35](darkgreybox)forF09E5.15areindicated(lowerpanel).FigurederivedfromWormBase.
Hiranietal.BMCBiotechnology2013,13:1 Page7of13
http://www.biomedcentral.com/1472-6750/13/1
A NotI NotI
RT-cassette NotI NotI
RT-cassette
RT
RT
F-YFP
B F-CFP
mCitrine(2I)
mTFP(2I)
mCitrine
mTFP
5 kb
F09E5.3 F09E5.15
EEED8.6
mCherry
mCherry(2I)
Mc-mCherry
Figure2Counter-selectionrecombineering-mediatedgenerationoffosmid-basedfluorescentprotein-fusionreporterconstructs.Panel
A:schematicrepresentationofthemodifiedcounter-selectionprotocol.ArpsL-tetA(C)(RT)counter-selectioncassette,PCR-amplifiedfromaNotI
fragmentexcisedfromtheappropriatepCC1Fos-basedconstruct,flankedbyapprox.200bpfromthe50and30endsofthefluorescentprotein
reportertobeinserted(purpleboxes)andterminal50bphomologyarms(stippledboxes),isrecombineeredintotheinsertionsitewithinthe
targetgeneviatetracyclineselectionofthepositivemarker(tetA(C)).InthesubsequentreplacementstepaNotIfragment,containingthe
fluorescentproteincodingsequence,replacestheinsertedRT-cassette,viastreptomycinselectionconferredduetolossofthenegativemarker
(rpsL),generatinganin-framegene::fpfusion.PanelB:aschematicrepresentation,withinthecentreofthepanelanddrawnapproximatelyto
scale,illustratingsizesandorientationsofthegeneslocatedontheinsertofthefosmidcloneWRM069dD11.ThegenesF09E5.3,F09E5.13and
EEED8.6(lightgreysolidarrows)weretagged,respectively,withoneofeitherF-CFP,mTFP1(2I)ormTFP1,F-YFP,mCitrine(2I)ormCitrine,or
Mc-mCherry,mCherry(2I)ormCherry.Reportergenefusionsmarkedwithanasterisklackthe5terminalcodonsofthetargetgene.
signaling [34]. While the generalized anti-oxidant role (fNH058), demonstrated a highly unusual expression pat-
might suggest a relatively widespread distribution for tern that did not conform with either of these previous
PRDX-2 in C. elegans the previously reported expres- reports (Figure 3, panels G-N). F-YFP expression was ob-
sion patterns indicated a more tissue-, even cell-specific servedasintensepunctatefocidistributed,apparentlyran-
localization suggesting that PRDX-2 may play one of domly, throughout the body and that did not co-localize
these more discrete, specialized functional role(s). For with any specific tissue or cell type. Equivalent patterns
example, using a F09E5.15PROM transcriptional reporter wereobserved inother linestransformed withfNH058as
(Figure 1), Isermann et al. (2004) ref. [35] reported that well as those generated from the triple-tagged construct
PRDX-2 expression was restricted to the pharyngeal (Figure 3, panel S). This pattern of concentrated fluores-
interneurons I2 and I4. A more distributed PRDX-2 ex- centfociis difficult tointerpret inthe context ofPRDX-2
pressionpattern,includingheadandtailneuronsandin- function. It might reflect some uncharacterized role but,
testine, was reported in strain BC13145 transformed andpossiblymostlikely,mayalsoresultfromunexpected,
with a similar transcriptional reporter (Figure 1) [32,33]. artifactual aggregation of the fusion protein perhaps
Olahovaetal.(2008)ref.[36] demonstratedsubsequently, initiated and promoted by the presence of the C-terminal
via an immunohistochemical approach, that PRDX-2 was F-YFPsequence. Whilstthis is entirely possible,one ofus
also expressed in gonad and intestine. However, examin- (IAH), with considerable experience in interpreting gene
ation of strain CTD1051 (Additional file 1: Table S7), expression patterns in C. elegans, has not previously ob-
transformed with the single F09E5.15::F-YFP construct served such aggregations suggesting that if they do occur
Hiranietal.BMCBiotechnology2013,13:1 Page8of13
http://www.biomedcentral.com/1472-6750/13/1
AA BB CC EE
DD FF
GG HH II MM
JJ KK LL NN
OO PP QQ
RR SS
TT UU
Figure3Expressionpatterns.Reporterexpressionpatternsinadulthermaphroditestransgenicforfosmid-basedconstructsthattageachof
thegenesF09E5.3(A-F),F09E5.15(prdx-2)(G-N)andEEED8.6(ccpp-6)(O-Q)individually,orcollectively(R-U).F-CFP(B,D,R),mTFP1(E,F),F-YFP
(H,I,K,L,M,N,S)andMc-mCherry(P,Q,T)andmergedF-CFP/F-YFP/Mc-mCherry(U)distributionsarepresented.DICwasusedtoobserve
anatomicaldetailseitheralone(A,C,G,J,O)oraftermergingwiththeassociatedFPimage(s)(I,L,M,N,Q).TheC.elegansstrainsphotographed
wereCTD1059(A-D),CTD1050(E,F),CTD1051(G-N),andCTD1052(O-Q)andCTD1055(R-U)(Additionalfile1:TableS7).Imageswerecaptured
at100x(A,B,E,F,J,K,L,R,S,T,U)or400x(C,D,G,H,I,O,P,Q)magnificationandfluorescenceimagecapturetimeswere2msec(A,C,G,H,
J,K,O,U),5msec(S),250msec(E,F)or1sec(B,D,P,R,T).Confocalimages(M,N)werecapturedat400xmagnification.Mc-mCherry
expressionintheanteriordendriticprojectionsandcellbodiesofonepairofthefourheadcephalicneuronsareindicated(arrowheads)inpanelP.
The location ofthese samecell bodies is also indicated in panel T (arrowheads).Inpanels R-U the approximateoutline ofthe imaged worm is
provided and, inaddition, inpanel T a region ofgranular intestinal autofluorescence prominent following the 1 sec excitationof Mc-mCherry is
also outlined.
withreportergenefusionsitisarareevent.Weweresub- likely artifactual aggregation, is due to the C-terminal ex-
sequently made aware (E. Veal, pers. comm.) that very si- tensionandappearsnottobeFP-specific.
milarpunctateexpressionwasobservedwithaprdx-2::gfp EEED8.6 (ccpp-6), the third gene to be tagged within
translational reporter fusion but not when an N-terminal fosmid WRM069dD11, and ccpp-1 each encode one of
gfp::prdx-2 construct was used. Taken together these two C. elegans cytosolic carboxypeptidases. CCPP-6 has
resultsindicatethatthepunctateexpressionpattern,most beenidentified[37]asadeglutamylasethat,inconjunction
Hiranietal.BMCBiotechnology2013,13:1 Page9of13
http://www.biomedcentral.com/1472-6750/13/1
withtubulintyrosineligase-like(TTLL)glutamylases,me- constructs required to generate fosmid reporters tagged
diate the respective deglutamylation and glutamylation witheithermTFP1,F-CFP,F-YFPorMc-mCherryasthese
of tubulin thereby regulating the microtubular network will be of immediate use to others (Tables 1 and 2).
presentintheC.elegansneuronalsensorycilia.Accpp-1:: Constructs containing sequences encoding mCerulean,
gfptranscriptionalreporterrevealedCCPP-1expressionin mCitrine and mCherry, encoded by the codon-optimized
head neurons, specifically amphids, which were also sequencesdesignedbyus,areavailablefromCTD.
demonstrated to exhibit TTLL-dependent tubulin gluta-
mylationactivity[37].Interestingly,accpp-6::gfptranscrip- Conclusions
tional reporter suggested labial neuron expression for We have described the generation and utility of con-
CCPP-6 whereas, in contrast, a translational version indi- struct collections designed to simplify and facilitate the
cated expression in putative amphid cell bodies [37].This building of fosmid-based FP reporter constructs via
discrepancy was attributed to the inclusion of a possible counter-selection recombineering. Use of the resource
enhancer(s) in the latter construct. Examination of strain generates final recombineered products that are invari-
CTD1052 (Additional file 1: Table S7), transformed with ably free of unwanted sequence artefacts and, as such,
the single EEED8.6::Mc-mCherry construct (fNH060), can be used directly to create transgenic animals with
demonstrated clear, distinct reporter expression in head the need for only minimal fidelity checking. Although
neuron cell bodies and anterior dendritic extensions. some of the FPs encoded displayed undesirable charac-
Careful examination of the relative location of the cell teristics, such as rapid bleaching and poor brightness,
bodies (Figure 3, panel Q) identified these as likely to be the remaining constructs represent a valuable resource
the mechanosensitive CEP cephalic neurons. This inter- that both simplifies the overall procedure and increases
pretation was confirmed by additional confocal micros- significantly recombineeringefficiency.
copy (data not shown). Localized CEP neuron expression
was observed in other lines transformed with EEED8.6:: Methods
Mc-mCherry (data not shown) and the triple-tagged con- C.elegansculture,strains,transformationandmicroscopy
struct (Figure 3, panel T). Lines transformed with the C.elegans culture, handlingandmanipulationswereper-
latter construct exhibited unrelated punctate fluores- formed according to standard methods. The wild-type
cence in the red channel due to bleed-through from Bristol N2 strain [1] was transformed by co-injection
excitation of the concentrated foci of F09E5.15::F-YFP. [39] of either plasmid (100 ng/μl) or fosmid (10 ng/μl)
The clear CEP expression observed here for EEED8.6 DNA together with marker plasmid pRF4 (100 ng/μl).
agreed with previously published expression data for pRF4 contains rol-6(su1006) which confers a rolling
strain BC11803 generated bytransformationwitha cor- phenotype by which transformants can be recognized
responding EEED8.6PROM transcriptional style reporter and transgenic lines maintained. Each transgenic strain
(Figure 1) [32,33]. Thus, interestingly, it would appear was established from a different injected animal and
that CCPP-6 is expressed predominantly in the cells of therefore is independently generated. FP expression pat-
the cephalic sensilla, whereas CCPP-1, that lacks detec- terns were observed, in hermaphrodites only, by fluores-
tabledeglutamylaseactivitybut co-localizeswithTTLL- cence microscopy on an Olympus BX61 equipped with
mediatedglutamylation[37]is,incontrast,expressedin DIC optics, filter sets designed to acquire GFP (Chroma,
theamphidneurons. 41012), CFP, mCerulean and mTFP1 (Semrock, CFP-
The use of recombineering to build, directly from a 2432A), YFP and mCitrine (Semrock, YFP-2427A) and
genomic clone, a translational-style C. elegans reporter mCherry (Semrock, mCherry-A) and CellSens (v.1.4)
fusion construct is gaining in popularity and a number software. Confocal images were captured with a Zeiss
ofrelatedmethodologies have been described[5,7-9]. All LSM510META systemandLSM510(v.3.4) software.
these different approaches represent variations on a
common methodological theme and, although all are Generalmolecularandbioinformaticmethods
welcomed as attempts to make the procedure easier and Unless otherwise stated classical genetic engineering uti-
more robust, they will, as discussed [38], have relative lized standard protocols [40]. Restriction and modifying
strengths and weaknesses. As is often the case, the enzymes were from NEB (UK) and oligonucleotides
choice of which to use will depend upon application and (ODNs)from IDT(Belgium). ODNsforprimingsequen-
personal preference. We have generated a construct re- cing or standard PCR reactions were desalted whereas
source that further simplifies the approach used by us long (>70 nt) ODNs designed to generate linear recom-
enabling the rapid construction of fosmid-based reporter bineering amplicons were either PAGE-purified or ultra-
fusion constructs seamlessly tagged, ifdesired, with mul- mer grade. All PCRs were performed in volumes of
tiple FP reporters. From this resource we are making 50 μl containing 15 pmol of each ODN primer and
available, through the plasmid depository Addgene, those 200 mM of each dNTP and were catalyzed with a high-
Hiranietal.BMCBiotechnology2013,13:1 Page10of13
http://www.biomedcentral.com/1472-6750/13/1
fidelity DNA polymerase (Phusion, NEB) using condi- togeneratetheinitialRT-cassette,smallerculturevolumes
tions designed to minimize mis-incorporation. ODN de- and incubation times, and no formal requirement to se-
sign, cloning strategies and sequence alignments were quence final recombinants. A volume (2–3 ml for each
performed using MacVector software (MacVector, Inc.). RT-cassette-containing PCR product to be introduced) of
Aconstructderiveddirectlyfromacloneoriginatingfrom liquidmedium(SOB(−Mg)plusCm),wasinoculatedwith
the C. elegans genomic library constructed in the copy an aliquot (1 in 10 v/v) from an overnight ‘target fosmid
number-inducible fosmid vector pCC1Fos (D. Moerman, clone’-containingMW005mini-culture(150r.p.m.,32°C),
pers.comm.)andwhichthusretainsthefosmidbackbone incubated on (approx. 2 h, 150 r.p.m., 32°C) to mid log
is prefixed with an “f” (fosmid). In contrast, non-genomic phase(Ab600approx.0.6),aliquots(1ml)transferredinto
DNAinsert-containingconstructs,irrespectiveofthe vec- each of an appropriate number of micro-tubes, centri-
tor backbone type, are considered plasmids and prefixed fuged, supernatant removed, cells resuspended (1 ml) in
“p” (plasmid). Linear RT-cassette-containing counter- pre-warmed(45°C)mediumandthetube(s)transferredto
selectionmarkersforinsertionwerePCR-amplifiedessen- a shaking incubator (Labnet VorTemp, 100 r.p.m., 45°C,
tiallyasdescribed[5]using,astemplate,arestrictionfrag- 5 min). Each tube was removed, chilled on ice (10 min),
ment excised from the appropriate construct (Additional harvested by brief centrifugation, cells washed (2 × 1 ml
file1:TableS6)andanannealingtemperatureof50°C. ice-coldddH O),resuspended(50μl,ddH O)andelectro-
2 2
porated with an appropriate, purified (Promega, Wizard)
Identificationoffosmidgenomiccloneswithassociated RT-cassette-containing PCR product (500 ng). Recovery
geneexpressiondata (3 h, 32°C) and subsequent positive selection of colonies
Data from WormBase [41] release WS226 was inter- harbouringRT-cassette-containingrecombinantcloneson
rogated to identify candidate pCC1Fos-based genomic LB-agar (Tc, Cm, 36-48 h, 32°C) was performed as des-
clones containing a cluster of genes with associated pub- cribed [5]. Subsequently, the RT-cassette was replaced,
lished expression pattern data. Appropriate filters were via negative-selection recombineering in MW005 cells
applied to these data to remove any data point that did prepared as described above, with the appropriate gel-
not have an associated reference. The remaining data purifiedNotI-NotIfragment (50ng)excised fromthe cor-
were then converted into alistofgenes byexploiting the rect ‘replacement’ construct (see below). Selection of
high levels of connectivity in the ACeDB [42] schema desiredrecombinant-containingcoloniesonNoSalt(NS)-
developed by the WormBase project. The gene co- LBagar(Sm,Cm,36-48h,32°C),subsequentpropagation
ordinate data were used to align with the fosmid clone in liquid culture, induction of copy-number (‘CopyCon-
genomic positions by performing a GFF (General Fea- trol’,Epicentre)andfosmidDNAisolationwereperformed
ture Format) union to generate Gene::Fosmid connec- as described [5]. Gross fidelity of final constructs was
tions. These data were then clustered and sorted on determinedbyREanalyses.
fosmid ID to produce a candidate list of over 4000
clones that contain three or more genes each of which
hasapublishedexpressionpattern. CodingsequencedesignandbuildingpGOv5-and
pPD95.86-basedsub-clones
Two-step,counter-selectionrecombineering DNA sequences encoding the FPs mCerulean [18],
All recombineering was undertaken in E. coli strain mTFP1 [19], mCitrine [20] and mCherry [17], plus N-
MW005 [6] that supports both λ Red- mediated recom- and C-TAP-tags, were codon-optimized for expression
bineering and copy-number induction of pCC1Fos- in C. elegans and, by careful placement of appropriate
based fosmid clones. Positive selection of recombinants RE sites, designed to be modular in nature to facilitate
via the RT-cassette employed tetracycline (Tc, 5 μg/ml) subsequent sub-clone creation (detailed in supplemental
plus chloramphenicol (Cm, 10 μg/ml) to select for the data and Additional file 1: Figure S1). The sequences
pCC1Fos backbone. On occasion, and as indicated in were commercially synthesized and provided in propri-
the text, ampicillin (amp, 50 μg/ml) either replaced, or etary vectors. The lack of common RE sites in one of
was used in combination with, Tc. Negative selection – these, pGOv5, facilitated the subsequent generation in
used when selecting for the targeted replacement of this plasmid vector of sets of sub-clones, one for each
the RT-cassette – was achieved with streptomycin (Sm, FP CDS, representing those module combinations likely
500 μg/ml) and Cm (10 μg/ml). Recombineering, when to be most useful. These included N- and C-TAP-tagged
employed at the start of the project as a tool to generate FPsand FP CDSs containing one or two artificialintrons
resource components, was performed essentially as des- (Additional file 1: Table S1). Following generation of
cribed [5]. Subsequent access to these resources enabled these pGOv5-based sub-clones a number of the insert
the following simplified, more streamlined recombineer- sequences, together with sequences encoding F-CFP, F-
ingprotocolto bedevelopedrequiringonly a single PCR YFP and Mc-mCherry, were each transferred into the
