Table Of ContentInt.J.Curr.Microbiol.App.Sci (2014) 3(4): 401-414
ISSN: 2319-7706 Volume 3 Number 4 (2014) pp. 401-414
http://www.ijcmas.com
Original Research Article
Assessment Mixed Culture of Actinomyces and Sacchromyces for
biodegradation of Complex Mineral Oil hydrocarbon
Ahmad F. Shahaby1,2*
1College of Medicine, Biotechnology and Genetic Engineering Unit, Taif University, Taif, Saudi
Arabia, 2Cairo University, College of Agriculture, Department of Microbiology, Cairo, Egypt
*Corresponding author
A B S T R A C T
The biodegradation of mineral oil hydrocarbon by mixed culture of hydrocarbon-
degrading organisms was investigated. The mixture or consortium of bacteria,
denoted as AS2 consisted of 2 microorganisms. Microorganisms were Actinomyces
octodloyts, Saccharomyces cerevieace. Microorganisms used in this study were
Keywords from the Biotechnology and Genetic Engineering Research Unit (BGERU)
Microbial Bank collection strains, at Taif University, KSA and were isolated from
hydrocarbon-contaminated soil samples by enrichment technique on hydrocarbons
Bioremediation
as the sole carbon and energy source. The strains of the mixture were identified as
control;
Actinomyces octodloyts, and Saccharomyces cerevieace, by means of 16S-rRNA
Mixed
genetic method. The strains were selected based on the criteria that they were able
cultures;
to display good growth under complex mineral oil. Each of these strains
Biosurfactant;
demonstrated a strong ability to grow as a single strain on a hydrocarbon as sole
16S-rRNA
carbon source. Their ability to degrade complex mineral oil hydrocarbon were
gene.
monitored by gas chromatography (GC) for 6 days. The biodegradation percentage
of mineral oil at 3% ml/L in liquid medium was 41.8% after 4 days of growth only.
Potential biosurfactant production tested using the two methods named modified
drop collapse (MDC) and blue agar plate (BAP) showed that the species are
biosurfactant producers. Thus, these two isolates have potential to be useful for
bioremediation of sites highly contaminated with petroleum hydrocarbons.
Introduction
Hydrocarbon degradation in soil by
environment. Bioremediation is a modern
microorganisms has undergone renewed
method in which the natural ability of
emphasis because of the increased
microorganisms is employed for the
incidence of petroleum-based pollution.
reduction of the concentration and/or
Knowledge about hydrocarbon
toxicity of various chemical substances,
degradation is needed to determine how
such as petroleum derivatives, aliphatic
microorganisms might be utilized in the
and aromatic hydrocarbons, industrial
removal of the pollutants from the
solvents, pesticides and metals. The class
401
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 401-414
of petroleum products known as mineral members of 6 genera to be able to
oils can be generally understood to include effectively degrading crude oil.
a variety of products which go by different
names such as white oils, lubricating oils, The vast range of substrates and
light fuel oils, residual fuel oils, as well as metabolites present in hydrocarbon
transformer and cable oils (Gary and impacted soils surely provides an
Handwerk, 2001). Mineral oils refer to all environment for the development of a
oils which are made from dewaxed quite complex microbial community
paraffin-based crude oils which are (Butier and Mason, 1997). Microbial
blended with additives to particular populations that consist of strains that
properties for specific uses (Aluyor and belong to various genera have been
Ori-jesu 2009). Mineral oils are composed detected in petroleum-contaminated soil or
of straight and branched chain paraffinic, water (Sorkhoh et al., 1995, Chikere et
naphthenic, and aromatic hydrocarbons al.,2009). This strongly suggests that each
with 15 or more carbons in a complex strain or genera have their roles in the
mixture (Aluyor and Ori-jesu 2009). hydrocarbon transformation processes.
More recently, microbial degradation was
Biological treatment most commonly found to be an available alternative
involves the breakdown of contamination method over the conventional methods.
into nontoxic forms using microbiological Microbial treatment can control
processes (Lee et al., 1998). Therefore, contamination of soils or water with crude
bioremediation may be defined as the use oil, used or fresh petroleum products by
of living organisms to remove reducing the length of the paraffin and oil
environmental pollutants from soil, water molecules and by producing by-products
and gases (Collin, 2001). The advantages that act as surfactants and paraffin and oil
of employing mixed cultures as opposed to solvents. However, information on
pure cultures in bioremediation have been numbers and local species of
demonstrated. It could be attributed to the microorganisms as well as their efficiency
effects of synergistic effects among in degradation of complex mineral oil in
members of the consortium. Moreover, Saudi Arabia is scarce. However, the
some substances can be decomposed only biodegradation of these compounds using
by cometabolism. The mechanisms in mixed cultures or microbial consortia
which petroleum degraders benefit from isolated from contaminated sites with
synergistic relationships may be complex. petroleum products has not been evaluated
It is possible that one species removes the and these microorganisms are adapted to
toxic metabolites of the species preceding grow and thrive under environments with
it. It is also possible that the second high concentrations of complex mineral
species are able to degrade compounds oils, and the effects of environmental
that the first are able to only partially factors on the microbial growth are not
degrade it (Alexander, 1999). Further known yet.
research should be directed towards
understanding the roles of individual High molecular weight hydrocarbons are
members in influencing the effectiveness highly difficult to degrade. High molecular
of a microbial consortium or mixer. weight biosurfactants are highly efficient
Rambeloarisoa et. al. (1984) demonstrated emulsifiers that work at low
a consortium of 8 strains made up of concentrations and exhibit considerable
402
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 401-414
substrate specificity, they are produced by recently recorded that suitable sequence
a large number of bacteria and they are differences in the 16S- rRNA gene could
composed of polysaccharides, proteins, be used for bacterial identification (Sacchi
lipopolysaccharides, lipoproteins etc. et al. 2002) and for subtyping and
(Banat et al., 2000, Zhang et al., 2012). In identifying hyper virulent bacterial clones
general microorganisms produce (Nilsson et al. 2003).
biosurfactants to increase their interfacial
area for contact to give improved uptake This work represents a continuation of our
of hydrophobic substrates. However, it has research in the area of hydrocarbon
been observed that the exopolymers biodegradation technology. The present
synthesized by these strains in media with study aims to characterize isolates using
glucose as carbon and energy source, had 16S-rRNA gene technique, to produce
a remarkable capacity of emulsifying biosurfactant and to degrade complex
hydrocarbon compounds (Martinez-Checa mineral oil as sole carbon substrate source
et al. 2002, Zhang et al., 2012). Microbial in pure culture or mixed culture
treatment can control hydrocarbons efficiently.
pollution by reducing the length of the
hydrocarbon molecules and by producing
by-products that act as biosurfactants and Materials and Methods
solvents (Banat, 1995 and Wolicka et al.,
2009). Microbial strains
The phylogenetic diversity of microbial Microorganisms were Actinomyces
communities can be tested by molecular octodloyts AF104, Saccharomyces
methods, like fingerprinting or cloning and cerevieace AF203. Microorganisms used
sequencing of PCR-amplified rRNA in this study were from the Biotechnology
genes. These techniques have been and Genetic Engineering Research Unit
employed to isolates and consortia (BGERU) Microbial Bank collection of
enriched from natural environments. The strains, at Taif University, KSA. Strains
16S-rRNAmethod was also used to were local isolated strains from mechanic
monitor the microbial diversity in workshops and gas stations contaminated
environments and to follow transitions in soils by enrichment culture technique in
community structure upon seasonal our previous work in our laboratory. The
changes or along spatial gradients in two isolates showed good growth on
salinity, temperature, and availability of Bushnell- Haas enrichment mineral
substrates and minerals (Kleinsteuber et. medium(BHM) amended with
al. 2006). The use of 16S- rRNA gene hydrocarbon and were selected based on
sequencing to examine genetic relatedness the growth and degradation ability.
of prokaryotic species is well established
and has led to increased availability of Growth potential of hydrocarbon-
16S- rRNA databases. The convergence of utilizing microorganisms
these technical and computational
advances has also enhanced the Inocula were routinely grown in Luria
application of 16S- rRNA gene sequence Bertani (LB) broth medium (g L 1):
analysis to bacterial identification peptone, 10.0; yeast extract, 5.0; NaCl, 5.0
(Rantakokko-Jalava et al. 2000). It was (Miller, 2007). Media were autoclaved at
403
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 401-414
120 °C for 20 min. Cultures were grown Biodegradation of hydrocarbons
overnight first on LB medium without
hydrocarbon addition. Then, grown on Strains were incubated overnight in 50 ml
Bushnell- Haas enrichment mineral LB broth medium in triplicate, pH 7.5 at
medium (BHM) containing (g/l): 30oC (shaken culture: 150rpm). Cells were
MgSO .7H2O, 0.2; K HPO , 1.0; centrifuged and washed twice with the
4 2 4
KH PO , 1.0; FeCl , 0.05; NH NO , 1.0; liquid inorganic salts BHM. The pellet was
2 4 3 4 3
CaCl , 0.02; pH to 7.2 and sterilized at suspended in 5ml BHM and inoculated
2
121oC for 15 min. Bacteria were grown in into 250 ml of BHM in 3 flasks
250 ml Erlenmeyer flasks for one week in supplemented with 3 concentrations of
a rotary shaker. Flasks were amended with mineral oil: 1, 3 and 5%(v/v) as sole
mineral oil 1, 3, and 5 % (v/v) for each carbon and energy sources.
organism. The pH of media was adjusted
to 7. One ml was taken to measure Biodegradation Efficiency
turbidity at 595 nm with
spectrophotometer. Growth on mineral oil Samples taken from the flasks were mixed
was monitored by measuring the optical with equal volumes of hexane and shaken
density (O.D.) at 595 nm in 2 ml cuvettes to extract mineral oil. Residual mineral oil
using a spectrophotometer (Biophotometer was monitored using the method used by
plus, Eppendorf). Martinez-Checa et. al. (2002).
The net dry weight for the biomass was Biosurfactant production screening
determined simultaneously. A 1 mL of using the modified drop collapse
culture was centrifuged at 1500 rpm for 10 method (MDC)
min, washed twice with distilled water,
poured into a pre-weighed container, dried To prepare the assay, three plates were
overnight at 90 °C to constant weight and rinsed successively with hot water, 75%
cooled for reweighing. Mineral oil adapted ethanol, distilled water and dried with air.
cells were harvested and washed twice After preparation, plates were equilibrated
with BHM and the pellet suspended in and coated with a thin layer of crude oil.
0.1M phosphate buffer at pH 7.0. Cells The preparation was left for 24 h to ensure
were harvested by centrifugation for 5 min a uniform oil coating. Bacterial or yeast
at 3,000 x g at room temperature. The suspensions of all isolated strains were
growth rates of cultures in exponential prepared and OD (595 nm) was adjusted to
phase were determined from linear 0.8 for each strain. A volume of 0.5 l of
regressions of log10 absorbency vs. time, each organism suspension was transferred
calculating a least squares fit of data from on the thin oil layer.The shape of the drop
the exponential growth phase, and was inspected after 1 min; if the drop
determining the slope of this line. The remained beaded, the result was scored as
instantaneous growth rate ( ) was negative (-). If the drop collapsed, the
determined from the slope of this line x result was scored as positive (+) (Bodour
ln10; had the dimensions h-1 (Koch, and Miller-Maier, 1998).
1984).
404
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 401-414
Biosurfactant production screening of each primer and 12.5 l of 2xSuperHot
using the blue agar plate method (BAP) PCR Master Mix (Bioron, Ludwigshafen,
Germany) mixed with 50 to 100 ng of
This method shows an ionic biosurfactant DNA template. Sterile d. H O was added
2
producing strains by color reaction. to a final volume of 25 l. Thermal cycler
Mineral salts agar medium (MSA) (Uno II, Biometra, Germany) with the
(Siegmund and Wagner, 1991) following thermal profile: 94 °C for 4
supplemented with carbon sources min., 94 °C for 1 min., 55 °C for 1 min.,
(glycerol), 2%, cetyltrimethylammonium 72 °C for 1.5 min, the number of cycles
bromide (CTAB) 0.5 mg/ml), methylene was 35 cycle and the post PCR reaction
blue (0.2 mg/ml) were prepared. Three time was 72°C for 5 min.
Plates was streaked with organism of
interest and incubated at 30°C for 24 h. A Analysis of the PCR products
dark blue halo around the culture was
considered as positive for biosurfactant The PCR reaction products were
production. Sodium dodecyl sulfate electrophoresed with 100 bp ladder marker
(SDS), 1 mg/l and sterile distilled water (Fermentas, Germany) on 10 x 14 cm
were used respectively as positive and 1.5%- agarose gel (Bioshop, Canada) for
negative controls. 30 min using Tris-borate- EDTA Buffer.
The gels were stained with 0.5ug/ml of
DNA extraction, PCR, and sequence ethidium bromide, visualized under the
analysis UV light (Watanabe et al., 2001) and
documented using a GeneSnap 4.00- Gene
DNA Extraction Genius Bio Imaging System (Syngene,
Frederick, Maryland, USA).
The genomic DNA of Actinomyces sp.
sample was extracted using a bacteria Sequencing of 16S-rRNA gene
DNA Preparation Kit and Yeast DNA
Preparation kit (Jena Bioscience, Jena, The PCR-products of each organism was
Germany) according to the manufacturer s purified from excess primers and
instructions (www.jenabioscience.com). nucleotides by the use of AxyPrep PCR
Clean-up kit (AXYGEN Biosciences,
PCR amplification of 16S-rRNA gene Union City, California, USA) and directly
sequenced using the same primers as
Primer sequences used to amplify the 16S- described for the amplification process.
rRNA gene fragment were: primers The microorganisms DNA sequences were
forward fD1 (5'- determined with the chain-termination
CCGAATTCGTCGACAACAGAGTTTG method on an ABI 3730 DNA sequencer
ATCCTGG CTCAG-3') and reverse rD1 by a commercial service (Seoul, Korea).
(5'-CCCGGGATCCAAGCTGGAGGT G Sequences were aligned in the GenBank
ATCCAG CC-3') for Actinomycetes and database using the BLASTN program at
primers P1 (ATCAATAAGCG the National Center for Biotechnology
GAGGAAAAG and P2 Information (NCBI), and percent
CTCTGGCTTCACCCTATTC for yeast homology scores were obtained to identify
as described by Ren et al. (2007). The microorganisms.
PCR reaction mixture contained 10 Pmol
405
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 401-414
Statistical analysis Psedomonas aeruginosa, Bacillus subtilis
and Halomonaseurihalina (moderately
Statistical analysis was performed using halophilic bacterium) species were
the SPSS 10.0 software. Data underwent a effective bacteria in the biodegradation of
one-way ANOVA test, and means were heavy hydrocarbons (mineral oil) and n-
compared using Duncan s multiple range tetradecane (Martinez-Checa et. al., 2002,
tests at 5% significance level. Sadeghazad and Ghaemi, 2003, Shahaby
and El-Tarras, 2011, and El- Tarras et al.,
Results and Discussion
2012, Shahaby et al., 2013).Isolation of
alkane degrading microorganisms from oil
Identification of microbial candidates contaminated soil has been reported by
several researchers. Nazina et al (2005)
Mixtures of organisms were obtained have obtained hydrocarbon oxidizing
during enrichment using 0.1% yeast Geobacilli strains from formation waters
extract in BHM. Screening on an agar of oil fields.
plate containing mineral oil resulted in
isolation of several candidates from the Nucleotide sequence accession numbers
contaminated sites. Two isolates of
Actinomycessp. and three isolates of The partial 16S-rRNA gene sequences that
Saccharomyces sp. were identified and were determined have been deposited in
characterized. Strains AF104 and AF203 the GenBank, EMBL, and DDBJ
were local isolates isolated by enrichment nucleotide sequence databases under
technique and deposited in our microbial accession no. NJ700209 for
bank at Taif University during our Saccharomyces cerevieceae AF203 and
previous work (Shahaby and El-Tarras, NJ700210 for Actinomyces
2011) in our laboratory. The isolates were odontolyticus AF104.
identified on the basis of their cultural and
biochemical characteristics according to Growth rates and biomass of the
Bergey's Manual of Determinative microbial candidate's mixture
Bacteriology (9th edition) (Holt et al.,
1994) and Apikit profiles (2009). Optical density and biomass were
Phenotypic examination of the recovered determined simultaneously. The linear
microorganisms revealed that they belong relation between OD and dry mass was
595
to the genera of Actinomyces, and obtained during growth on 1% of mineral
Saccharomyces. Two isolates AF104 and oil. The specific growth rate and net dry
AF203 showed good growthon BHM weight of the two isolates were determined
amended with complex mineral oil and and illustrated in Table 1. These figures
were selected based on the growth and indicate the effluence of the specific
degradation ability. Strains AF104 and growth rate and biomass precipitation on a
AF203 showed optimal growth at 30oC. period of bacterial cultivation in BHM
The results of 16S-rDNA sequence containing 1 % (v/v) hydrocarbon. Little
alignment analysis revealed that 16S- adaptation occurred at 5% mineral oil,
rDNA sequence of strain AF104 and indicating that the highest hydrocarbon
AF204 were more than 98% identical to exceeded the strains capability to
that of Actinomyces octodloyts, and adapt.Table (1) summarize the results of
Saccharomyces cerevieace, respectively. growth rates, and biomass content during
406
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 401-414
growth at 1% (v/v) concentration of mineral oil as sole carbon source however,
complex mineral oil for a week under the efficiency of utilization varied among
laboratory conditions. The specific strains, with AF203 being the best (40.2%
growth rates of the two isolates on mineral removal within 5 days) at 5% hydrocarbon
oil showed that strain AF203 was faster concentration.AF104 was able to degrade
than strain AF104in growth in mineral mineral oil by more than 38.3%, whereas
salts medium BHM containing 1 % (v/v) the mixture of AF104 and AF203 named
hydrocarbon. Most growth occurred in the (AS2) could degrade about 41.8% after 4
first2 days for the two strains resulting in days only at 3% concentration of
good biomass production (Table 1). hydrocarbon. Two reference strains
Maximum specific growth rates ( ) for Actinomyces, Saccharomyces used as
max
AF104 and AF203 strains were occurred negative control could only degrade
after two and three days of growth being approximately 9 and 7% of mineral oil,
0.073 h 1 and 0.064 h 1, respectively. respectively under the same conditions
Strains were also grown on 3% and 5% (data not shown). The results on the
hydrocarbon (data not shown). However, assessment for degradation capacity were
growth on 1% hydrocarbon was better similar to those of growth (Fig. 1). In
than 3 and 5 % (v/v) concentrations. mineral oil 5% -supplemented BHM, a
Moreover, isolate AF203 produced more small degree of degradation was observed
biomass from hydrocarbon being 3.85 g only in cases of using consortium of
cells l-1mineral oil hydrocarbon after six AF104 and AF203 strains (AS2) being
days of growth. No change was observed 32.3 % after 2 days only. The consortium
in pH during the first seven days of degrades 39.4% of hydrocarbon after 2
incubation for strains. days only at concentration 3%. Mineral oil
was utilized to the extent of 38.3% for
The reduction in heavy hydrocarbon AF104 after 6 days at 5% concentration,
fractions by biodegradation of paraffinic 40.2% after 5 days at 5% concentration
hydrocarbons using Pseudomonas and and 39.4% for consortium of both AF104
Actinomyces species was noticed (Etoumi, and AF203 (AS2) after 2 days only of
2007). It was mentioned that the lower the growth. Strain AF203 was more efficient
concentration of hydrocarbons the higher than strain AF104 being 40.2% and 38.3%
was the utilization. Similar growth rates at 5% concentration, respectively. One
and biomass on hydrocarbon were might thus expect that incubation at 3% or
obtained (Etoumi, 2007, Shahaby and El- 5% hydrocarbon beyond6 days would
Tarras, 2011). have resulted in even more mineral oil
degradation than the 41.8% observed.
Degradation capacity of hydrocarbon Interestingly, CFU and total cell counts at
by isolates 3% and 5% concentration were even
higher than those in the maximally active
The hydrocarbon degradation capacity of incubation at 1% hydrocarbon
selected isolates in BHM supplemented concentration (data not shown). This
with complex mineral oil are illustrated in indicates reduced hydrocarbon degradation
Fig. 1-3. No evaporation of hydrocarbon per cell at the higher mineral oil
from the screw-capped flasks was concentration, which goes along with
observed throughout the experiments. All lower protein content per cell. The
isolates showed the ability to utilize maximally active incubation at 1%
407
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 401-414
hydrocarbon preserved the highest Saadoun (1997) determined ability of
metabolic versatility. Given that the two Rhodococcus erythropolis to degrade
strains were capable of strong growth in mineral oil and other hydrocarbons by
both solid and liquid media at 30°C and using a Warburg constant volume
3% or 5% of hydrocarbon as sole carbon respirometer. Results of oxygen uptake
source, we tested the performance of each indicated that hexane and tetrade cane
of the two strains separately via rotary were more degradable than mineral oil and
shaker under these conditions Table (2) decane. R. erythropolis exhibited highest
and Fig. 1-3.However, these percentages QO values (2.9 and 2.8) when exposed to
2
also demonstrated a moderate level of tetradecane and hexane, respectively.
mineral oil biodegradability by each of Mineral oil and decane were degraded
these two strains performed separately at more slowly with QO values 0.87 and
2
5% concentration. 0.94, respectively. Alvarez et al. (2011)
evaluated the effectiveness of monitored
Zhao et al. (2011) selected consortium by natural attenuation, bioenrichment, and
positive end dilution method. The bioaugmentation using a consortium of
consortium consisted of Rhizobiales sp., three actinomycetes strains in remediating
Pseudomonas sp., Brucella sp., Bacillus two distinct typical Brazilian soils that
sp., Rhodococcus sp., Microbacterium sp. were contaminated with crude oil, with or
and Roseomonas sp. and removed nearly without the addition of NaCl. Microcosms
52.1% of crude oil at initial concentration were used to simulate bioremediation
of 10,000 mg l 1 at 30 °C within 7 days. treatments over a 120-day period. During
The strains Pseudomonas sp., Brucella sp. this period, they monitored total petroleum
and Rhodococcus sp. likely played a key hydrocarbons (TPHs) and n-alkanes
role in the crude oil degradation(Abdel- degradation and changes in bacterial
Megeed et al., 2012 ).The mixed communities. Over time, they found the
populations of Pseudomonas, degradation rate of n-alkanes was higher
Rhodococcusand Bacillus are capable of than TPH in both soils, independent of the
degrading mineral oil of up to 120 ppm. treatment used. Suggesting that the total
However, biodegradation ofmineral oil bacterial community in the soils was
was fast by the mixed culture comparing mainly affected by the experimental period
to the biodegradtion of each strain of time, while the type of bioremediation
separately. treatment used was the main factor
influencing the actinomycetes populations
Lazar et al. (1999), Pokethitiyook et al. in both soils.Growth on mineral oil before
(2002), and Sadeghazad and Ghaemi exposure to specific hydrocarbon
(2003) reported that, Pseudomonas and compounds was intended as a pre-
Bacilli species were the most effective enrichment step, similar to the initial
microorganisms in the biodegradation of enrichment of polychlorinated biphenyl
heavy hydrocarbons. Lazar et al. (1999) (PCB) degraders on biphenyl (Bedard et
also, stated that microorganisms involved al.,1986,1987) or methylcyclohexane for
with the microbial treatment of crude oil, bacteria able to grow on a wide range of
are generally live, naturally occurring, and alicyclic compounds (Trudgill, 1984).The
are mainly facultative anaerobic, reduction in heavy hydrocarbon fractions
pathogenic, contain no sulphate-reducing by biodegradation of paraffinic
bacteria or slime-forming bacteria and are hydrocarbons using Pseudomonas and
environmentally safe. On the other hand,
408
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 401-414
Table.1 Growth rates, biomass yield and biosurfactant production (using MDC and BAP
techniques) of two strains AF104and AF203grown in Bushnel-Hass medium amended with
1% of mineral oil hydrocarbon.
Strains Biomass yield Growth rate Biosurfactant
(g cells /Lmineral oil) (µ) (h-1) production
Actinomyces(AF104) 3.58 0.071
Sacchromyces(AF203) 3.85 0.062
Table.2 Biodegradation performance of complex mineral oil hydrocarbon by aconsortium of
Actinomyces sp.AF104 and Saccharomycessp.AF203 (AS2)
Culture Name Hydrocarbon Incubation time Biodegradation %
concentration% (days)
Sacharomycessp. 3 6 39.5
Actinomycetssp. 5 6 38.3
Mixture of Actinomycessp. and 3 4 41.8
Saccharomyces sp. (AS2)
Fig.1 Performance of ActinomycesAF104 in various concentration of hydrocarbon and
incubation time at 30 oC. M. O., mineral oil content.
M.O 1 %
M.O 3 %
M.O 5 %
Fig.2 Performance of Saccharomyces AF203 in various concentration of hydrocarbon and
incubation time at 30 oC. M. O., mineral oil content.
M.O 1 %
M.O 3 %
M.O 5 %
409
Int.J.Curr.Microbiol.App.Sci (2014) 3(4): 401-414
Fig.3 Performance of ActinomycesAF104 and Saccharomyces AF203 consortium (AS2)
under various concentration of hydrocarbon and incubation time at 30oC. M. O., mineral oil
content
M.O 1 %
M.O 3 %
M.O 5 %
Actinomyces species was noticed (Etoumi, consortium of 8 strains made up of
2007). It was mentioned that the lower the members of 6 genera to be able to
concentration of hydrocarbons the higher effectively degrading crude oil
was the utilization (El_Tarras et al., 2012, (Rambeloarisoa et al. 1984). Interestingly,
Shahaby et. al., 2013). Biodegradation only 5 of these strains were able to grow in
would be required if the contaminated site pure cultures using a variety of
lacked proper microorganisms (Kauppi et hydrocarbons. However, when the other 3
al., 2011). Therefore, isolation of pure strains were removed from the consortium,
microbial strains or enrichment of the effectiveness of the mixed culture was
microbial consortium from contaminated remarkably reduced. These further support
sites for biodegradation of hydrocarbons is the theory that each member in a microbial
considered as an approach to provide community has a significant role and may
inocula for bioaugmentation (Liu et al., need to depend on the presence of other
2011 and Kauppi et al., 2011). Due to species or strains to be able to survive
microbial complexity and diversity, a
microbial consortium could work better Production of biosurfactant
and more stable than pure culture for the
bioremediation of crude oil-contaminated Biosurfactant are produced by many
soil. Mainly because that crude oil is a bacterial strains that can degrade or
complex mixture consisting of aliphatics, transform the components of petroleum
aromatics, resins and asphaltenes (van products. They are non-toxic, non-
Hamme et al., 2003 and Malina and hazardous, biodegradable and
Zawierucha, 2007). Although, a crude oil- environmentally friendly compounds
degrading consortium could be made up (Banat et al., 2000).Using the two
by combining a number of individual qualitative methods (MDC and BAP),
microbial strains, the bioremediation results demonstrated that Actinomyces sp.
performance of the combined bacteria AF104 and Saccharomyces sp.AF203
usually is not satisfactory (Komukai- strains used in this study were
Nakamura et al., 1996 and Ko and biosurfactant producers (Table 1).
Lebeault, 1999). Demonstrated a
410
Description:Actinomyces octodloyts, and Saccharomyces cerevieace, by means of 16S-rRNA
effectively degrading crude oil. Marine Actinobacteria isolated from.